Krüppel-like factor 7 is required for olfactory bulb dopaminergic neuron development

E XP ER I ME NT AL CE L L R ES E AR CH 3 1 7 (2 0 11 ) 4 64 – 4 73

available at www.sciencedirect.com

www.elsevier.com/locate/yexcr

Research Article

Krüppel-like factor 7 is required for olfactory bulb dopaminergic neuron development Massimiliano Caiazzoa,b,⁎, Luca Colucci-D'Amatoa,c,⁎, Floriana Volpicellia , Luisa Speranzaa , Ciro Petronea , Lucio Pastored , Stefano Stifani e , Francesco Ramirez f , Gian Carlo Bellenchi a , Umberto di Porzioa a

Institute of Genetics and Biophysics “A. Buzzati-Traverso”, CNR, 80131 Naples, Italy Istituto di diagnosi e cura “Hermitage Capodimonte”, 80131 Naples, Italy c Dipartimento di Scienze della Vita, Seconda Università di Napoli, 81100 Caserta, Italy d CEINGE Biotecnologie Avanzate, 80145 Naples, Italy e Centre for Neuronal Survival, Montreal Neurological Institute, McGill University, Montreal, Quebec H3A 2B4, Canada f Department of Pharmacology and Systems Therapeutics, Mount Sinai School of Medicine, New York, NY 10029, USA b

A R T I C L E I N F O R M A T I O N

A B S T R A C T

Article Chronology:

Krüppel-like factor 7 (KLF7) belongs to the large family of KLF transcription factors, which

Received 23 July 2010

comprises at least 17 members. Within this family, KLF7 is unique since its expression is strictly

Revised version received

restricted within the nervous system during development. We have previously shown that KLF7 is

10 November 2010

required for neuronal morphogenesis and axon guidance in selected regions of the nervous

Accepted 11 November 2010

system, including hippocampus, olfactory bulbs and cortex, as well as in neuronal cell cultures. In

Available online 18 November 2010

the present work, we have furthered our analysis of the role of KLF7 in central nervous system development. By gene expression analysis during brain embryogenesis, we found significant

Keywords:

alterations in dopaminergic neurons in Klf7 null mice. In particular, the tyrosine hydroxylase (TH)

Olfactory bulbs

and dopamine transporter (Dat) transcripts are strongly decreased in the olfactory bulbs and

Ventral midbrain

ventral midbrain at birth, compared to wild-type littermates. Interestingly, Klf7-mutant mice show

Tyrosine hydroxylase

a dramatic reduction of TH-positive neurons in the olfactory bulbs, but no change in GABAergic or

Dopamine transporter

midbrain dopaminergic neurons. These observations raise the possibility that a lack of a KLF family

Neuronal differentiation

member affects dopaminergic neuron development.

Adult neurogenesis

© 2010 Elsevier Inc. All rights reserved.

⁎ Corresponding authors. Institute of Genetics and Biophysics “A. Buzzati-Traverso”, CNR, 80131 Naples, Italy. Fax: +39 081 6132350. E-mail addresses: [email protected] (M. Caiazzo), [email protected] (L. Colucci-D'Amato), [email protected] (F. Volpicelli), [email protected] (L. Speranza), [email protected] (C. Petrone), [email protected] (L. Pastore), [email protected] (S. Stifani), [email protected] (F. Ramirez), [email protected] (G.C. Bellenchi), [email protected] (U. di Porzio). Abbreviations: AADC/DDC, L-aromatic amino acid decarboxylase; CA, catecholamine; CNS, central nervous system; DA, dopamine; DAT, dopamine transporter; E, embryonic day; FGF8, fibroblast growth factor 8; Gad1-2, glutamate decarboxylase 1-2; Hprt, hypoxanthine guanine phosphoribosyl transferase; KLF7, Krüppel-like factor 7; Klf7−/−, Klf7-homozygous null mutant; L-DOPA, L-dihydroxy-phenylalanine; mDA, mesencephalic dopamine; NE, noradrenaline; NGS, normal goat serum; NS, nervous system; OB, olfactory bulbs; PBS, phosphate-buffered saline; PD, Parkinson's disease; P, postnatal day; qRT-PCR, quantitative real-time RT-PCR; RT, room temperature; RMS, rostral migratory stream; 5-HT, serotonergic; SHH, sonic hedgehog; SN, substantia nigra; SVZ, subventricular zone; TFs, transcription factors; TH, tyrosine hydroxylase; TPH1-2, tryptophan hydroxylase 1-2; VTA, ventral tegmental area; vMb, ventral midbrain; VIAAT/VGAT, vesicular GABA transporter; VMAT2, vesicular monoamine transporter 2; wt, wild type 0014-4827/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2010.11.006

