Cas9

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 International Journal for Parasitology xxx (2014) xxx–xxx 1

Contents lists available at ScienceDirect

International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara 5 6

Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9

3 4 7 8 9 11 10 12 1 2 4 8 15 16 17 18 19 20 21 22 23 24 25 26 27

Q1

Jun Zheng, Honglin Jia ⇑, Yonghui Zheng Harbin Veterinary Research Institute, CAAS-Michigan State University Joint Laboratory of Innate Immunity, State Key Laboratory of Veterinary Biotechnology, Chinese Academy of Agricultural Sciences, Maduan Street 427, Nangang District, Harbin 150001, PR China

a r t i c l e

i n f o

Article history: Received 23 June 2014 Received in revised form 19 September 2014 Accepted 22 September 2014 Available online xxxx Keywords: Toxoplasma gondii Leucine aminopeptidase CRISP/Cas9 Growth Invasion

a b s t r a c t Leucine aminopeptidases of the M17 peptidase family represent ideal drug targets for therapies directed against the pathogens Plasmodium, Babesia and Trypanosoma. Previously, we characterised Toxoplasma gondii leucine aminopeptidase and demonstrated its role in regulating the levels of free amino acids. In this study, we evaluated the potential of T. gondii leucine aminopeptidase as a drug target in T. gondii by a knockout method. Existing knockout methods for T. gondii have many drawbacks; therefore, we developed a new technique that takes advantage of the CRISPR/Cas9 system. We first chose a Cas9 target site in the gene encoding T. gondii leucine aminopeptidase and then constructed a knockout vector containing Cas9 and the single guide RNA. After transfection, single tachyzoites were cloned in 96-well plates by limiting dilution. Two transfected strains derived from a single clone were cultured in Vero cells, and then subjected to expression analysis by western blotting. The phenotypic analysis revealed that knockout of T. gondii leucine aminopeptidase resulted in inhibition of attachment/invasion and replication; both the growth and attachment/invasion capacity of knockout parasites were restored by complementation with a synonymously substituted allele of T. gondii leucine aminopeptidase. Mouse experiments demonstrated that T. gondii leucine aminopeptidase knockout somewhat reduced the pathogenicity of T. gondii. An enzymatic activity assay showed that T. gondii leucine aminopeptidase knockout reduced the processing of a leucine aminopeptidase-specific substrate in T. gondii. The absence of leucine aminopeptidase activity could be slightly compensated for in T. gondii. Overall, T. gondii leucine aminopeptidase knockout influenced the growth of T. gondii, but did not completely block parasite development, virulence or enzymatic activity. Therefore, we conclude that leucine aminopeptidase would be useful only as an adjunctive drug target in T. gondii. Ó 2014 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc.

29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51

52 53

1. Introduction

54

Toxoplasma gondii is an obligate intracellular protozoan parasite belonging to the phylum Apicomplexa. The parasite infects most species of domestic animals and birds as well as humans in both developed and developing countries. Up to one-third of the population in the United States is infected with Toxoplasma, whereas in some other countries up to 90% of the populations are infected with T. gondii (McLeod et al., 2000). In immunocompromised individuals and pregnant women, infection with the parasite can cause severe complications (Luft and Remington, 1992). Currently, no vaccine is available to prevent infection in humans, and only the antifolate medicines sulfadiazine and pyrimethamine are available for the treatment of T. gondii in humans (McLeod et al., 2006).

55 56 57 58 59 60 61 62 63 64 65

⇑ Corresponding author. Tel.: +86 18946066070.

However, these drugs are not widely used due to their marked side effects. Therefore, new drugs must be developed to treat toxoplasmosis. Selection and determination of effective novel biological targets is the primary task for Toxoplasma drug development. Parasite proteases are increasingly recognised as potential targets for chemotherapeutic agents. Most of these proteins play important roles in parasite biology. leucine aminopeptidases are metalloaminopeptidases that catalyse the removal of N-terminal amino acid residues, preferentially leucine, from proteins and peptides. Leucine aminopeptidases (LAPs), which are found in animals, plants and microorganisms, comprise a diverse set of enzymes with different biochemical and biophysical properties. These proteins play important roles in physiological processes such as the catabolism of endogenous and exogenous proteins, peptide and protein turnover and processing, modulation of gene expression, antigen processing and defense (Matsui et al., 2006). LAPs of the M17 peptidase family contain two unrelated domains, with the

E-mail address: [email protected] (H. Jia). http://dx.doi.org/10.1016/j.ijpara.2014.09.003 0020-7519/Ó 2014 Published by Elsevier Ltd. on behalf of Australian Society for Parasitology Inc.

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 2 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116

J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx

active site located in the C-terminal domain. LAPs require two metal ions for activity, are generally most active at neutral or basic pH, and are sensitive to bestatin and amastatin (Rawlings et al., 2006). Owing to their essential functions in the life cycle of pathogenic microorganisms such as Plasmodium, Fusobacterium nucleatum and Trypanosoma brucei, LAPs have emerged as novel and promising targets for drug design (Knowles, 1993; Rogers et al., 1998; Skinner-Adams et al., 2012). Furthermore, vaccination trials using Fasciola hepatica LAP (FhLAP) for rabbit immunization showed a strong IgG response and a highly significant level of protection after experimental infection with F. hepatica metacercariae, confirming that FhLAP is a relevant candidate for vaccine development (Acosta et al., 2008). In a previous study, we characterised the enzymatic activity of T. gondii LAP (TgLAP) (Jia et al., 2010). However, it remains to be determined whether LAP is an ideal drug target in Toxoplasma. To demonstrate the suitability of TgLAP as a drug target, we sought to investigate the impact of knocking out the TgLAP gene on parasite growth and invasiveness. However, existing knockout technologies for use in protozoan parasites have many limitations and are unable to fully silence targeted genes. Using LAP as a proofof-principle target, we used the clustered regularly interspaced short palindromic repeats-associated 9 (CRISPR/Cas9) genome editing system to demonstrate the feasibility of this methodology for targeted gene knockout in this organism (Cho et al., 2013). Using a novel ‘‘all-in-one’’ T. gondii delivery vector that heterologously expressed both a codon-optimised Cas9 and its synthetic guide RNA (gRNA), we demonstrated robust disruption of the CRISPR-modified TgLAP locus. Furthermore, by linking Cas9 expression to GFP fluorescence and dihydrofolate reductase (DHFR) resistance, we were able to track and screen the genedisrupted TgLAP parasite (DTgLAP) in host cells. Taken together, these results establish Cas9 genome editing as a powerful and practical approach for functional study of proteins in T. gondii.

