- Email: [email protected]
KRAS and BRAF mutations in sinonasal cancer
Oral Oncology 48 (2012) 692–697
Contents lists available at SciVerse ScienceDirect
Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology
KRAS and BRAF mutations in sinonasal cancer Fernando López a, Cristina García Inclán a, Jhudit Pérez-Escuredo a, César Álvarez Marcos a, Bartolomé Scola b, Carlos Suárez a, José Luis Llorente a, Mario A. Hermsen a,⇑ a b
Department of Otolaryngology, Instituto Universitario de Oncología del Principado de Asturias, Hospital Universitario Central de Asturias, Oviedo, Spain Department of Otolaryngology, Hospital Gregorio Marañon, Madrid, Spain
a r t i c l e
i n f o
Article history: Received 16 January 2012 Received in revised form 14 February 2012 Accepted 17 February 2012 Available online 27 March 2012 Keywords: Maxillary sinus Ethmoid sinus Sinonasal Squamous cell carcinoma Adenocarcinoma KRAS BRAF
s u m m a r y Objetives: Despite improvements in the field of surgery and radiotherapy, the overall prognosis of sinonasal carcinomas is poor, mainly due to the difficulty to resect the tumour completely in this anatomically complex region. Therefore, there is great need for alternative treatments. Knowledge of the KRAS and BRAF mutational status would become clinically important with regard to the possible use of antiEGFR therapies. Material and methods: DNA was extracted from paraffin embedded tumour samples from 57 cases of sinonasal squamous cell carcinoma (SNSCC) and from fresh frozen tumour samples from 58 cases of intestinal-type sinonasal adenocarcinoma (ITAC). Point mutations were analysed for KRAS exon 2 (codons 12 and 13) and BRAF (exon 15, V600E) by direct sequencing. Results: Neither KRAS nor BRAF showed any mutations in the SNSCC, whereas 7/58 (12%) ITAC harboured KRAS mutations and no BRAF mutations. All seven cases with KRAS mutation concerned well-differentiated and less aggressive (papillary and colonic type) ITAC, all patients being woodworkers and 4/7 tobacco smokers. Conclusion: Neither of SNSCCs carried mutations in KRAS and BRAF and a low frequency of KRAS mutation was found in ITAC. This suggests that KRAS and BRAF mutations play a limited role in the development of sinonasal cancer and that mutation analysis is not useful as a screening test for sensitivity to anti-EGFR therapy in sinonasal cancer. Ó 2012 Elsevier Ltd. All rights reserved.
Introduction Sinonasal squamous cell carcinomas (SNSCCs) and intestinaltype sinonasal adenocarcinomas (ITACs) are epithelial tumours originating in the respiratory mucosa of the nasal cavities and paranasal sinuses. Cancer of the sinonasal cavities is rare with an annual incidence rate of <1 case per 100,000 inhabitants per year in Spain, occurring predominantly among men with a mean age of presentation of 50–60 years. A wide variety of histological types of tumours originates in this anatomic area, mostly epithelial (>75%), of which the most common is SNSCC, accounting for 50% of all nasal epithelial tumours, followed by ITAC with 12%.1 This is a complex anatomic area, close to structures such the eyes and the brain, which is of special relevance for surgery and postoperative treatment, since mutilation and aesthetic deformities are difficult to avoid. ⇑ Corresponding author. Address: Department of Otolaryngology, Instituto Universitario de Oncología del Principado de Asturias (IUOPA), Edificio H Covadonga 1ª Planta Centro, lab 2, Hospital Universitario Central de Asturias, Celestino Villamil s/n, 33006 Oviedo, Spain. Tel.: +34 985 107956; fax: +34 985 108015. E-mail address: [email protected] (M.A. Hermsen). 1368-8375/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.oraloncology.2012.02.018
SNSCC and ITAC tend to present at advanced stages, although lymph node or distant metastases are infrequent. Current therapeutic modalities include surgery followed by radiotherapy in advanced stages, sometimes with chemotherapy treatment.1–4 However, despite improvements in the field of surgery and radiotherapy, patients still face a very unfavourable prognosis. Local recurrence and intracranial invasion are the main causes of death. The overall 5-year survival varies between 22% and 67%.3 Therefore, new therapeutic approaches are needed to improve these figures and the development of new treatment strategies for SNSCC and ITAC remains a challenge. Although it is well-known that SNSCC and ITAC are etiologically related to occupational exposure to wood, leather and other types of organic dust,5–7 the tumourigenesis of these tumours is still poorly understood. However, molecular genetic analysis is becoming increasingly important in characterising the genetic ‘signatures’ of tumours and in aiding clinical management by novel anti-cancer treatments. Epidermal growth factor receptor (EGFR) is a member of the erbB family of tyrosine kinase receptor proteins, which also include erb-B2 (HER2/neu), erb-B3, and erb-B4. Ligand occupancy of EGFR activates the RAS/RAF/MAPK, STAT and PI3K signalling pathways,
693
F. López et al. / Oral Oncology 48 (2012) 692–697
which together modulate cellular proliferation, adhesion, angiogenesis and migration and promotes malignant transformation. EGFR has been validated as a therapeutic target in several malignancies, including colorectal and pancreatic adenocarcinoma and head and neck squamous cell carcinoma (HNSCC). Previous studies have indicated that a substantial proportion of SNSCC and ITAC carry EGFR gene copy number alterations and may benefit from EGFR antagonist therapy in the same way as HNSCC.8,9 Clinical trials with monoclonal antibodies directed against the extracellular domain of EGFR and small-molecule tyrosine kinase inhibitors (TKIs) directed to the intracellular catalytic domains have been performed in HNSCC and two anti-EGFR monoclonal antibodies (cetuximab and panitumumab) and two small-molecule tyrosine kinase inhibitors (gefitinib and erlotinib) have been approved for the treatment of HNSCC in several countries.10–12 However, only demonstrated modest response rates have been achieved. Potential mechanisms for the lack of response to EGFR inhibition in HNSCC include constitutive activation of signalling pathways independent of EGFR, as well as genetic aberrations causing dysregulation of the cell cycle or mutation of downstream effectors such as KRAS and BRAF.13 Since KRAS and BRAF mutations could be negative predictive factors for anti-EGFR therapies, we sought to determine the incidence of KRAS and BRAF mutations in sinonasal carcinomas.
Table 1 Patient and tumour characteristics.
Material and methods
the ethmoid sinus. The mean age was 66 years (range 45– 92 years). Eighteen tumours (31%) were stage I, 9 (16%) stage II, 17 (29%) stage III, 10 (17%) stage IVA, and 4 (7%) stage IVB. No patient had lymph node or distant metastases at the time of diagnosis. According to the World Health Organisation histological classification,15 our series comprised 5 (9%) papillary type or PTCC-I (Papillary Tubular Cylinder Cell-I), 29 (50%) colonic (PTCCII), 5 (9%) solid (PTCC-III), and 19 (32%) mucinous type tumours. Thirty-five patients (60%) received radiotherapy after radical surgery. Follow-up information was available with a median of 41 months (range 1–212 months). A summary of all the clinical data is given in Table 1.