E XP E RI ME N T AL C ELL R ES E AR C H 3 1 7 ( 2 0 11 ) 4 6 4– 4 73

Introduction The dopaminergic system is composed by groups of neurons producing the neurotransmitter dopamine (DA). In the vertebrate central nervous system (CNS), DA is the precursor of noradrenaline (NE) and adrenaline, in catecholamine (CA) biosynthesis. The first and rate-limiting enzyme in this pathway is tyrosine hydroxylase (TH), which converts tyrosine to L-dihydroxy-phenylalanine (L-DOPA), which is then converted to DA by L-aromatic amino acid decarboxylase (AADC/DDC). DA is stored in specific vesicles by means of the vesicular monoamine transporter 2 (VMAT2) and removed from the synaptic cleft via the dopamine transporter (DAT) that, by a high-affinity uptake, terminate neurotransmission [1]. DA neurons in the mammalian CNS are an anatomically and functionally heterogeneous group of cells, localized in areas A8–A10 [retrorubral field, substantia nigra (SN) and ventral tegmental area, (VTA)] of the ventral midbrain (vMb), areas A11–A15 of the diencephalon, area A16 of the olfactory bulbs (OB), and area A17 of the retina [1]. Different molecular mechanisms underlie the generation, development, and maintenance of the selective groups of DA nuclei, as shown by the expression of specific transcriptional pattern within each DAergic brain structure [2–6]. Mesencephalic DA (mDA) neurons are localized in two nuclei, the SN and the VTA. Nigral DA neurons coordinate motor functions and their modulation through the extrapyramidal system [7]. The VTA neurons form the mesocorticolimbic pathway, a circuit involved in emotional, reward, and motivational responses [8]. In the mouse, the mDA neurons are generated during midgestation near the rear junction of the midbrain [9] and migrate radially to reach their final position ventrally [10]. Alterations of mDA activity play a role in a number of severe neurological and psychiatric diseases, including Parkinson's diseases (PD), attention deficit hyperactive disorder (ADHD), and schizophrenia [2,11,12]. The molecular mechanisms underlying mDA neuron differentiation are well characterized. The first signal towards mDA neuron induction is provided by the action of the morphogens sonic hedgehog (SHH) and fibroblast growth factor 8 (FGF8). SHH and FGF8 induce the sequential expression of a number of genes encoding transcription factors (TFs; Otx2, Foxa1/2, En1/2, Lmx1a, Msx1, and Ngn2) generating midbrain DA neuronal precursor cells. Finally, differentiation of mDA neurons requires the expression of the TFs Nurr1, Pitx3, and Lmx1b that eventually lead to the final acquisition of the terminally differentiated dopaminergic phenotype, characterized by the presence of TH, AADC/DDC, VMAT2, and DAT [2–5,13,14]. In contrast to mDA neuron development, mechanisms and/or genes that preside over olfactory bulb DA (OB-DA) neuron differentiation are not well established. OB-DA neurons are periglomerular interneurons that exert a role in the modulation of the output of sensory information from the OB [6]. Only recently OB-DA neurons have become the object of intense investigation, in particular because of their ability to proliferate and integrate into pre-existing circuits in the adult stage, making them a potential tool for regenerative therapies for PD. While the molecular events presiding over OB-DA neuron differentiation are not well established [6], it is known that OB-DA neurons have multiple anatomical origins. In particular, they are continuously generated in the subventricular zone (SVZ) of the lateral ventricle and migrate through the rostral migratory stream (RMS) into the OB where they differentiate to DA phenotype.