117

2. Materials and methods

118

2.1. Parasites

119

Toxoplasma gondii RH strain tachyzoites were maintained in Vero cells cultured in minimum essential medium (Sigma, USA) supplemented with 8% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin at 37 °C in a 95% air/5% CO2 environment. To purify T. gondii tachyzoites, parasites and host cells were washed in cold PBS. The final pellet was resuspended in cold PBS and passed three times through a 27-gauge needle. The parasites were then passed through filters with 5.0 lm pores (Millipore, USA), washed twice with PBS and stored at 80 °C until use.

120 121 122 123 124 125 126 127

128 129 130 131 132 133 134 135 136 137 138 139 140 141 142

2.2. Construction of transgenic knockout plasmids of T. gondii The Cas9 gene was amplified from the pcDNA3.3-TOPO vector expressing human codon-optimised Cas9 (obtained from the G. M. Church laboratory through Addgene, USA). The Cas9 gene was assembled by hierarchical fusion PCR (all primers used are listed in Table 1) assembly of the FLAG tag, the nuclear location signal from the histone lysine acetyltransferase GCN5-B (Dixon et al., 2011), and the homologous arm of the GRA1 promoter. The resulting full-length products were cloned into the EcoRV site of the pDMG vector using the ClonExpress™ II One Step Cloning Kit (Vazyme, USA), and the resulting plasmid was designated PDMG-Cas9. Construction of the target gRNA (TgLAPgRNA; Fig. 1A) expression construct was performed by hierarchical fusion PCR assembly of the ToxoU6 promoter (a homolog to Plasmodium U6 in ToxoDB), TgLAP target sequence and gRNA scaffold

Table 1 Primers used in this study. Primer name

50 –30 sequence

Cas9GRA-F Cas9FLAG-R1 Cas9NLS-R2 Cas9GRA-R3 ToxoU6pro-F1 TgLAPtarget-R1 TgLAPtarget-F2 gRNA-R2

AAGAAGCTTGATGGGGATATCATGGACAAGAAGTACTCCAT CTTGTCGTCATCGTCTTTGTAGTCCATGTCTCCACCGAGCTGAGA GCCGCGCTTCTTGTTCTCCGCGGGCCTCTTGTCGTCATCGTCTTTG GTCGTACGGATACATGATATCCTATCTGCCGCGCTTCTTGTTCTC TTCCAGTCGACTAGT TCTAGAACGTACCCAAACGCGAAAGC AACCTTTAGCCATCTCAACAGCCAACTTGACATCCCCATTTACC G GCTGTTGAGATGGCTAAAGGTT TTAGAGCTAGAAATAGCAAG TACAGCCTTCGAAGCTCTAGA TTAATGCAGCTGGCACGACAG

Cas9, CRISPR-associated 9 control; TgLAP, Toxoplasma gondii leucine aminopeptidase; gRNA, guide RNA.

(Fig. 1B), and then cloned into the XbaI site of PDMG-Cas9 using the ClonExpress II Kit. The plasmid containing the TgLAP target fragment, designated pGCD-LAP (Fig. 1C), was then used to establish knockout strains stably expressing the GFP reporter.

143

2.3. Parasite transfections and selection of stable transformants

147

Toxoplasma gondii tachyzoite transfections were performed by electroporation as previously described (Soldati and Boothroyd, 1993) using 10 lg of pGCD-LAP (DTgLAP plasmid) or pGCD (Cas control plasmid). Selection based on pyrimethamine (1 lM, prepared in ethanol) was performed as described previously (Reynolds et al., 2001). Stable clones (DTgLAP-B4 and DTgLAPC6) were isolated by limiting dilution in 96-well plates and confirmed by western blotting.

148

2.4. Western blotting and immunoprecipitation analysis

156

Western blot samples were obtained by spinning down extracellular parasites and incubating them with RIPA buffer (50 mM Tris–HCl (pH 8), 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS and 1 mM EDTA) containing a protease inhibitor cocktail (Calbiochem, USA) for 20 min on ice to lyse the parasites. Afterwards, samples were centrifuged for 30 min at 15,000 g at 4 °C and Laemmli buffer was added to the supernatant. Unless indicated otherwise, 106 parasites were loaded onto a SDS– polyacrylamide gel and immunoblotting was performed as described previously (Soldati and Boothroyd, 1993). To determine the sizes of TgLAP proteins, immunoprecipitation was performed. Initially, specific antibody was isolated from mouse anti-TgLAP serum using protein G Plus agarose (Pierce, USA). The eluted antibody was added to the RIPA lysate containing protein from 106 parasites. This mixture was mixed by rotation overnight at 4 °C. The next day, 50 ll of protein G-agarose was added to each sample, which was rotated for an additional 6 h at 4 °C. At that time, the agarose beads were recovered by centrifugation and washed three times with RIPA buffer. Antibody-TgLAP complexes bound to the agarose were analysed by SDS–PAGE. Following fluorescein staining (Invitrogen, USA), the band corresponding to TgLAP protein was cut out from the PAGE gel, reclaimed and subjected to mass spectrometric analysis at Beijing Genomics Institute (Beijing, China).