Tumour specimens Between 1990 and 2009, 57 surgical tissue specimens from patients who were diagnosed of SNSCC were collected at the Departments of Otolaryngology at Central University Hospital of Asturias (Oviedo, Spain) and Gregorio Marañon General University Hospital (Madrid, Spain) and 58 surgical tissue specimens from patients who were diagnosed of ITAC were collected at the Department of Otolaryngology at Central University Hospital of Asturias (Oviedo, Spain). All 57 SNSCC samples proceeded from paraffin embedded tissue after histopathological analysis and all 58 ITAC samples were obtained from surgical resection specimens of non-necrotic tumour areas that were immediately stored in liquid nitrogen after surgery. All patients who were enrolled in the study provided written informed consent for the collection, storage, and analysis of specimens; and the study had received prior approval from our institutional ethical committees. All patients underwent radical surgery. Representative tissue sections were obtained from archival paraffin-embedded blocks. Clinical variables Of 57 SNSCC patients, 41 were male (72%) and 16 female (28%). The mean patient age was 66 years (range 47–91 years). Forty-six tumours were localised in the maxillary sinus (81%), and 11 in the ethmoid sinus (19%). The series comprised of 20 well differentiated tumours (35%), 11 moderately differentiated tumours (19%), and 26 poorly differentiated tumours (46%). According to the TNM system for tumour classification (T),14 seven tumours were T2 (12%), 17 T3 (30%), 25 T4a (44%), and 8 T4b (14%). Classified disease according to stage, the series consisted of six stage II (10%), 18 stage III tumours (32%), 25 stage IVA (44%), and 8 stage IVB tumours (14%). At the time of surgery, 15 patients (26%) had lymph node metastasis, and no patient had distant metastases. Fortythree patients (75%) received radiotherapy after radical surgery. The median follow-up was 27 months (range, 3–211 months). All 58 ITAC patients were male, 54 had professional exposure to wood dust and 28 were tobacco users. All 58 ITAC were located in
Characteristic
Gender Tumour site pT classification
Disease stage
pN classification Histological differentiation
Histological subtype
No. of patients (%)
Female Male Maxillary sinus Ethmoid sinus T1 T2 T3 T4a T4b I II III IVa IVb N0 N1 Well differentiated Moderately differentiated Poorly differentiated Papillary (PTCC-I) Colonic (PTCC-II) Solid (PTCC-III) Mucinous
SNSCC
ITAC
16 (28) 41 (72) 46 (81) 11 (19) 0 (0) 7 (12) 17 (30) 25 (44) 8 (14) 0 (0) 6 (10) 18 (32) 25 (44) 8 (14) 42 (74) 15 (26) 20 (35) 11 (19) 26 (46)
0 (0) 58 (100) 0 (0) 58 (100) 18 (31) 9 (16) 17 (29) 10 (17) 4 (7) 18 (31) 9 (16) 17 (29) 10 (17) 4 (7) 58 (100) 0 (0)
5 (9) 29 (50) 5 (9) 19 (32)
DNA extraction Tumour DNA was extracted from frozen tissue and paraffinembedded tissue samples using Qiagen extraction kits (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s recommendations. Special care was taken to obtain high-quality DNA from the formaldehyde-fixed, paraffin-embedded SNSCC tissues. DNA extracted from archival material can be partly degraded and cross-linked, the extent of which depends on the pH of the formaldehyde and the time of the fixation before paraffin embedding. To improve the quality of the isolated DNA, we applied an elaborate extraction protocol especially for paraffin tissues, which includes thorough deparaffinization with xylene, methanol washings to remove all traces of the xylene, and a 24-h incubation in 1 mol/L sodium thiocyanate to reduce crosslinks. Subsequently, the tissue pellet is dried and digested for 3 days in lysis buffer with high doses of proteinase K (final concentration, 2 lg/lL, freshly added twice daily). With this protocol, most formaldehyde-fixed, paraffin embedded tissue samples yielded DNA of relatively good quality with A260/A280 values between 1.7 and 2.0 measured by Nanodrop (Thermo Scientific, Wilmington, Del) and lengths between 2000 and 20,000 base pairs. KRAS and BRAF mutation analysis KRAS exon 2 (codons 12 and 13) and BRAF exon 15 (V600E) were analysed by direct sequencing. Reactions were set up in standard
694
F. López et al. / Oral Oncology 48 (2012) 692–697
Table 2 Oligonucleotides used for PCR amplification and sequencing. Oligonucleotide
Sequence 50 to 30
KRAS exon 2F KRAS exon 2R BRAF exon 15F BRAF exon 15R
TACTGGTGGAGTATTTGATAGTG CTGTATCAAAGAATGGTCCTG CTTCATAATGCTTGCTCTGATAGG GCATCTCAGGGCCAAAAAT
conditions with a 50 -first step at 95 °C followed by 30 cycles, (30 min 95 °C, 45 min 60 °C, 30 min 70 °C) for KRAS and 45 cycles (15 min 95 °C, 30 min 58 °C, 30 min 72 °C) for BRAF. Products were purified with High Pure PCR product purification kit (Roche) following manufacturer’s instructions. Sequencing PCR was set up with kit Big Dye TerminatorÒ v1.1 (Applied Biosystems) and analysed using the ABI PRISM 3100 and 3730 Genetic Analyser (Applied Biosystems, Foster City CA, USA). The primers are given in Table 2. Sense and antisense sequencing was performed for confirmation. Statistical analysis
Table 3 Survival analysis of clinical and histological parameters. Univariate analysis by Mantel-Cox log-rank test, and multivariate analysis by Cox regression. Univariate analysis Multivariate analysis Log rank SNSCC Gender Tumour site pT classification pN classification Tumour stage Orbit invasion Intracranial invasion Histological differentiation Radiotherapy ITAC
4.772 0.054 0.845 0.772 0.885 0.039 2.945
Significance Hazard ratio p-value (95% C.I.)
Significance p-value
0.029 0.816 0.358 0.680 0.347 0.844 0.086
0.072 0.985 2.396 0.122
Tumour stagea
37.682 0.0001
Intracranial invasion Histological subtypeb Radiotherapy
51.436 0.0001 6.987 0.008
3.437 (0.912– 12.951) 7.047 (1.589– 31.259) 3.158 (1.249– 7.980)
0.068 0.010 0.015
0.255 0.614
Possible correlations between genetic and clinical parameters were statistically analysed by SPSS 12.0 software for Windows (SPSS Inc., Chicago, IL), using the Pearson chi-square test and Fischer’s exact test. Kaplan–Meier analysis was performed for estimation of survival, comparing distributions of survival through the Mantel-Cox log-rank test. Multivariate Cox regression analysis was performed to examine the relative impact on outcome of the variables that appeared statistically significant in univariate analysis. Values of p < 0.05 were considered significant.
C.I.: confidence interval. a ITAC tumour stage was dichotomized as stages I–III versus IVa–IVb. b ITAC histopathological type was dichotomized as papillary/colonic versus solid/ mucinous type.
Results
Evaluation of KRAS and BRAF mutations
Follow-up
Sequence analysis of KRAS codon 12 and 13 mutations was successful for 35/57 SNSCC DNA samples (extracted from paraffin embedded tissue) and for all of the 58 ITAC DNA samples (extracted from fresh frozen tissue). All 35 cases of SNSCC showed wildtype KRAS, whereas 7/58 (12%) ITAC demonstrated a mutation, five in codon 12 and two in codon 13. Six of the mutations concerned a G ? A transition (Fig. 1) and one a G ? T transversion. BRAF exon 15 (V600E) showed absence of mutations in 33 analizable SNSCC and in all 58 ITAC. KRAS mutation occurred in one papillary and in six colonic type ITAC. The predilection of KRAS mutations for well-differentiated tumours (seven of seven) was significantly different from KRAS wildtype cases (26 of 51) (Fisher Exact Chi2, p = 0.016). Likewise KRAS mutated cases occurred in relatively less aggressive ITAC (only one of seven showed intracranial invasion). However, overall or disease-free survival was not different between mutated and wildtype cases. All seven ITAC with KRAS mutated concerned patients with professional exposure to wood dust, and four of seven were also tobacco smokers.
During the course of follow-up of the 57 SNSCC patients, 47 patients developed local recurrences (82%), six of whom also developed distant metastasis (10%). At the time of the current report, a total of 10 patients remained disease free (19%). The overall 5year survival rate was 15%, and the 1-year and 5-year disease-free survival rates were 22% and 6%, respectively. The main causes of death in our series were local recurrences and distant metastasis. However, six patients died during the postoperative period or because of intercurrent causes. We observed a significant relation between overall survival and gender, with male patients having a worse outcome (log rank 4.772, p = 0.029). Other clinical parameters like localisation, histological differentiation, tumour stage, disruption of the orbit, intracranial invasion, or affected lymph nodes at the time of diagnosis did not show prognostic value (Table 3). Patients with advanced tumours (T3-T4; p = 0.0021) and with disruption of the orbit (p = 0.001) developed early recurrence after treatment. Of 58 ITAC patients, 26 patients (45%) developed local recurrence, six patients distant metastasis (14%), and two both recurrence and metastasis. At the time of writing, a total of 26 (45%) patients remained disease-free. The overall 5-year survival was 54%, 5-year disease-free survival was 41%. The main cause of death in our series was local recurrence and intracranial invasion. However, 4 patients died during the postoperative period or due to intercurrent causes. Overall survival was significantly related to histopathological type (using all four types: log rank 32.902, p = 0.0001), tumour stage (using five stage-groups: log rank 59.521, p = 0.0001) and intracranial invasion (log rank 51.436, p = 0.0001) at the time of diagnosis (Table 3). Multivariate Cox regression analysis, with histopathological type and tumour stage
dichotomized (papillary/colonic versus solid/mucinous and tumour stages I–III versus IVa–IVb, respectively), revealed only intracranial invasion and histopathological type as independent prognostic factors (Table 3).