465

Newly generated DA neurons become integrated in the OB both postnatally and during adulthood [15,16]. Here we describe results showing that the KLF7 member of the Krüppel-like factor (KLF) family is important for OB-DA neuron development. Klf genes code for zinc fingers TFs involved in a variety of biological processes, including proliferation, cell death, migration, and differentiation [17]. To date 17 members of this gene family have been identified. Although the biological functions of most KLF proteins are largely unknown, a growing body of evidence links KLFs to nervous system (NS) differentiation and development [18–21]. In particular, KLF7 is expressed in the NS during mouse embryogenesis and plays important roles during neural development and function [22,23]. At the mRNA level, Klf7 is highly expressed throughout the entire brain starting from E11.5 [24]. Intense staining has been shown in the most external layers of the cortex, the hippocampus, and the proliferative SVZ zone, as well as in the mesencephalon and in the OB. In adult mice, the expression persists at high level in the mesenchepalic structures and in Purkinje cells of the cerebellum. In the OB, a strong expression profile has been also shown in our previous study [25]. Indeed we have demonstrated that Klf7-homozygous null mutant (Klf7−/−) mice present severely hypoplastic OB, as well as alterations in neurite processes (axon growth and dendritic arborization) in the cerebral cortex and hippocampus, other than the olfactory system [26]. KLF7 is a key regulator of neurogenesis and cell cycle progression [23], while KLF7 silencing leads to delayed neuronal differentiation in ES cells and neurite outgrowth impairment in the neuronal cell line PC12 [20]. These data are in agreement with previous observation by Moore et al. [18] showing that KLF7 is the most effective among KLFs to promote neurite outgrowth in cortical and retinal ganglion primary cultures. In order to characterize the molecular mechanisms underlying the OB deficit in Klf7−/− mice, we investigated the gene expression profiles of different neuronal subtypes in the brain, including OB neurons, in Klf7 mutant mice. These studies revealed a selective reduction of the DA markers TH and DAT, as well as of the number of OB-DA neurons, in the Klf7−/− mice compared to control littermates. These results implicate KLF7 in the regulation of OB-DA neuron development.

Materials and methods Animals and dissections Timed pregnant Klf7-heterozygous pregnant female mice and postnatal (P) 0 pups were euthanized in accordance with Society for Neuroscience guidelines and Italian law. The embryonic age was determined by considering the day of insemination (as confirmed by vaginal plug) as embryonic day (E) 0. Embryos from E11.5 to E17.5 were quickly removed and placed in phosphate-buffered saline (PBS), without calcium and magnesium, and supplemented with 33 mM glucose. All tissues from embryos and pups were dissected according to the coordinates reported in the rodent brain atlas [27,28] and processed for RNA extraction. All embryonic and postnatal tissues obtained from Klf7heterozygous pregnant mothers were processed separately, and a tail sample was processed for genotyping as previously described [25].

466

E XP ER I ME NT AL CE L L R ES E AR CH 3 1 7 (2 0 11 ) 4 64 – 4 73

RNA isolation and qRT-PCR analysis RNA isolation and retro-transcription were performed as previously described [29,30]. qRT-PCR was carried out using the 7900HT Fast Real-Time PCR System (Applied Biosystems, Milan,

Italy). 1/50 of the reverse-transcribed cDNA was amplified in a 25 μl reaction mixture containing 1× SYBR Green PCR Master Mix (Applied Biosystems) and 0.4 mM each primer. The thermal profile consisted of 2 min at 50 °C, 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. mRNA levels were calculated

Table 1 – Primers nucleotide sequence (5′–3′) used for real-time experiments. Marker

Forward sequence (5′–3′)

Reverse sequence (5′–3′)

Aadc Aldh1 Bdnf Blbp Dat Dbh Dlx2 Dlx5 Drd1 Drd2 Drd3 Drd4 Drd5 Eaat1 Egr1 En1 En2 Foxa1 Foxa2 Foxg1 Gabat Gad1 Gad2 Gat1 Gat2 Gat3 Gat4 Gdnf Hprt Lmx1a Lmx1b Map2 Mash1 Msx1 Ncam1 Ncam2 Nestin Neurod Ngn1 Ngn2 Nurr1 Otx2 Pax6 Phox2a Pitx3 Ret Sall3 Sert Sox1 Sox2 Sox3 Th Tph1 Tph2 Vgat Vmat2