157

2.5. Attachment/invasion assay

181

To measure the attachment/invasion rates of the DTgLAP parasites, Cas9 control and knockout parasites were scratched, filtered and inoculated onto Vero monolayers in six-well culture plates (Costar, USA) (106 parasites per well). Parasites were allowed to invade for 2 h or 4 days under normal growth conditions (37 °C, 5% CO2), after which extracellular parasites were washed away

182

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

144 145 146

149 150 151 152 153 154 155

158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180

183 184 185 186 187

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx

3

Fig. 1. Schematic diagram of the Cas-control plasmid-leucine aminopeptidase (pGCD-LAP) expression construct. (A) The Toxoplasma gondii leucine aminopeptidase cleavage site is shown in its genomic context. The target guide RNA (gRNA) of T. gondii leucine aminopeptidase is underlined and the protospacer adjacent motif sequence is framed. (B) ToxoU6 promoter-based expression scheme for the gRNA. This fragment bears all of the components necessary for gRNA expression: ToxoU6 promoter (dashed line), T. gondii leucine aminopeptidase target sequence (framed), gRNA scaffold (underlined) and termination signal. (C) Toxoplasma gondii expression vector for Cas9 and single gRNA (sgRNA). The pGCD-LAP expression plasmid contains four important genes: GFP, Cas9, TgLAPgRNA and dihydrofolate reductase (DHFR). The genes are represented by grey rectangles and their promoters (pro) are represented by arrows.

194

with PBS and the cells were trypsinized for 3 min. The cells were resuspended in 1 ml of DMEM supplemented with 10% FCS, and the suspension was then centrifuged, followed by another PBS wash. Finally, FACS buffer (1% FCS prepared in PBS supplemented with 1 mM EDTA) was added to achieve a final concentration of 106 parasites per ml. A total of 10,000 events were counted on a FACS Calibur Becton Dickinson LSRII.

195

2.6. Replication and infection foci assay

196

209

To investigate the replication rates of the DTgLAP parasites, Cas9 control and knockout parasites were scratched, filtered, and inoculated onto Vero monolayers in six-well culture plates (106 parasites per well). Parasites were allowed to invade for 2 h under normal growth conditions (37 °C, 5% CO2), extracellular parasites were washed away with PBS, and the parasites were incubated for another 24 h. The parasites in at least 100 vacuoles were counted for each condition, and the reported results are representative of three independent experiments. To directly compare the growth of Cas9 control and knockout parasites, an infection foci assay was performed. Equal numbers of DTgLAP parasites and Cas9 control parasites were allowed to infect and grow for 4 days in fully confluent Vero cells. The sizes of the areas displaying green fluorescence were observed by fluorescence microscopy.

210

2.7. Fatality assay

211

Freshly lysed tachyzoites were filtered (5 lm pore size), spun down and resuspended in PBS. Cas9 control (102), DTgLAP-B4

188 189 190 191 192 193

197 198 199 200 201 202 203 204 205 206 207 208

212

(102, 103 or 104), or DTgLAP-C6 (102) tachyzoites in 0.1 ml of PBS were injected i.p. into 6–8 weeks old BALB/c outbred female mice (a total of five groups; n = 5 for each group). The number of dead mice was recorded every day until all had died. The experiments were approved by the Animal Ethics Committee of Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (CAAS) and were performed in accordance with animal ethics guidelines and approved protocols. The Animal Ethics Committee approval number was SYXK (Hei) 20142019.

213

2.8. Complementation of TgLAP in DTgLAP parasites

222

The pBluescript II plasmid containing the hypoxanthine–xanthine–guanine phosphoribosyl transferase (HXGPRT) expression cassette (derived from the pHXNTPHA plasmid), designated pBH, was used to construct the complemented plasmid. To construct plasmid pBH-synoTgLAP (Fig. 2A), a TgLAP gene containing synonymous codons (synoTgLAP) was ligated into the PmeI site of the pBH vector using the aforementioned cloning kit. In this plasmid, synoTgLAP expression was driven by the GRA1 promoter. The C-terminus of synoTgLAP was ligated to the FLAG tag by hierarchical fusion PCR. To generate DTgLAP/synoTgLAP parasites, 107 DTgLAP-B4 parasites were transfected with 10 lg of pBH-synoTgLAP plasmid and selected with mycophenolic acid (25 lg/ml) and xanthine (50 lg/ml). After three generations, parasites expressing synoTgLAP were used to assay invasive ability and replication in vitro. To measure the virulence of complemented parasites in mice, Cas9 control (102), complement (102), or DTgLAP-B4 (102) tachyzoites were injected i.p. into 6–8 weeks

223

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

214 215 216 217 218 219 220 221

224 225 226 227 228 229 230 231 232

233 234 235 236 237 238

239

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 4

J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx

Fig. 2. Complementation of Toxoplasma gondii leucine aminopeptidase in gene-disrupted T. gondii leucine aminopeptidase (DTgLAP) parasites and recovery of attachment/ invasive ability. (A) The complementing T. gondii leucine aminopeptidase expression plasmid was introduced into DTgLAP-B4 lines. To avoid recognition by Cas9, T and A in the T. gondii leucine aminopeptidase genomic target located near the protospacer adjacent motif were mutated to C and G, respectively, resulting in no change in amino acid sequence; the encoded amino acids are framed. The FLAG tag was used for identification of the complementing T. gondii leucine aminopeptidase protein. Hypoxanthine– xanthine–guanine phosphoribosyl transferase (HXGPRT) expression was used to screen for complementing lines. (B) Western blot analysis of DTgLAP-B4/T. gondii leucine aminopeptidase with synonymous codons (synoTgLAP) parasites. Complementing T. gondii leucine aminopeptidase could be detected with both a mouse monoclonal antiFLAG antibody and a mouse anti-T. gondii leucine aminopeptidase serum. Secondary antibody was a horseradish peroxidase-labelled goat anti-mouse monoclonal antibody. Prestained protein marker: 10–170 kDa. (C, D) Complementation of T. gondii leucine aminopeptidase restored the invasive ability of DTgLAP-B4/synoTgLAP parasites. Flow cytometric analysis was performed (C) 2 h or (D) 4 days p.i. ⁄⁄P < 0.01.