Discussion Knowledge on the genetic changes involved in ITAC and SNSCC is increasing,8,9,16 which is relevant with regard to clinical decision making and possibilities for the application of molecularly targeted cancer therapies.17,18 Monoclonal antibodies and TKIs against ErbB receptors have shown promising results in the treatment of colorectal, lung, breast and HNSCC, also with a synergistic effect when combined with chemotherapy. EGFR and ERBB2 amplification and/ or overexpression are present in a substantial subset of patients with SNSCC and ITAC.8,9 Therefore, theoretically, EGFR antagonists could be used in some patients.
F. López et al. / Oral Oncology 48 (2012) 692–697
695
Figure 1 Sequence analysis of part of KRAS exon 2. (Top) Normal control DNA showing the wildtype sequence. (Bottom) A stage III, colonic type ITAC of a patient with wood dust and tobacco etiology, showing a G ? A missense mutation at codon 13.
However, the response of cancer patients to molecular targeted therapy depends not only on factors such as the expression, amplification and mutation status of EGFR, but also on downstream effectors of the EGFR pathway such as KRAS, BRAF and PIK3CA, the presence of the echinoderm microtubule-associated proteinlike 4/anaplastic lymphoma kinase (EML4/ALK) fusion gene and phosphatase and tensin homologue (PTEN) gene expression. Screening for these markers in patients with sinonasal carcinomas might provide additional information for the selection of optimal candidates for EGFR-based therapy. EGFR mutations are rare in HNSCC carcinomas with frequencies between 1% in the caucasian and 7% in the asian population.19 Activating PIK3CA and inactivating PTEN mutations have been reported in 10–20% and 10% of HNSCC patients, respectively19 and therefore does not seem to have value in response prediction to EGFR antagonists.20 RAS is one of the most important molecules in the EGFR downstream signalling pathway and can activate the serine/threonine kinase RAF, mitogen-activated kinases ERK1 and ERK2, phosphatidylinositol 3-kinase, and a number of proteins that translocate to the nucleous to promote cell proliferation. Mutations in the KRAS gene occur early in the development of many cancers.21 Commonly restricted to codon 12 and 13 in exon 2, these mutations cause impaired GTPase activity and result in a continual stimulus for cellular proliferation. They have been found in more than 90% of pancreatic carcinomas, 40% of colorectal cancers and 33% of non-small cell lung carcinomas.22 Several studies have revealed that patients with KRAS mutation usually had a worse prognosis when being
treated with gefitinib or erlotinib in lung cancer23 and also in colorectal cancer had a poor response to monoclonal antibody against EGFR (cetuximab) therapy.24 In contrast to tumours of different lineage, oncogenic RAS mutations are rarely found within HNSCC.25 Overall, KRAS mutations are found in approximately 3,5% of HNSCC.21 Van Damme et al. studied the mutation of KRAS in tonsil squamous cell carcinoma and detected it in only two of 22 (9%) patients,26 and no mutation in KRAS was found in 47 oral squamous cell carcinomas by Wang et al.27 Our KRAS data on sinonasal carcinomas, showing mutation in 0% in SNSCC and 12% ITAC, are in agreement with these low frequencies reported in HNSCC. Our data also concur with the study of Bornholdt et al.28 who studied 174 sinonasal carcinomas, including 107 SNSCC and 23 ITAC, and found one SNSCC case only (1%) with KRAS mutation and 13% of adenocarcinomas (without specifying the exact frequency for ITAC). Other reports on KRAS mutation in sinonasal carcinoma have focussed only on ITAC and usually included a limited number of patients. With the exception of Frattini et al. who found 50% (9/18 cases),29 all confirm a low involvement, around 13–16% of KRAS mutations.30–32 It has been argued that the differences in the prevalence of mutations might be related to differences in wood dust exposure. In our series, all ITAC patients with KRAS mutations had professional exposure to wood dust. In our series, G ? A transition was the most common mutation type (6/7), as in previous studies.28,29,31 It may be that this specific mutation is related to the wood dust etiology of these tumours.28,29,31 Predominant G ? A transitions in wood dust related
696
F. López et al. / Oral Oncology 48 (2012) 692–697
ITAC have also been reported in the gene TP53.33,34 In contrast, G ? T transversions are associated with tobacco35 and their infrequent occurrence in sinonasal cancer would exclude tobacco as an additional etiological factor in these tumours. BRAF is a protein kinase which is activated by membranebound RAS. BRAF and KRAS mutations are thought to be functionally redundant and therefore mutually exclusive.36 BRAF somatic missense mutations are found in about 15% of all human cancers,37 predominantly in malignant melanomas.38 V600E amino acid substitution in the activation segment accounts for 90% of BRAF mutations and is significantly associated with microsatellite instability.39 Several studies suggest that mutated BRAF can affect the response to anti-EGFR monoclonal antibodies in patients with wild type KRAS,35 40–60% of whom do not respond to such therapy.40 In contrast to melanoma37 or colorectal cancer,41 BRAF mutation is detected in only a small number of HNSCC. Weber et al. detected BRAF mutation in 3 out of 81 (4%) HNSCC.36 All mutations activating BRAF missense mutations within exons 11 and 15. To our knowledge, this paper is the first to present data on somatic BRAF mutation in sinonasal cancer. We found complete absence of BRAF mutations in both SNSCC and ITAC, which is consistent with those reported in more prevalent and far more studied HNSCC. This result indicates that the kinase inhibitor for BRAF (sorafenib)42 could be used in these tumours. Current guidelines state that patients with tumours (i.e. metastatic colorectal carcinomas) being considered for EGFRtargeted therapies should be tested for KRAS and BRAF mutations.43 However, in contrast to colorectal cancer, our results showed that in sinonasal carcinoma, mutations in KRAS are rare and absent in BRAF. Therefore, KRAS/BRAF mutation analysis cannot be used to preclude patients from receiving anti-EGFR-TKIs. Moreover, our data on BRAF suggest that these patients may benefit from small molecule inhibitors such as sorafenib. However, further clinical trials will be necessary to elucidate the role of anti EGFR therapies in a substantial subset of patients with sinonasal cancer. Conflict of interest statement None declared. References 1. Turner JH, Reh DD. Incidence and survival in patients with sinonasal cancer: a historical analysis of population-based data. Head Neck 2011 Epub ahead of print. 2. Dulguerov P, Allal AS. Nasal and paranasal sinus carcinoma: how can we continue to make progress? Curr Opin Otolaryngol Head Neck Surg. 2006;14:67–72. 3. Dulguerov P, Jacobsen MS, Allal AS, Lehmann W, Calcaterra T. Nasal and paranasal sinus carcinoma: are we making progress? A series of 220 patients and a systematic review. Cancer 2001;92:3012–29. 4. Robbins KT, Ferlito A, Silver CE, Takes RP, Strojan P, Snyderman CH, et al. Contemporary management of sinonasal cancer. Head Neck 2011;33: 1352–65. 5. Cantu G, Solero CL, Mariani L, Lo Vullo S, Riccio S, Colombo S, et al. Intestinal type adenocarcinoma of the ethmoid sinus in wood and leather workers: a retrospective study of 153 cases. Head Neck 2011;33:535–42. 6. Mannetje A, Kogevinas M, Luce D, Demers PA, Bégin D, Bolm-Audorff U, et al. Sinonasal cancer, occupation, and tobacco smoking in European women and men. Am J Ind Med 1999;36:101–7. 7. Gotte K, Hormann K. Sinonasal malignancy: what’s new? Review. ORL J Otorhinolaryngol Relat Spec 2004;66:85–97. 8. López F, Llorente JL, García-Inclán C, Alonso-Guervós M, Cuesta-Albalad MP, Fresno MF, et al. Genomic profiling of sinonasal squamous cell carcinoma. Head Neck 2011;33:145–53. 9. Franchi A, Fondi C, Paglierani M, Pepi M, Gallo O, Santucci M. Epidermal growth factor receptor expression and gene copy number in sinonasal intestinal type adenocarcinoma. Oral Oncol 2009;45(9):835–8. 10. Sharafinski ME, Ferris RL, Ferrone S, Grandis JR. Epidermal growth factor receptor targeted therapy of squamous cell carcinoma of the head and neck. Head Neck 2010;32:1412–21.