GGGACCACATCCTGCTGTTC GAGATCGTCTGCTGCTGGC ACAATGTGACTCCACTGCCG CCAGCTGGGAGAAGAGTTTGA TCTGGGTATCGACAGTGCCA GACCGGCTACTGCACAGACAA GTCAACAACGAGCCGGACA CTACAACCGCGTCCCGAG CTGGCACAAGGCAAAACCTAC GCACAGCAAGCATCTTGAACC TCCTCACTAGACAGAACAGCC AAGGGAGCGCAAGGCAAT GAGACACCCTGGGAGGAAGG CCTTCGTTCTGCTCACGGTC CGAGCGAACAACCCTATGA CGCCTGGGTCTACTGCACA GACCGGCCTTCTTCAGGTC GAAGGGCATGAGAGCAACGA ACGAGCCATCCGACTGGAG GGCAAGTACGAGAAGCCGC CAATGTGGCCCGTGTGG TGCCAAACAAAAGGGCTATGT AGGGTTACTGATGTCCCGGAA GCTGATGCTGGGCATTGAC TCTTCATCATGCTCCTGTTTCTAGG GTGACCTCCGAGAATGCCA CACCTTGTTCTTCATGATGCTCA AGGTCCGGATGGGTCTCCT TGCCCTTGACTATAATGAGTACTTCAG AACCAGCGAGCCAAGATGAA ACACAGCAGCGAAGAGCTTTC AACGGGATCAACGGAGAGCT GGGAATGGACTTTGGAAGCA CTCCCCGCCCCCAGCCAGAC CCAGGATTCCCAGTCCATGT AAGGAAGAGTGGAGGCGAGG AGCAACTGGCACACCTCAAGA TGAGATCGTCACTATTCAGAACCTTT CCAGTAGTCCCTCGGCTTCA ATCTGGAGCCGCGTAGGAT GTGCCTAGCTGTTGGGATGG TAACGTCCAATGCGGCTGTA GGTGCTGGACAATGAAAACGT AAGATCGACCTCACTGAGGCTC GACGCAGGCACTCCACACC TGAACCTACCCAGGGCCTACT ATCCAGCACTGTAGGCAACG GGAACGAAGACGTGTCCGAG GGAAAACCCCAAGATGCACA AGGGCTGGACTGCGAACTG GCACATGAAGGAGTACCCGG CTCACCTATGCACTCACCCGA ACAACATCCCGCAACTGGAG GACCACCATTGTGACCCTGAA AGCGGGCTGGAACGTGA TTGCTCATCTGTGGCTGGG

CACACACCCTCCTGGTTGC CGACAAGTATGCATTGGCAAAG CACTCTTCTCACCTGGTGGAACT CATCCAACCGAACCACAGACT GCAGCTGGAACTCATCGACAA GAGAGGCAAAGATGTGGATTCC ACTTTCTTTGGCTTCCCGTTC TCACCATCCTCACCTCTGGC TGTCATCCTCGGCATCTTCC CAACATAGGCATGGCCACAG CCGCAGACAGGAAGACTGCT AGAAAGGCGTCCAACACACC GTTCGGTTCAGGCTGGAGTC TTTATACGGTCGGAGGGCAA TTGGCTGGGATAACTCGTCT TCTTCTTTAGCTTCCTGGTGCG GGCCGCTTGTCCTCTTTGT ACAGGGACAGAGGAGTAGGCC GGCGTTCATGTTGCTCACG TTCTCGGGACTCTGCCTGAT TGAACTGAGGGTACTGGGCCT CGAATGCTCCGTAAACAGTCG TCCATGTCACAGAGTTGGC GGTACTCGTCCACCAGGGC GGAAGCGGTCACCAGGC CCATCCGAGAGCTTCAGGACT TCACAAGACTCTCCACGCACAC TCTCCGTAGACCCCCAGTTG TTGGCTTTTCCAGTTTCACTAATG TGGGTGTTCTGTTGGTCCTGT GTCTCTCGGACCTTCCGACA TGTGACTACTTGAACTATCCTTGCAGAT ATTTGACGTCGTTGGCGAG GGGCTTGCGGTTGGTCTTGT TGTACACAGCCACAGGGCC TGCTGGTGGAACGTTAACAATAA CTCAGCCTCCAGCAGAGTCC CGCTCTCGCTGTATGATTTGG CAGGCCAGGAAAGGAGAAAAG CATCAGTACCTCCTCTTCCTCCTTC GTAAACGACCTCTCCGGCC GGAGTGGACAGGGTCAGGGT AGCCAGTCTCGTAATACCTGCC TCCTGTTTGCGGAACTTGG TTCTCCGAGTCACTGTGCTC GACTTTCCCGATCTGGGCAT GAGGGTTTGGCAGATTGGAG TGCCTCCGCATATGTGATGA CCTCGGACATGACCTTCCACT TTTGCACCCCTCCCAATTC TGTCCTTCTTGAGCAGCGTCT GGTCAGCCAACATGGGTACG CACAGGACGGATGGAAAACC ACGGCACATCCTCGAGATCT CGTGGAGGATGGCGTAGG TGGCGTTACCCCTCTCTTCAT

467

E XP E RI ME N T AL C ELL R ES E AR C H 3 1 7 ( 2 0 11 ) 4 6 4– 4 73

according to the threshold cycle numbers within a linear range of amplification between 20 and 32 cycles. Data were standardized versus the housekeeping gene hypoxanthine guanine phosphoribosyl transferase (Hprt) used as internal standard [31] and amplified for every sample in parallel assays. A melting curve was obtained for each PCR product after each run, to confirm that the SYBR green signal corresponded to a unique and specific amplified product. The primers used for amplification reactions are listed in Table 1.

luciferase assays, cells were extracted with passive lysis buffer (Promega). Ten microliters of cell extract was used for firefly and Renilla luciferase assays using the Dual-LuciferaseTM Reporter Assay System (Promega), and the ratio of luminescence signals from the reaction mediated by the firefly luciferase reporter to those from the reaction mediated by the Renilla luciferase was calculated. For each reporter, the luciferase activity of the empty pGL3 vector was subtracted. The data were performed in triplicate and expressed as mean ± SEM.