242

old BALB/c mice, respectively (a total of three groups; n = 8 for each group). The number of dead mice was recorded each day until all had died.

243

2.9. Enzymatic activity assay

244

260

Aminopeptidase activity was determined by measuring the rate at which L-leucine was liberated from the flaws liber substrate Lleucine-4-methyl-coumaryl-7-amide (kindly provided by Dr. Xuenan Xuan, Obihiro University, Japan). The released 4-methyl-coumaryl-7-amide (MCA) was measured using an EnSpire Multimode Plate Reader (PerkinElmer, Turku, Finland) at a wavelength of 355–460 nm for both emission and excitation. To determine the LAP activity of knockout and complemented lines, fresh naturally emerged tachyzoites were purified and collected by centrifugation. Protein was extracted from the parasites using lysis buffer (20 mM Tris–HCl (pH 8.0), 137 mM NaCl, 1% Nonidet P-40 and 2 mM EDTA) and quantitated using a bicinchoninic acid (BCA) protein assay kit (Pierce). Parasite protein (10 lg) was added to 200 ll of Tris–HCl buffer (50 mM) before the specific substrate (0.1 mM) was added to measure enzymatic activity. The relative fluorescent levels were assessed for 30 min (repeated thrice, with a time interval of 3 min).

261

3. Results

262

3.1. Generation of TgLAP knockout parasites using the CRISPR/Cas9 system

240 241

245 246 247 248 249 250 251 252 253 254 255 256 257 258 259

263 264 265

To further investigate the function of leucine aminopeptidases in T. gondii, we decided to generate a knockout mutant of TgLAP

(DTgLAP). In the pGCD-LAP parasite line, the TgLAPgRNA coding sequence bound a specific target in the genomic copy of TgLAP, allowing for the excision of the fragment after transient transfection of the parasite with a plasmid heterologously expressing bacterial Cas9 endonuclease (Fig. 1). TgLAP-deficient parasites were selected with pyrimethamine. Ultimately, two TgLAP-negative clones were obtained out of 24 clones screened by western blotting using mouse anti-TgLAP serum (data not shown). The complete absence of TgLAP protein expression in the DTgLAP parasite was confirmed by western blot analysis (Fig. 3A). However, the size of the TgLAP protein in the T. gondii RH wild-type (WT) strain differed from the size of LAP reported in ToxoDB (Fig. 3B). Therefore, we immunoprecipitated TgLAP from the parasite lysates and subjected the resultant material to mass spectrometric analysis (data not shown). The result indicated that the reclaimed TgLAP protein was indeed the Toxoplasma leucine aminopeptidase. We presume that it was smaller than predicted owing to protein modifications and/or proteolytic cleavage during the process of protein maturation. Unfortunately, we did not detect a precursor protein.

266

3.2. Loss of TgLAP affects attachment/invasion and growth in vitro

285

To determine whether the DTgLAP parasites had defects in attachment/invasion, we performed attachment/invasion and reattachment/invasion assays. The results of these experiments revealed a significant difference in attachment/invasion behaviour between Cas9 control and DTgLAP parasites (Fig. 4A, B). This difference was significant after inoculation for just 2 h (P < 0.05), and even more so after inoculation for 4 days (P < 0.01). To determine how the infectivity of the parasite was affected by TgLAP deficiency, we performed infection foci assays. The infection foci of DTgLAP

286

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284

287 288 289 290 291 292 293 294

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx

Fig. 3. The identification of Toxoplasma gondii leucine aminopeptidase knockout (DTgLAP) parasites. (A) Expression of T. gondii leucine aminopeptidase in a T. gondii leucine aminopeptidase-deleted line (DTgLAP-B4/C6) and a control line (Cas9 control) was determined by western blotting. Toxoplasma gondii leucine aminopeptidase was detected using mouse anti-T. gondii leucine aminopeptidase serum. TgTubulin was detected using mouse anti-a-tubulin serum as a loading control. Primary antibodies were detected with horseradish peroxidase-labelled goat antimouse secondary antibodies (Sigma, USA). (B) Immunoprecipitation analysis of T. gondii leucine aminopeptidase in the T. gondii RH wild-type strain. The observed size of T. gondii leucine aminopeptidase (arrow) was 59.8 kDa, smaller than the predicted size of T. gondii leucine aminopeptidase in ToxoDB (83.2 kDa; TGGT1_290670 and TGME49_290670). Marker: 10–170 kDa prestained protein ladder (Thermo, USA). Purified specific IgG from mouse anti-T. gondii leucine aminopeptidase serum was used in the immunoprecipitation. 295 296 297 298 299 300

parasites were significantly smaller than those formed by Cas9 control parasites (Fig. 4D). To confirm the presence of an intracellular growth defect, we performed growth assays by scoring the number of parasites per vacuole (Fig. 4C). In DTgLAP parasites, a significant percentage of vacuoles contained tachyzoites that exhibited retarded division. After incubation for 24 h, the number

5

of parasitophorous vacuoles containing eight tachyzoites peaked in Cas9 control parasites, and we could occasionally find vacuoles containing more than eight tachyzoites. By contrast, vacuoles with eight or more tachyzoites could not be detected in cells inoculated with DTgLAP parasites. In contrast to the controls, as the numbers of tachyzoites in vacuoles increased, the numbers of vacuoles gradually declined in samples containing DTgLAP parasites. In these assays, two knockout parasites showed a similar ability of attachment/invasion and growth in vitro, indicating that the phenotype could not be affected by random integration of Cas9. Although a complemented line was not used as a control, these findings indicate that TgLAP can play an important role in parasite attachment/invasion and growth.