11. Machiels JP, Schmitz S. Molecular-targeted therapy of head and neck squamous cell carcinoma: beyond cetuximab-based therapy. Curr Opin Oncol 2011;23: 241–8. 12. Sundvall M, Karrila A, Nordberg J, Grenman R, Elenius K. EGFR targeting drugs in the treatment of head and neck squamous cell carcinoma. Expert Opin Emerg Drugs 2010;15:185–201. 13. Normanno N, Tejpar S, Morgillo F, De Luca A, Van Cutsem E, Ciardiello F. Implications for KRAS status and EGFR-targeted therapies in metastatic CRC. Nat Rev Clin Oncol 2009;6:519–27. 14. Sobin LH. In: Gospodarowicz MK, Wittekind C, editors. TNM classification of malignant tumours. 7th ed. New York: Wiley-Blackwell; 2009. 15. Franchi A, Santucci M, Wenig B. Adenocarcinoma. In: Barnes L, Eveson JW, Reichart P, Sidransky D, editors. Pathology and genetics of head and neck tumours, World health organization classification of tumours. 5th ed. Lyon: IARC; 2005. p. 20–3. 16. Hermsen MA, Llorente JL, Pérez-Escuredo J, López F, Ylstra B, Alvarez-Marcos C, et al. Genome-wide analysis of genetic changes in intestinal-type sinonasal adenocarcinoma. Head Neck 2009;31:290–7. 17. Machiels JP, Schmitz S. Molecular-targeted therapy of head and neck squamous cell carcinoma: beyond cetuximab-based therapy. Curr Opin Oncol 2011;23: 241–8. 18. Sundvall M, Karrila A, Nordberg J, Grénman R, Elenius K. EGFR targeting drugs in the treatment of head and neck squamous cell carcinoma. Expert Opin Emerg Drugs 2010;15:185–201. 19. Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer 2011 Jan;11(1):9–22. 20. Sharafinski ME, Ferris RL, Ferrone S, Grandis JR. Epidermal growth factor receptor targeted therapy of squamous cell carcinoma of the head and neck. Head Neck 2010;32:1412–21. 21. Loriot Y, Mordant P, Deutsch E, Olaussen KA, Soria JC. Are RAS mutation predictive marker of resistance to standard chemotherpy? Nat Rev Clin Oncol 2009;6:528–34. 22. Adjei AA. Blocking oncogenic Ras signaling for cancer therapy. J Natl Cancer Inst 2001;93:1062–74. 23. Massarelli E, Varella-Garcia M, Tang X, Xavier AC, Ozburn NC, Liu DD, et al. KRAS mutation is an important predictor of resistance to therapy with epidermal growth factor receptor tyrosine kinase inhibitors in non small- cell lung cancer. Clin Cancer Res 2007;13:2890–6. 24. Lièvre A, Bachet JB, Le Corre D, Boige V, Landi B, Emile JF, et al. KRAS mutation status is predictive of response to cetuximab therapy in colorectal cancer. Cancer Res 2006;66:3992–5. 25. Hao D, Rowinsky EK. Inhibiting signal transduction: recent advances in the development of receptor tyrosine kinase and Ras inhibitors. Cancer Invest 2002;20:387–404. 26. Van Damme N, Deron P, Van Roy N, Demetter P, Bols A, Van Dorpe J, et al. Epidermal growth factor receptor and K-RAS status in two cohorts of squamous cell carcinomas. BMC Cancer 2010;10:189. 27. Wang WY, Chien YC, Wong YK, Lin YL, Lin JC. Effects of KRAS mutation and polymorphism on the risk and prognosis of oral squamous cell carcinoma. Head Neck 2011 Epub ahead of print. 28. Bornholdt J, Hansen J, Steiniche T, Dictor M, Antonsen A, Wolff H, et al. K-ras mutations in sinonasal cancers in relation to wood dust exposure. BMC Cancer 2008;8:53. 29. Frattini M, Perrone F, Suardi S, Balestra D, Caramuta S, Colombo F, et al. Phenotype-genotype correlation: challenge of intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Head Neck 2006;28:909–15. 30. Perez P, Dominguez O, Gonzalez S, Gonzalez S, Trivino A, Suárez C. Ras gene mutation in ethmoid sinus adenocarcinoma: prognostic implications. Cancer 1999;86:255–64. 31. Saber AT, Nielsen LR, Dictor M, Hagmar L, Mikoczy Z, Wallin H. K-ras mutations in sinonasal adenocarcinomas in patients occupationally exposed to wood or leather dust. Cancer Lett 1998;126:59–65. 32. Yom SS, Rashid A, Rosenthal DI, Elliott DD, Hanna EY, Weber RS, et al. Genetic analysis of sinonasal adenocarcinoma phenotypes: distinct alterations of histogenetic significance. Mod Pathol 2005;18:315–9. 33. Perrone F, Oggionni M, Birindelli S, et al. TP53, p14ARF, p16INK4a and H-ras gene molecular analysis in intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Int J Cancer 2003;105:196–203. 34. Holmila R, Bornholdt J, Suitiala T, et al. Profile of TP53 gene mutations in sinonasal cancer. Mutat Res 2010;686:9–14. 35. Olivier M, Hussain SP, Caron de Fromentel C, Hainaut P, Harris CC. TP53 mutation spectra and load: a tool for generating hypotheses on the etiology of cancer. IARC Sci Publ 2004;157:247–70. 36. Weber A, Langhanki L, Sommerer F, Markwarth A, Wittekind C, Tannapfel A. Mutations of the BRAF gene in squamous cell carcinoma of the head and neck. Oncogene 2003;22:4757–9. 37. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature 2002;417:949–54. 38. Hingorani SR, Jacobtz MA, Robertson GP, Herlyn M, Tuveson DA. Suppression of BRAF V599E in human melanoma abrogates transformation. Cancer Res 2003;63:5198–202. 39. Rajagopalan H, Bardelli A, Lengauer C, Kinzler KW, Vogelstein B, Velculescu VE. Tumourigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature 2002;418:934. 40. Wilson PM, Labonte MJ, Lenz HJ. Molecular markers in the treatment of metastatic colorectal cancer. Cancer J 2010;16:262–72.
F. López et al. / Oral Oncology 48 (2012) 692–697 41. Loupakis F, Ruzzo A, Cremolini C, Vincenzi B, Salvatore L, Santini D, et al. KRAS codon 61, 146 and BRAF mutations predict resistance to cetuximab plus irinotecan in KRAS codon 12 and 13–27-wild-type metastatic colorectal cancer. Br J Cancer 2009;101:715–21.
697
42. Si L, Kong Y, Xu X, Flaherty KT, Sheng X, Cui C, et al. Prevalence of BRAF V600E mutation in Chinese melanoma patients: large scale analysis of BRAF and NRAS mutations in a 432-case cohort. Eur J Cancer 2012;48:94–100. 43. National Comprehensive Cancer Network. Guidelines for Colon and Rectal, Cancer. v. 1.2010.