301

3.3. DTgLAP parasites exhibit attenuated virulence in mice

314

Based on the reduced growth we observed in vitro, we next investigated the effect of TgLAP deletion on parasite virulence in mice. BALB/c outbred mice were infected i.p. with Cas9 control (102), DTgLAP-B4 (102, 103 or 104), or DTgLAP-C6 (102) tachyzoites (Fig. 5). As expected, mice infected with Cas9 control parasites started to show signs of disease (i.e., ascites due to tachyzoites in the peritoneum, ruffled fur) at 6 days p.i., and they died between 8 and 10 days p.i. By contrast, mice that were challenged with 102 DTgLAP parasites (strain B4 or C6) exhibited no signs before 13 days p.i., and they all remained alive until 15 days p.i. Mice that received 104 DTgLAP-B4 tachyzoites exhibited a slightly swollen abdomen as the sole sign of disease and all remained alive until 11 days p.i. Although the complemented line was not used as a control, the results showed that knockout of TgLAP slightly attenuated the virulence of T. gondii in mice.

315

Fig. 4. The loss of Toxoplasma gondii leucine aminopeptidase affects attachment/invasion and growth in vitro. (A, B) Attachment/invasion assay. Graphs show the percentage of cells attached/invaded and re-invaded by tachyzoites after an equal number (106) of Cas9 control and gene-disrupted T. gondii leucine aminopeptidase (DTgLAP) parasites (B4 and C6 strains) were added extracellularly to confluent Vero cell monolayers and incubated at 37 °C. Alternatively, cells were infected and flow cytometric analysis was performed for (A) 2 h or (B) 4 days p.i. ⁄⁄P < 0.01. (C) Replication assay. For intracellular growth assays, Cas9 control or DTgLAP-B4/C6 parasites were grown for 24 h and then the number of parasites per vacuole (X-axis) was counted. At least 100 vacuoles were scored for each condition. All results are the mean of three independent experiments. Error bars show S.E.M. (D) Infection foci assay. The DTgLAP-B4 and -C6 lines formed infection foci (white arrow) significantly smaller than those formed by Cas9 control parasites (white arrowheads) at 4 days p.i. All images were taken at 200 magnification.

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

302 303 304 305 306 307 308 309 310 311 312 313

316 317 318 319 320 321 322 323 324 325 326 327 328 329

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 6

J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx

Fig. 5. Gene-disrupted Toxoplasma gondii leucine aminopeptidase (DTgLAP) parasites exhibit attenuated virulence in mice. Survival curves of parasites in BALB/c mice. Mice that were infected with 102 Cas9 control parasites died between days 8 and 10 p.i. In contrast, mice that were challenged with 102, 103 or 104 DTgLAP-B4 or -C6 parasites remained alive. For the DTgLAP-C6 parasites, only the data for 102 parasites infection is shown. Mice were i.p. injected with the number of parasites indicated in parentheses.

330 331 332 333 334 335 336 337 338 339 340 341 342

3.4. Re-expression of synoTgLAP in DTgLAP-B4 parasites restores attachment/invasive ability To further indicate the effect of TgLAP in attachment/invasion, we designed and constructed a complementing TgLAP expression plasmid by replacing the original codons with synonymous codons (synoTgLAP), resulting in an allele of the TgLAP gene that could avoid Cas9 knockout (Fig. 2A). Western blot analysis revealed that in the DTgLAP-B4/synoTgLAP parasites, TgLAP protein could be detected by both a mouse monoclonal anti-FLAG antibody and mouse anti-TgLAP serum (Fig. 2B). The results revealed that the complemented parasites expressed a similar level of LAP protein to Cas9 control parasites. Attachment/invasion assays revealed that the corresponding behaviour and statistics of DTgLAP-B4/

Fig. 7. Enzymatic activity assay of Toxoplasma gondii parasites. Enzymatic activity curves of whole protein lysates of various lines are shown in the graph, which was generated using GraphPad Prism version 5.0 (GraphPad Software, San Diego, USA). Positive control: free 4-methyl-coumaryl-7-amide; negative control: Leu-4-methylcoumaryl-7-amide without enzymes.

synoTgLAP parasites were similar to those of the Cas9 control parasites. By contrast, the DTgLAP-B4 parasites exhibited diminished invasive capacity (Fig. 2C, D). These results further demonstrate that the loss of TgLAP affects parasite attachment/invasion in vitro.

343

3.5. Compensation of LAP restores growth ability of parasites and virulence in mice

347

To further investigate the growth ability of complemented parasites, the replication and infection foci assays were performed. The results showed that the growth rate of complemented parasites were similar to those of the Cas9 control parasites. But the DTgLAP-B4 parasites exhibited reduced replication capability (Fig. 6A, B). The fatality assay of complemented parasites showed that re-expression of synoTgLAP in DTgLAP-B4 parasites restores virulence in mice (Fig. 6C). These results further demonstrate the

349

Fig. 6. Recovery of growth ability and virulence in complemented Toxoplasma gondii leucine aminopeptidase parasites. (A) Cas9 control strains formed large infection foci that were similar to those generated by the complemented (DTgLAP-B4/synoTgLAP) strains (white arrowheads), but were significantly larger than those formed by DTgLAP-B4 parasites (white arrow). All images were taken at 200 magnification. (B) Complementation of T. gondii leucine aminopeptidase restored the replication ability of DTgLAP-B4/synoTgLAP parasites. The complemented parasites were grown for 30 h, and the number of parasites per vacuole was counted. Cas9 control and DTgLAP-B4 lines were used as loading controls in all experiments. (C) Survival curves of complemented parasites in BALB/c mice. Mice that were infected with complemented strains died between days 8 and 11 p.i. In contrast, mice that were challenged with 102 DTgLAP-B4 parasites remained alive until day 18 p.i. TgLAP complementation restored parasite virulence. Mice were i.p. injected with the number of parasites indicated in parentheses.

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

344 345 346

348

350 351 352

353 354 355 356

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx 357 358

functional significance of TgLAP in T. gondii development and virulence.