Contents lists available at SciVerse ScienceDirect
Oral Oncology journal homepage: www.elsevier.com/locate/oraloncology
KRAS and BRAF mutations in sinonasal cancer Fernando López a, Cristina García Inclán a, Jhudit Pérez-Escuredo a, César Álvarez Marcos a, Bartolomé Scola b, Carlos Suárez a, José Luis Llorente a, Mario A. Hermsen a,⇑ a b
Department of Otolaryngology, Instituto Universitario de Oncología del Principado de Asturias, Hospital Universitario Central de Asturias, Oviedo, Spain Department of Otolaryngology, Hospital Gregorio Marañon, Madrid, Spain
a r t i c l e
i n f o
Article history: Received 16 January 2012 Received in revised form 14 February 2012 Accepted 17 February 2012 Available online 27 March 2012 Keywords: Maxillary sinus Ethmoid sinus Sinonasal Squamous cell carcinoma Adenocarcinoma KRAS BRAF
s u m m a r y Objetives: Despite improvements in the field of surgery and radiotherapy, the overall prognosis of sinonasal carcinomas is poor, mainly due to the difficulty to resect the tumour completely in this anatomically complex region. Therefore, there is great need for alternative treatments. Knowledge of the KRAS and BRAF mutational status would become clinically important with regard to the possible use of antiEGFR therapies. Material and methods: DNA was extracted from paraffin embedded tumour samples from 57 cases of sinonasal squamous cell carcinoma (SNSCC) and from fresh frozen tumour samples from 58 cases of intestinal-type sinonasal adenocarcinoma (ITAC). Point mutations were analysed for KRAS exon 2 (codons 12 and 13) and BRAF (exon 15, V600E) by direct sequencing. Results: Neither KRAS nor BRAF showed any mutations in the SNSCC, whereas 7/58 (12%) ITAC harboured KRAS mutations and no BRAF mutations. All seven cases with KRAS mutation concerned well-differentiated and less aggressive (papillary and colonic type) ITAC, all patients being woodworkers and 4/7 tobacco smokers. Conclusion: Neither of SNSCCs carried mutations in KRAS and BRAF and a low frequency of KRAS mutation was found in ITAC. This suggests that KRAS and BRAF mutations play a limited role in the development of sinonasal cancer and that mutation analysis is not useful as a screening test for sensitivity to anti-EGFR therapy in sinonasal cancer. Ó 2012 Elsevier Ltd. All rights reserved.
Introduction Sinonasal squamous cell carcinomas (SNSCCs) and intestinaltype sinonasal adenocarcinomas (ITACs) are epithelial tumours originating in the respiratory mucosa of the nasal cavities and paranasal sinuses. Cancer of the sinonasal cavities is rare with an annual incidence rate of <1 case per 100,000 inhabitants per year in Spain, occurring predominantly among men with a mean age of presentation of 50–60 years. A wide variety of histological types of tumours originates in this anatomic area, mostly epithelial (>75%), of which the most common is SNSCC, accounting for 50% of all nasal epithelial tumours, followed by ITAC with 12%.1 This is a complex anatomic area, close to structures such the eyes and the brain, which is of special relevance for surgery and postoperative treatment, since mutilation and aesthetic deformities are difficult to avoid. ⇑ Corresponding author. Address: Department of Otolaryngology, Instituto Universitario de Oncología del Principado de Asturias (IUOPA), Edificio H Covadonga 1ª Planta Centro, lab 2, Hospital Universitario Central de Asturias, Celestino Villamil s/n, 33006 Oviedo, Spain. Tel.: +34 985 107956; fax: +34 985 108015. E-mail address: [email protected] (M.A. Hermsen). 1368-8375/$ - see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.oraloncology.2012.02.018
SNSCC and ITAC tend to present at advanced stages, although lymph node or distant metastases are infrequent. Current therapeutic modalities include surgery followed by radiotherapy in advanced stages, sometimes with chemotherapy treatment.1–4 However, despite improvements in the field of surgery and radiotherapy, patients still face a very unfavourable prognosis. Local recurrence and intracranial invasion are the main causes of death. The overall 5-year survival varies between 22% and 67%.3 Therefore, new therapeutic approaches are needed to improve these figures and the development of new treatment strategies for SNSCC and ITAC remains a challenge. Although it is well-known that SNSCC and ITAC are etiologically related to occupational exposure to wood, leather and other types of organic dust,5–7 the tumourigenesis of these tumours is still poorly understood. However, molecular genetic analysis is becoming increasingly important in characterising the genetic ‘signatures’ of tumours and in aiding clinical management by novel anti-cancer treatments. Epidermal growth factor receptor (EGFR) is a member of the erbB family of tyrosine kinase receptor proteins, which also include erb-B2 (HER2/neu), erb-B3, and erb-B4. Ligand occupancy of EGFR activates the RAS/RAF/MAPK, STAT and PI3K signalling pathways,
693
F. López et al. / Oral Oncology 48 (2012) 692–697
which together modulate cellular proliferation, adhesion, angiogenesis and migration and promotes malignant transformation. EGFR has been validated as a therapeutic target in several malignancies, including colorectal and pancreatic adenocarcinoma and head and neck squamous cell carcinoma (HNSCC). Previous studies have indicated that a substantial proportion of SNSCC and ITAC carry EGFR gene copy number alterations and may benefit from EGFR antagonist therapy in the same way as HNSCC.8,9 Clinical trials with monoclonal antibodies directed against the extracellular domain of EGFR and small-molecule tyrosine kinase inhibitors (TKIs) directed to the intracellular catalytic domains have been performed in HNSCC and two anti-EGFR monoclonal antibodies (cetuximab and panitumumab) and two small-molecule tyrosine kinase inhibitors (gefitinib and erlotinib) have been approved for the treatment of HNSCC in several countries.10–12 However, only demonstrated modest response rates have been achieved. Potential mechanisms for the lack of response to EGFR inhibition in HNSCC include constitutive activation of signalling pathways independent of EGFR, as well as genetic aberrations causing dysregulation of the cell cycle or mutation of downstream effectors such as KRAS and BRAF.13 Since KRAS and BRAF mutations could be negative predictive factors for anti-EGFR therapies, we sought to determine the incidence of KRAS and BRAF mutations in sinonasal carcinomas.
Table 1 Patient and tumour characteristics.
Material and methods
the ethmoid sinus. The mean age was 66 years (range 45– 92 years). Eighteen tumours (31%) were stage I, 9 (16%) stage II, 17 (29%) stage III, 10 (17%) stage IVA, and 4 (7%) stage IVB. No patient had lymph node or distant metastases at the time of diagnosis. According to the World Health Organisation histological classification,15 our series comprised 5 (9%) papillary type or PTCC-I (Papillary Tubular Cylinder Cell-I), 29 (50%) colonic (PTCCII), 5 (9%) solid (PTCC-III), and 19 (32%) mucinous type tumours. Thirty-five patients (60%) received radiotherapy after radical surgery. Follow-up information was available with a median of 41 months (range 1–212 months). A summary of all the clinical data is given in Table 1.
Tumour specimens Between 1990 and 2009, 57 surgical tissue specimens from patients who were diagnosed of SNSCC were collected at the Departments of Otolaryngology at Central University Hospital of Asturias (Oviedo, Spain) and Gregorio Marañon General University Hospital (Madrid, Spain) and 58 surgical tissue specimens from patients who were diagnosed of ITAC were collected at the Department of Otolaryngology at Central University Hospital of Asturias (Oviedo, Spain). All 57 SNSCC samples proceeded from paraffin embedded tissue after histopathological analysis and all 58 ITAC samples were obtained from surgical resection specimens of non-necrotic tumour areas that were immediately stored in liquid nitrogen after surgery. All patients who were enrolled in the study provided written informed consent for the collection, storage, and analysis of specimens; and the study had received prior approval from our institutional ethical committees. All patients underwent radical surgery. Representative tissue sections were obtained from archival paraffin-embedded blocks. Clinical variables Of 57 SNSCC patients, 41 were male (72%) and 16 female (28%). The mean patient age was 66 years (range 47–91 years). Forty-six tumours were localised in the maxillary sinus (81%), and 11 in the ethmoid sinus (19%). The series comprised of 20 well differentiated tumours (35%), 11 moderately differentiated tumours (19%), and 26 poorly differentiated tumours (46%). According to the TNM system for tumour classification (T),14 seven tumours were T2 (12%), 17 T3 (30%), 25 T4a (44%), and 8 T4b (14%). Classified disease according to stage, the series consisted of six stage II (10%), 18 stage III tumours (32%), 25 stage IVA (44%), and 8 stage IVB tumours (14%). At the time of surgery, 15 patients (26%) had lymph node metastasis, and no patient had distant metastases. Fortythree patients (75%) received radiotherapy after radical surgery. The median follow-up was 27 months (range, 3–211 months). All 58 ITAC patients were male, 54 had professional exposure to wood dust and 28 were tobacco users. All 58 ITAC were located in
Characteristic
Gender Tumour site pT classification
Disease stage
pN classification Histological differentiation
Histological subtype
No. of patients (%)
Female Male Maxillary sinus Ethmoid sinus T1 T2 T3 T4a T4b I II III IVa IVb N0 N1 Well differentiated Moderately differentiated Poorly differentiated Papillary (PTCC-I) Colonic (PTCC-II) Solid (PTCC-III) Mucinous
SNSCC
ITAC
16 (28) 41 (72) 46 (81) 11 (19) 0 (0) 7 (12) 17 (30) 25 (44) 8 (14) 0 (0) 6 (10) 18 (32) 25 (44) 8 (14) 42 (74) 15 (26) 20 (35) 11 (19) 26 (46)
0 (0) 58 (100) 0 (0) 58 (100) 18 (31) 9 (16) 17 (29) 10 (17) 4 (7) 18 (31) 9 (16) 17 (29) 10 (17) 4 (7) 58 (100) 0 (0)
5 (9) 29 (50) 5 (9) 19 (32)
DNA extraction Tumour DNA was extracted from frozen tissue and paraffinembedded tissue samples using Qiagen extraction kits (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s recommendations. Special care was taken to obtain high-quality DNA from the formaldehyde-fixed, paraffin-embedded SNSCC tissues. DNA extracted from archival material can be partly degraded and cross-linked, the extent of which depends on the pH of the formaldehyde and the time of the fixation before paraffin embedding. To improve the quality of the isolated DNA, we applied an elaborate extraction protocol especially for paraffin tissues, which includes thorough deparaffinization with xylene, methanol washings to remove all traces of the xylene, and a 24-h incubation in 1 mol/L sodium thiocyanate to reduce crosslinks. Subsequently, the tissue pellet is dried and digested for 3 days in lysis buffer with high doses of proteinase K (final concentration, 2 lg/lL, freshly added twice daily). With this protocol, most formaldehyde-fixed, paraffin embedded tissue samples yielded DNA of relatively good quality with A260/A280 values between 1.7 and 2.0 measured by Nanodrop (Thermo Scientific, Wilmington, Del) and lengths between 2000 and 20,000 base pairs. KRAS and BRAF mutation analysis KRAS exon 2 (codons 12 and 13) and BRAF exon 15 (V600E) were analysed by direct sequencing. Reactions were set up in standard
694
F. López et al. / Oral Oncology 48 (2012) 692–697
Table 2 Oligonucleotides used for PCR amplification and sequencing. Oligonucleotide
Sequence 50 to 30
KRAS exon 2F KRAS exon 2R BRAF exon 15F BRAF exon 15R
TACTGGTGGAGTATTTGATAGTG CTGTATCAAAGAATGGTCCTG CTTCATAATGCTTGCTCTGATAGG GCATCTCAGGGCCAAAAAT
conditions with a 50 -first step at 95 °C followed by 30 cycles, (30 min 95 °C, 45 min 60 °C, 30 min 70 °C) for KRAS and 45 cycles (15 min 95 °C, 30 min 58 °C, 30 min 72 °C) for BRAF. Products were purified with High Pure PCR product purification kit (Roche) following manufacturer’s instructions. Sequencing PCR was set up with kit Big Dye TerminatorÒ v1.1 (Applied Biosystems) and analysed using the ABI PRISM 3100 and 3730 Genetic Analyser (Applied Biosystems, Foster City CA, USA). The primers are given in Table 2. Sense and antisense sequencing was performed for confirmation. Statistical analysis
Table 3 Survival analysis of clinical and histological parameters. Univariate analysis by Mantel-Cox log-rank test, and multivariate analysis by Cox regression. Univariate analysis Multivariate analysis Log rank SNSCC Gender Tumour site pT classification pN classification Tumour stage Orbit invasion Intracranial invasion Histological differentiation Radiotherapy ITAC
4.772 0.054 0.845 0.772 0.885 0.039 2.945
Significance Hazard ratio p-value (95% C.I.)
Significance p-value
0.029 0.816 0.358 0.680 0.347 0.844 0.086
0.072 0.985 2.396 0.122
Tumour stagea
37.682 0.0001
Intracranial invasion Histological subtypeb Radiotherapy
51.436 0.0001 6.987 0.008
3.437 (0.912– 12.951) 7.047 (1.589– 31.259) 3.158 (1.249– 7.980)
0.068 0.010 0.015
0.255 0.614
Possible correlations between genetic and clinical parameters were statistically analysed by SPSS 12.0 software for Windows (SPSS Inc., Chicago, IL), using the Pearson chi-square test and Fischer’s exact test. Kaplan–Meier analysis was performed for estimation of survival, comparing distributions of survival through the Mantel-Cox log-rank test. Multivariate Cox regression analysis was performed to examine the relative impact on outcome of the variables that appeared statistically significant in univariate analysis. Values of p < 0.05 were considered significant.
C.I.: confidence interval. a ITAC tumour stage was dichotomized as stages I–III versus IVa–IVb. b ITAC histopathological type was dichotomized as papillary/colonic versus solid/ mucinous type.
Results
Evaluation of KRAS and BRAF mutations
Follow-up
Sequence analysis of KRAS codon 12 and 13 mutations was successful for 35/57 SNSCC DNA samples (extracted from paraffin embedded tissue) and for all of the 58 ITAC DNA samples (extracted from fresh frozen tissue). All 35 cases of SNSCC showed wildtype KRAS, whereas 7/58 (12%) ITAC demonstrated a mutation, five in codon 12 and two in codon 13. Six of the mutations concerned a G ? A transition (Fig. 1) and one a G ? T transversion. BRAF exon 15 (V600E) showed absence of mutations in 33 analizable SNSCC and in all 58 ITAC. KRAS mutation occurred in one papillary and in six colonic type ITAC. The predilection of KRAS mutations for well-differentiated tumours (seven of seven) was significantly different from KRAS wildtype cases (26 of 51) (Fisher Exact Chi2, p = 0.016). Likewise KRAS mutated cases occurred in relatively less aggressive ITAC (only one of seven showed intracranial invasion). However, overall or disease-free survival was not different between mutated and wildtype cases. All seven ITAC with KRAS mutated concerned patients with professional exposure to wood dust, and four of seven were also tobacco smokers.
During the course of follow-up of the 57 SNSCC patients, 47 patients developed local recurrences (82%), six of whom also developed distant metastasis (10%). At the time of the current report, a total of 10 patients remained disease free (19%). The overall 5year survival rate was 15%, and the 1-year and 5-year disease-free survival rates were 22% and 6%, respectively. The main causes of death in our series were local recurrences and distant metastasis. However, six patients died during the postoperative period or because of intercurrent causes. We observed a significant relation between overall survival and gender, with male patients having a worse outcome (log rank 4.772, p = 0.029). Other clinical parameters like localisation, histological differentiation, tumour stage, disruption of the orbit, intracranial invasion, or affected lymph nodes at the time of diagnosis did not show prognostic value (Table 3). Patients with advanced tumours (T3-T4; p = 0.0021) and with disruption of the orbit (p = 0.001) developed early recurrence after treatment. Of 58 ITAC patients, 26 patients (45%) developed local recurrence, six patients distant metastasis (14%), and two both recurrence and metastasis. At the time of writing, a total of 26 (45%) patients remained disease-free. The overall 5-year survival was 54%, 5-year disease-free survival was 41%. The main cause of death in our series was local recurrence and intracranial invasion. However, 4 patients died during the postoperative period or due to intercurrent causes. Overall survival was significantly related to histopathological type (using all four types: log rank 32.902, p = 0.0001), tumour stage (using five stage-groups: log rank 59.521, p = 0.0001) and intracranial invasion (log rank 51.436, p = 0.0001) at the time of diagnosis (Table 3). Multivariate Cox regression analysis, with histopathological type and tumour stage
dichotomized (papillary/colonic versus solid/mucinous and tumour stages I–III versus IVa–IVb, respectively), revealed only intracranial invasion and histopathological type as independent prognostic factors (Table 3).