359

3.6. Compensation of LAP activity in DTgLAP parasites

360

370

To examine the change in enzymatic activity in knockout parasites, synthesised substrates of LAP were analysed in whole protein extracts of various lines. There was a significant difference in enzymatic activity between Cas9 control and DTgLAP-B4/C6 lines (Fig. 7). The enzymatic activity of DTgLAP-B4 was restored by synoTgLAP complementation. This indicates that the amino peptidase activity of T. gondii was decreased owing to LAP loss. The processing of a specific substrate was not completely lost in knockout parasites. This shows that other enzymes can compensate for the absence of TgLAP in T. gondii. Consequently, deletion of TgLAP was not lethal for the parasite.

371

4. Discussion

372

For the past few years, leucine aminopeptidases have emerged as promising new drug targets for the development of antiparasitic drugs, based on the essential roles of these proteins (Jia et al., 2009; Cadavid-Restrepo et al., 2011; Harbut et al., 2011). In previous work, we characterised TgLAP (Jia et al., 2010). However, that study did not fully explore whether TgLAP represents an ideal drug target. Therefore, in this study, we investigated the suitability of this protein as a drug target in T. gondii by knocking out the encoding gene. TgLAP knockout did not lead to death or complete loss of specific enzymatic activity in T. gondii, but instead only hindered its growth and decreased the processing of a LAP substrate. Thus, TgLAP is not essential for life, but it is necessary for robust growth of the parasite. Therefore, although the loss of TgLAP function cannot kill the parasite completely, we consider LAP to represent an adjunctive drug target in T. gondii. Aminopeptidases are exopeptidases that catalyse the sequential removal of amino acids from the N-termini of peptides; these enzymes play major roles in regulating the balance between catabolism and anabolism in all living cells (Kang et al., 2011). In Streptomyces coelicolor, deletion of leucine aminopeptidase increases actinorhodin production and sporulation (Song et al., 2013). In Caenorhabditis elegans, LAP null mutants exhibit a reduced growth rate and delayed onset of egg laying (Joshua, 2001). In malaria parasites, leucine aminopeptidase-like enzymes are believed to function in the terminal stages of haemoglobin digestion to generate free amino acids that are then used for parasite protein synthesis (Curley et al., 1994; Kolakovich et al., 1997; Gavigan et al., 2001). In T. gondii, TgLAP could also release free amino acids as the final step in protein catabolism. The substrates of this aminopeptidase might be peptides from proteasomal degradation pathways or possibly those degraded in the parasitophorous vacuole by endoproteases and sent to the cytoplasm (Jia et al., 2010). In this study, we found that the size of TgLAP was smaller than predicted in ToxoDB. We hypothesised that the TgLAP we detected could represent a truncation product of the mature protein. However, no immature protein of TgLAP was detected. Our findings demonstrate that the functions of TgLAP are important for parasite growth. We hypothesise that the loss of TgLAP might affect replication by interfering with parasite metabolism. The phenotypes of the DTgLAP and complemented parasites support this hypothesis. Surprisingly, host attachment/invasion was also affected in DTgLAP parasites, possibly because TgLAP substrates that may mediate LAP-dependent invasion in T. gondii were not investigated in this study. Furthermore, mouse experiments demonstrated a reduction in toxicity of DTgLAP parasites. Notwithstanding these results, the precise role of LAP in T. gondii

361 362 363 364 365 366 367 368 369

373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417

7

remains unclear and it remains to be determined whether it acts directly or indirectly in protein synthesis or parasite metabolism. Several knockout strategies have been developed to study protein function in T. gondii. A one-step homologous replacement has been used to study the function of many non-essential genes. However, for single copy essential genes, no viable knockout strain can be obtained using this method (Donald and Roos, 1998). The sitespecific recombinase Cre can be used to generate a knockout strain and obtain a clonal population of knockout mutants. However, because Cre-mediated recombination depends on the recognition of lox sites, the recombination efficiency is affected by the conformation and DNA methylation status of the recognition sites, as well as the expression level of recombinant enzyme (Vooijs et al., 2001). Moreover, Cryptic-lox or Pseudo-lox sites can also be recognised and recombined by Cre in mammalian genomes, resulting in DNA damage to the host genome (Semprini et al., 2007). Consistent with this, high expression of Cre in the nucleus can be toxic to cells (Loonstra et al., 2001). To overcome these technical challenges, we demonstrated that the CRISPR/Cas9 system can be used for targeted genome editing in T. gondii. This system introduces a targeting construct that eliminates the WT copy of the gene and an edited template that both eliminates cleavage by dual-RNA:Cas9 and introduces desired mutations. The specificity and versatility of editing with the CRISPR-Cas9 system rely on several unique properties of the Cas9 endonuclease: (i) its target specificity can be programmed with a small RNA, without the need for enzyme engineering; (ii) target specificity is very high, determined by a 20 bp RNA–DNA interaction with low probability of non-target recognition; (iii) almost any sequence can be targeted, the only requirement being the presence of an adjacent NGG sequence; and (iv) almost any mutation in the NGG sequence, as well as mutations in the seed sequence of the protospacer (see below), eliminates targeting (Jiang et al., 2013). RNA-guided Cas9 endonuclease in the type II CRISPR system has facilitated the development of a new, easily used and programmable platform for genome editing (Shalem et al., 2014). Using this platform, we obtained TgLAP-knockout strains in a very short time, leaving more time for further assays of the phenotype. Design and construction of the knockout vector are very important in CRISPR/Cas9 systems. For convenience, we inserted several exogenous genes into a single T. gondii delivery vector. Our results proved that this design was convenient and effective, as reflected by our successful screen for gene-disrupted TgLAP parasites. Furthermore, this method should facilitate knockout of other genes in the T. gondii genome by simply replacing the gRNA target sequence with one corresponding to a gene of interest. Type II CRISPR interference is a result of Cas9 unwinding of the DNA duplex, searching for sequences matching the CRISPR RNAs (crRNA), and finally cleavage. Target recognition occurs upon detection of complementarity between a protospacer sequence in the target DNA and the remaining spacer sequence in the crRNA. Importantly, Cas9 cuts the DNA only if a correct protospacer adjacent motif (PAM) is also present at the 30 end. Different type II systems have differing PAM requirements. The system utilised in this work requires a GN20GG sequence, where N can be any nucleotide (Mali et al., 2013). However, if the crRNA is located near the C-terminus of the gene of interest, it can cause expression of a truncated protein, affecting subsequent phenotypic assays of knockout strains. Moreover, if the crRNA target sequence is homologous to other genes in the T. gondii genome, or a mismatch occurs, it would result in knockout of other genes in addition to the gene of interest. In this study, the 19 nucleotide sequences upstream of all NGGs in the N-terminal two-thirds of the TgLAP gene were analysed individually using the Basic Local Alignment Search Tool (BLAST) before we ultimately determined the crRNA used to knockout TgLAP.