Discussion Knowledge on the genetic changes involved in ITAC and SNSCC is increasing,8,9,16 which is relevant with regard to clinical decision making and possibilities for the application of molecularly targeted cancer therapies.17,18 Monoclonal antibodies and TKIs against ErbB receptors have shown promising results in the treatment of colorectal, lung, breast and HNSCC, also with a synergistic effect when combined with chemotherapy. EGFR and ERBB2 amplification and/ or overexpression are present in a substantial subset of patients with SNSCC and ITAC.8,9 Therefore, theoretically, EGFR antagonists could be used in some patients.
F. López et al. / Oral Oncology 48 (2012) 692–697
695
Figure 1 Sequence analysis of part of KRAS exon 2. (Top) Normal control DNA showing the wildtype sequence. (Bottom) A stage III, colonic type ITAC of a patient with wood dust and tobacco etiology, showing a G ? A missense mutation at codon 13.
However, the response of cancer patients to molecular targeted therapy depends not only on factors such as the expression, amplification and mutation status of EGFR, but also on downstream effectors of the EGFR pathway such as KRAS, BRAF and PIK3CA, the presence of the echinoderm microtubule-associated proteinlike 4/anaplastic lymphoma kinase (EML4/ALK) fusion gene and phosphatase and tensin homologue (PTEN) gene expression. Screening for these markers in patients with sinonasal carcinomas might provide additional information for the selection of optimal candidates for EGFR-based therapy. EGFR mutations are rare in HNSCC carcinomas with frequencies between 1% in the caucasian and 7% in the asian population.19 Activating PIK3CA and inactivating PTEN mutations have been reported in 10–20% and 10% of HNSCC patients, respectively19 and therefore does not seem to have value in response prediction to EGFR antagonists.20 RAS is one of the most important molecules in the EGFR downstream signalling pathway and can activate the serine/threonine kinase RAF, mitogen-activated kinases ERK1 and ERK2, phosphatidylinositol 3-kinase, and a number of proteins that translocate to the nucleous to promote cell proliferation. Mutations in the KRAS gene occur early in the development of many cancers.21 Commonly restricted to codon 12 and 13 in exon 2, these mutations cause impaired GTPase activity and result in a continual stimulus for cellular proliferation. They have been found in more than 90% of pancreatic carcinomas, 40% of colorectal cancers and 33% of non-small cell lung carcinomas.22 Several studies have revealed that patients with KRAS mutation usually had a worse prognosis when being
treated with gefitinib or erlotinib in lung cancer23 and also in colorectal cancer had a poor response to monoclonal antibody against EGFR (cetuximab) therapy.24 In contrast to tumours of different lineage, oncogenic RAS mutations are rarely found within HNSCC.25 Overall, KRAS mutations are found in approximately 3,5% of HNSCC.21 Van Damme et al. studied the mutation of KRAS in tonsil squamous cell carcinoma and detected it in only two of 22 (9%) patients,26 and no mutation in KRAS was found in 47 oral squamous cell carcinomas by Wang et al.27 Our KRAS data on sinonasal carcinomas, showing mutation in 0% in SNSCC and 12% ITAC, are in agreement with these low frequencies reported in HNSCC. Our data also concur with the study of Bornholdt et al.28 who studied 174 sinonasal carcinomas, including 107 SNSCC and 23 ITAC, and found one SNSCC case only (1%) with KRAS mutation and 13% of adenocarcinomas (without specifying the exact frequency for ITAC). Other reports on KRAS mutation in sinonasal carcinoma have focussed only on ITAC and usually included a limited number of patients. With the exception of Frattini et al. who found 50% (9/18 cases),29 all confirm a low involvement, around 13–16% of KRAS mutations.30–32 It has been argued that the differences in the prevalence of mutations might be related to differences in wood dust exposure. In our series, all ITAC patients with KRAS mutations had professional exposure to wood dust. In our series, G ? A transition was the most common mutation type (6/7), as in previous studies.28,29,31 It may be that this specific mutation is related to the wood dust etiology of these tumours.28,29,31 Predominant G ? A transitions in wood dust related
696
F. López et al. / Oral Oncology 48 (2012) 692–697
ITAC have also been reported in the gene TP53.33,34 In contrast, G ? T transversions are associated with tobacco35 and their infrequent occurrence in sinonasal cancer would exclude tobacco as an additional etiological factor in these tumours. BRAF is a protein kinase which is activated by membranebound RAS. BRAF and KRAS mutations are thought to be functionally redundant and therefore mutually exclusive.36 BRAF somatic missense mutations are found in about 15% of all human cancers,37 predominantly in malignant melanomas.38 V600E amino acid substitution in the activation segment accounts for 90% of BRAF mutations and is significantly associated with microsatellite instability.39 Several studies suggest that mutated BRAF can affect the response to anti-EGFR monoclonal antibodies in patients with wild type KRAS,35 40–60% of whom do not respond to such therapy.40 In contrast to melanoma37 or colorectal cancer,41 BRAF mutation is detected in only a small number of HNSCC. Weber et al. detected BRAF mutation in 3 out of 81 (4%) HNSCC.36 All mutations activating BRAF missense mutations within exons 11 and 15. To our knowledge, this paper is the first to present data on somatic BRAF mutation in sinonasal cancer. We found complete absence of BRAF mutations in both SNSCC and ITAC, which is consistent with those reported in more prevalent and far more studied HNSCC. This result indicates that the kinase inhibitor for BRAF (sorafenib)42 could be used in these tumours. Current guidelines state that patients with tumours (i.e. metastatic colorectal carcinomas) being considered for EGFRtargeted therapies should be tested for KRAS and BRAF mutations.43 However, in contrast to colorectal cancer, our results showed that in sinonasal carcinoma, mutations in KRAS are rare and absent in BRAF. Therefore, KRAS/BRAF mutation analysis cannot be used to preclude patients from receiving anti-EGFR-TKIs. Moreover, our data on BRAF suggest that these patients may benefit from small molecule inhibitors such as sorafenib. However, further clinical trials will be necessary to elucidate the role of anti EGFR therapies in a substantial subset of patients with sinonasal cancer. Conflict of interest statement None declared. References 1. Turner JH, Reh DD. Incidence and survival in patients with sinonasal cancer: a historical analysis of population-based data. Head Neck 2011 Epub ahead of print. 2. Dulguerov P, Allal AS. Nasal and paranasal sinus carcinoma: how can we continue to make progress? Curr Opin Otolaryngol Head Neck Surg. 2006;14:67–72. 3. Dulguerov P, Jacobsen MS, Allal AS, Lehmann W, Calcaterra T. Nasal and paranasal sinus carcinoma: are we making progress? A series of 220 patients and a systematic review. Cancer 2001;92:3012–29. 4. Robbins KT, Ferlito A, Silver CE, Takes RP, Strojan P, Snyderman CH, et al. Contemporary management of sinonasal cancer. Head Neck 2011;33: 1352–65. 5. Cantu G, Solero CL, Mariani L, Lo Vullo S, Riccio S, Colombo S, et al. Intestinal type adenocarcinoma of the ethmoid sinus in wood and leather workers: a retrospective study of 153 cases. Head Neck 2011;33:535–42. 6. Mannetje A, Kogevinas M, Luce D, Demers PA, Bégin D, Bolm-Audorff U, et al. Sinonasal cancer, occupation, and tobacco smoking in European women and men. Am J Ind Med 1999;36:101–7. 7. Gotte K, Hormann K. Sinonasal malignancy: what’s new? Review. ORL J Otorhinolaryngol Relat Spec 2004;66:85–97. 8. López F, Llorente JL, García-Inclán C, Alonso-Guervós M, Cuesta-Albalad MP, Fresno MF, et al. Genomic profiling of sinonasal squamous cell carcinoma. Head Neck 2011;33:145–53. 9. Franchi A, Fondi C, Paglierani M, Pepi M, Gallo O, Santucci M. Epidermal growth factor receptor expression and gene copy number in sinonasal intestinal type adenocarcinoma. Oral Oncol 2009;45(9):835–8. 10. Sharafinski ME, Ferris RL, Ferrone S, Grandis JR. Epidermal growth factor receptor targeted therapy of squamous cell carcinoma of the head and neck. Head Neck 2010;32:1412–21.
11. Machiels JP, Schmitz S. Molecular-targeted therapy of head and neck squamous cell carcinoma: beyond cetuximab-based therapy. Curr Opin Oncol 2011;23: 241–8. 12. Sundvall M, Karrila A, Nordberg J, Grenman R, Elenius K. EGFR targeting drugs in the treatment of head and neck squamous cell carcinoma. Expert Opin Emerg Drugs 2010;15:185–201. 13. Normanno N, Tejpar S, Morgillo F, De Luca A, Van Cutsem E, Ciardiello F. Implications for KRAS status and EGFR-targeted therapies in metastatic CRC. Nat Rev Clin Oncol 2009;6:519–27. 14. Sobin LH. In: Gospodarowicz MK, Wittekind C, editors. TNM classification of malignant tumours. 7th ed. New York: Wiley-Blackwell; 2009. 15. Franchi A, Santucci M, Wenig B. Adenocarcinoma. In: Barnes L, Eveson JW, Reichart P, Sidransky D, editors. Pathology and genetics of head and neck tumours, World health organization classification of tumours. 5th ed. Lyon: IARC; 2005. p. 20–3. 16. Hermsen MA, Llorente JL, Pérez-Escuredo J, López F, Ylstra B, Alvarez-Marcos C, et al. Genome-wide analysis of genetic changes in intestinal-type sinonasal adenocarcinoma. Head Neck 2009;31:290–7. 17. Machiels JP, Schmitz S. Molecular-targeted therapy of head and neck squamous cell carcinoma: beyond cetuximab-based therapy. Curr Opin Oncol 2011;23: 241–8. 18. Sundvall M, Karrila A, Nordberg J, Grénman R, Elenius K. EGFR targeting drugs in the treatment of head and neck squamous cell carcinoma. Expert Opin Emerg Drugs 2010;15:185–201. 19. Leemans CR, Braakhuis BJ, Brakenhoff RH. The molecular biology of head and neck cancer. Nat Rev Cancer 2011 Jan;11(1):9–22. 20. Sharafinski ME, Ferris RL, Ferrone S, Grandis JR. Epidermal growth factor receptor targeted therapy of squamous cell carcinoma of the head and neck. Head Neck 2010;32:1412–21. 21. Loriot Y, Mordant P, Deutsch E, Olaussen KA, Soria JC. Are RAS mutation predictive marker of resistance to standard chemotherpy? Nat Rev Clin Oncol 2009;6:528–34. 22. Adjei AA. Blocking oncogenic Ras signaling for cancer therapy. J Natl Cancer Inst 2001;93:1062–74. 23. Massarelli E, Varella-Garcia M, Tang X, Xavier AC, Ozburn NC, Liu DD, et al. KRAS mutation is an important predictor of resistance to therapy with epidermal growth factor receptor tyrosine kinase inhibitors in non small- cell lung cancer. Clin Cancer Res 2007;13:2890–6. 24. Lièvre A, Bachet JB, Le Corre D, Boige V, Landi B, Emile JF, et al. KRAS mutation status is predictive of response to cetuximab therapy in colorectal cancer. Cancer Res 2006;66:3992–5. 25. Hao D, Rowinsky EK. Inhibiting signal transduction: recent advances in the development of receptor tyrosine kinase and Ras inhibitors. Cancer Invest 2002;20:387–404. 26. Van Damme N, Deron P, Van Roy N, Demetter P, Bols A, Van Dorpe J, et al. Epidermal growth factor receptor and K-RAS status in two cohorts of squamous cell carcinomas. BMC Cancer 2010;10:189. 27. Wang WY, Chien YC, Wong YK, Lin YL, Lin JC. Effects of KRAS mutation and polymorphism on the risk and prognosis of oral squamous cell carcinoma. Head Neck 2011 Epub ahead of print. 28. Bornholdt J, Hansen J, Steiniche T, Dictor M, Antonsen A, Wolff H, et al. K-ras mutations in sinonasal cancers in relation to wood dust exposure. BMC Cancer 2008;8:53. 29. Frattini M, Perrone F, Suardi S, Balestra D, Caramuta S, Colombo F, et al. Phenotype-genotype correlation: challenge of intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Head Neck 2006;28:909–15. 30. Perez P, Dominguez O, Gonzalez S, Gonzalez S, Trivino A, Suárez C. Ras gene mutation in ethmoid sinus adenocarcinoma: prognostic implications. Cancer 1999;86:255–64. 31. Saber AT, Nielsen LR, Dictor M, Hagmar L, Mikoczy Z, Wallin H. K-ras mutations in sinonasal adenocarcinomas in patients occupationally exposed to wood or leather dust. Cancer Lett 1998;126:59–65. 32. Yom SS, Rashid A, Rosenthal DI, Elliott DD, Hanna EY, Weber RS, et al. Genetic analysis of sinonasal adenocarcinoma phenotypes: distinct alterations of histogenetic significance. Mod Pathol 2005;18:315–9. 33. Perrone F, Oggionni M, Birindelli S, et al. TP53, p14ARF, p16INK4a and H-ras gene molecular analysis in intestinal-type adenocarcinoma of the nasal cavity and paranasal sinuses. Int J Cancer 2003;105:196–203. 34. Holmila R, Bornholdt J, Suitiala T, et al. Profile of TP53 gene mutations in sinonasal cancer. Mutat Res 2010;686:9–14. 35. Olivier M, Hussain SP, Caron de Fromentel C, Hainaut P, Harris CC. TP53 mutation spectra and load: a tool for generating hypotheses on the etiology of cancer. IARC Sci Publ 2004;157:247–70. 36. Weber A, Langhanki L, Sommerer F, Markwarth A, Wittekind C, Tannapfel A. Mutations of the BRAF gene in squamous cell carcinoma of the head and neck. Oncogene 2003;22:4757–9. 37. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature 2002;417:949–54. 38. Hingorani SR, Jacobtz MA, Robertson GP, Herlyn M, Tuveson DA. Suppression of BRAF V599E in human melanoma abrogates transformation. Cancer Res 2003;63:5198–202. 39. Rajagopalan H, Bardelli A, Lengauer C, Kinzler KW, Vogelstein B, Velculescu VE. Tumourigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature 2002;418:934. 40. Wilson PM, Labonte MJ, Lenz HJ. Molecular markers in the treatment of metastatic colorectal cancer. Cancer J 2010;16:262–72.
F. López et al. / Oral Oncology 48 (2012) 692–697 41. Loupakis F, Ruzzo A, Cremolini C, Vincenzi B, Salvatore L, Santini D, et al. KRAS codon 61, 146 and BRAF mutations predict resistance to cetuximab plus irinotecan in KRAS codon 12 and 13–27-wild-type metastatic colorectal cancer. Br J Cancer 2009;101:715–21.
697
42. Si L, Kong Y, Xu X, Flaherty KT, Sheng X, Cui C, et al. Prevalence of BRAF V600E mutation in Chinese melanoma patients: large scale analysis of BRAF and NRAS mutations in a 432-case cohort. Eur J Cancer 2012;48:94–100. 43. National Comprehensive Cancer Network. Guidelines for Colon and Rectal, Cancer. v. 1.2010.