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003

418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483

PARA 3711

No. of Pages 8, Model 5G

15 November 2014 8

J. Zheng et al. / International Journal for Parasitology xxx (2014) xxx–xxx

494

In summary, we implemented a new knockout strategy that is generally applicable to studying the functions of genes that are important in bacteria (Jiang et al., 2013), viruses (Bi et al., 2014), and mammals (Sung et al., 2014). Recently, both rop18 knockout strain in T. gondii and complemented lines in the type I GT1 strain were rapidly generated using CRISPR/CAS9 (Shen et al., 2014). That report further supports the feasibility of the Cas9 system used in T. gondii. In addition, our study provides direct evidence that TgLAP plays an important role in parasite attachment/invasion and growth, and that TgLAP deficiency decreases parasite virulence in vivo.

495

5. Uncited references

484 485 486 487 488 489 490 491 492 493

496 497 498 499 500 501 502 503

Q2

Stack et al. (2007). Acknowledgements

This work was supported by a grant awarded to Honglin Jia Q3 from the National Natural Science Foundation of China (no. Q4 31101811). We thank Dr. K.A. Joiner (Yale University, USA) for providing the pHXNTPHA and pDMG plasmids generated by Dr. Xuenan Xuan (Obihiro University of Agriculture and Veterinary Medicine, Japan).

504

References

505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542

Acosta, D., Cancela, M., Piacenza, L., Roche, L., Carmona, C., Tort, J.F., 2008. Fasciola hepatica leucine aminopeptidase, a promising candidate for vaccination against ruminant fasciolosis. Mol. Biochem. Parasitol. 158, 52–64. Bi, Y., Sun, L., Gao, D., Ding, C., Li, Z., Li, Y., Cun, W., Li, Q., 2014. High-efficiency targeted editing of large viral genomes by RNA-guided nucleases. PLoS Pathog. 10, e1004090. Cadavid-Restrepo, G., Gastardelo, T.S., Faudry, E., de Almeida, H., Bastos, I.M., Negreiros, R.S., Lima, M.M., Assumpção, T.C., Almeida, K.C., Ragno, M., Ebel, C., Ribeiro, B.M., Felix, C.R., Santana, J.M., 2011. The major leucyl aminopeptidase of Trypanosoma cruzi (LAPTc) assembles into a homohexamer and belongs to the M17 family of metallopeptidases. BMC Biochem. 12, 46. Cho, S.W., Lee, J., Carroll, D., Kim, J.S., Lee, J., 2013. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195, 1177–1180. Curley, G.P., O’Donovan, S.M., McNally, J., Mullally, M., O’Hara, H., Troy, A., O’Callaghan, S.A., Dalton, J.P., 1994. Aminopeptidases from Plasmodium falciparum, Plasmodium chabaudi and Plasmodium berghei. J. Eukaryot. Microbiol. 41, 119–123. Dixon, S.E., Bhatti, M.M., Uversky, V.N., Dunker, A.K., Sullivan, W.J., 2011. Regions of intrinsic disorder help identify a novel nuclear localization signal in Toxoplasma gondii histone acetyltransferase TgGCN5-B. Mol. Biochem. Parasitol. 175, 192– 195. Donald, R.G., Roos, D.S., 1998. Gene knock-outs and allelic replacements in Toxoplasma gondii: HXGPRT as a selectable marker for hit-and-run mutagenesis. Mol. Biochem. Parasitol. 91, 295–305. Gavigan, C.S., Dalton, J.P., Bell, A., 2001. The role of aminopeptidases in haemoglobin degradation in Plasmodium falciparum-infected erythrocytes. Mol. Biochem. Parasitol. 117, 37–48. Harbut, M.B., Velmourougane, G., Dalal, S., Reiss, G., Whisstock, J.C., Onder, O., Brisson, D., McGowan, S., Klemba, M., Greenbaum, D.C., 2011. Bestatin-based chemical biology strategy reveals distinct roles for malaria M1- and M17-family aminopeptidases. Proc. Natl. Acad. Sci. U. S. A. 108, E526–E534. Jia, H., Nishikawa, Y., Luo, Y., Yamagishi, J., Sugimoto, C., Xuan, X., 2010. Characterization of a leucine aminopeptidase from Toxoplasma gondii. Mol. Biochem. Parasitol. 170, 1–6. Jia, H., Terkawi, M.A., Aboge, G.O., Goo, Y.K., Luo, Y., Li, Y., Yamagishi, J., Nishikawa, Y., Igarashi, I., Sugimoto, C., Fujisaki, K., Xuan, X., 2009. Characterization of a leucine aminopeptidase of Babesia gibsoni. Parasitology 136, 945–952.

Jiang, W., Bikard, D., Cox, D., Zhang, F., Marraffini, L.A., 2013. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat. Biotechnol. 31, 233–239. Joshua, G.W., 2001. Functional analysis of leucine aminopeptidase in Caenorhabditis elegans. Mol. Biochem. Parasitol. 113, 223–232. Kang, J.M., Ju, H.L., Sohn, W.M., Na, B.K., 2011. Molecular cloning and characterization of a M17 leucine aminopeptidase of Cryptosporidium parvum. Parasitology 138, 682–690. Knowles, G., 1993. The effects of arphamenine-A, an inhibitor of aminopeptidases, on in-vitro growth of Trypanosoma brucei brucei. J. Antimicrob. Chemother. 32, 172–174. Kolakovich, K.A., Gluzman, I.Y., Duffin, K.L., Goldberg, D.E., 1997. Generation of hemoglobin peptides in the acidic digestive vacuole of Plasmodium falciparum implicates peptide transport in amino acid production. Mol. Biochem. Parasitol. 87, 123–135. Loonstra, A., Vooijs, M., Beverloo, H.B., Allak, B.A., van Drunen, E., Kanaar, R., Berns, A., Jonkers, J., 2001. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 98, 9209–9214. Luft, B.J., Remington, J.S., 1992. Toxoplasmic encephalitis in AIDS. Clin. Infect. Dis. 15, 211–222. Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church, G.M., 2013. RNA-guided human genome engineering via Cas9. Science 339, 823–826. Matsui, M., Fowler, J.H., Walling, L.L., 2006. Leucine aminopeptidases: diversity in structure and function. Biol. Chem. 12, 1535–1544. McLeod, R., Boyer, K., Karrion, T., Kasza, K., Swisher, C., Roizen, N., Jalbrzikowski, J., Remington, J., Heydemann, P., Noble, A.G., Mets, M., Holfels, E., Withers, S., Latkany, P., Meier, P., 2006. Outcome of treatment for congenital toxoplasmosis, 1981–2004: The National Collaborative Chicago-Based, Congenital Toxoplasmosis Study. Clin. Infect. Dis. 42, 1383–1394. McLeod, R., Boyer, K., Roizen, N., Stein, L., Swisher, C., Holfels, E., Hopkins, J., Mack, D., Karrison, T., Patel, D., Pfiffner, L., Remington, J., Withers, S., Meyers, S., Aitchison, V., Mets, M., Rabiah, P., Meier, P., 2000. The child with congenital toxoplasmosis. Curr. Clin. Top. Infect. Dis. 20, 189–208. Rawlings, N.D., Morton, F.R., Barrett, A.J., 2006. MEROPS: the peptidase database. Nucleic Acids Res. 34 (Database), D270–D272. Reynolds, M.G., Oh, J., Roos, D.S., 2001. In vitro generation of novel pyrimethamine resistance mutations in the Toxoplasma gondii dihydrofolate reductase. Antimicrob. Agents Chemother. 45, 1271–1277. Rogers, A.H., Gunadi, A., Gully, N.J., Zilm, P.S., 1998. An aminopeptidase nutritionally important to Fusobacterium nucleatum. Microbiology 144, 1807–1813. Semprini, S., Troup, T.J., Kotelevtseva, N., King, K., Davis, J.R.E., Mullins, L.J., Chapman, K.E., Dunbar, D.R., Mullins, J.J., 2007. Cryptic loxP sites in mammalian genomes: genome-wide distribution and relevance for the efficiency of BAC/PAC recombineering techniques. Nucl Acids Res. 35, 1402– 1410. Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., Zhang, F., 2014. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84–87. Shen, B., Brown, K.M., Lee, T.D., Sibley, L.D., 2014. Efficient gene disruption in diverse strains of Toxoplasma gondii using CRISPR/CAS9. MBio 5, e01114–14. Skinner-Adams, T.S., Peatey, C.L., Anderson, K., Trenholme, K.R., Krige, D., Brown, C.L., Stack, C., Nsangou, D.M., Mathews, R.T., Thivierge, K., Dalton, J.P., Gardiner, D.L., 2012. The aminopeptidase inhibitor CHR-2863 is an orally bioavailable inhibitor of murine malaria. Antimicrob. Agents Chemother. 56, 3244–3249. Soldati, D., Boothroyd, J.C., 1993. Transient transfection and expression in the obligate intracellular parasite Toxoplasma gondii. Science 260, 349–352. Song, E., Rajesh, T., Lee, B.R., Kim, E.J., Jeon, J.M., Park, S.H., Park, H.Y., Choi, K.Y., Kim, Y.G., Yang, Y.H., Kim, B.G., 2013. Deletion of an architectural unit, leucyl aminopeptidase (SCO2179), in Streptomyces coelicolor increases actinorhodin production and sporulation. Appl. Microbiol. Biotechnol. 97, 6823–6833. Stack, C.M., Lowther, J., Cunningham, E., Donnelly, S., Gardiner, D.L., Trenholme, K.R., Skinner-Adams, T.S., Teuscher, F., Grembecka, J., Mucha, A., Kafarski, P., Lua, L., Bell, A., Dalton, J.P., 2007. Characterization of the Plasmodium falciparum M17 leucyl aminopeptidase. A protease involved in amino acid regulation with potential for antimalarial drug development. J. Biol. Chem. 282, 2069–2080. Sung, Y.H., Kim, J.M., Kim, H.T., Lee, J., Jeon, J., Jin, Y., Choi, J.H., Ban, Y.H., Ha, S.J., Kim, C.H., Lee, H.W., Kim, J.S., 2014. Highly efficient gene knockout in mice and zebrafish with RNA-guided endonucleases. Genome Res. 24, 125–131. Vooijs, M., Jonkers, J., Berns, A., 2001. A highly efficient ligand- regulated Cre recombinase mouse line shows that LoxP recombination is position dependent. EMBO Rep. 2, 292–297.

543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616

Please cite this article in press as: Zheng, J., et al. Knockout of leucine aminopeptidase in Toxoplasma gondii using CRISPR/Cas9. Int. J. Parasitol. (2014), http://dx.doi.org/10.1016/j.ijpara.2014.09.003