Western blot analysis

Statistical analysis

Western blotting was performed as previously described [30]. The following primary and secondary antibodies were used: rabbit anti-TH (1:1000, Chemicon International, Tamecula, CA, USA), rabbit anti-vesicular GABA transporter (VIAAT/VGAT, 1:1000, gift from Dr. B. Gasnier), mouse anti-βACTIN (1:5000, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), and horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG antibodies (1:10,000, Amersham Biosciences). The reaction was detected with ECL plus reagent (Amersham Biosciences).

For all experiments, analysis of variance was carried out, followed by post hoc comparison (ANOVA, Scheffè F-test). A value of p ≤ 0.05 was considered significant. Data were expressed as mean ± SE. At least three independent replicates were used for RT-PCR and Western blot quantization. All the shown experiments were performed separately at least twice.

Immunohistochemical analysis

To elucidate the role of KLF7 in dopaminergic mouse brain development, we performed a transcriptional characterization of a number of proneural, neuronal, and brain developmental markers in wt and Klf7−/− brains. To this aim, different brain areas were dissected from wt and Klf7−/− mice and analyzed by real-time RT-PCR (qRT-PCR, Table 2) at the neonatal stage (P0), a time when phenotypical alterations in Klf7−/− mice have been described previously [26]. We first examined a number of proneural markers, namely Mash1, Ngn1, Ngn2, and Neurod, whose expression is important for neurogenesis and OB development [32–34]. Similarly we tested the expression levels of other transcription factors described previously as important for the dopaminergic periglomerular neurons development in the OB such as Dlx2, Pax6 [35] Sall-3 [36], and Egr-1 [37]. None of these markers showed modifications of its expression profile in Klf7−/− mice when compared with wt littermate. Thus, we analyzed a set of representative DAergic and GABAergic markers in the OB, where they represent the two most abundant neuronal populations [38]. Interestingly, we found that the DAergic TH and Dat transcripts were significantly decreased in Klf7−/− mice, whereas we did not

P0 brains were fixed overnight at 4 °C with 4% paraformaldehyde, buffered in 30% sucrose until they sunk to cryopreserve the tissue, and embedded in OCT. Frozen brains were sectioned into 15- or 30-μm thick sections with a cryostat and processed for immunostaining. Sections were permeabilized for 1 h at RT in PBS containing 0.1% or 0.25% Triton X-100 and 10% normal goat serum (NGS), and incubated with PBS containing 10% NGS and rabbit anti-TH antibody (1:200, Chemicon) for 2 h at RT or overnight at 4 °C in PBS containing 10% NGS, 0.25% triton and rabbit anti-calbindin antibody (1:5000, Swant, CH) or rabbit anti- VIAAT/VGAT antibody (1:2000). The immunoreactive signal was revealed according to standard avidin–biotin immunocytochemistry procedures (Vectastain Elite, Vector Laboratories, Burlingame, CA, USA), using a peroxidase substrate kit (DiAaminoBenzidine) or using an antirabbit fluorescent secondary antibody. Cell counting was performed in at least 5 independent fields for each condition.

TH and DAT promoter plasmid construction Mouse genomic DNA was used as a template to amplify the TH (5′-TGGGGCAGTGAGTAGATAGT-3′; 5′-CAGAAGTTGCTCCAGATACC3′) and DAT (5′-AAATCTTGCTCGCAGGTTGGT-3′; 5′-TGGTTTCT GCCCCTCGCT-3′) promoter fragments. The amplified fragments were cloned into pGL3-basic firefly luciferase reporter vector (Promega, Milan, Italy). All plasmids pGL3-TH, pGL3-DAT were confirmed by sequencing.

Transient transfection and luciferase assay For the promoter analysis, the plasmids pGL3-TH, pGL3-DAT were transfected in HeLa cells using lipofectamine 2000, according to the manufacturer's instructions. Four hundred nanograms of pcDNA3-Klf7 plasmid and 400 ng of each luciferase reporter vector were cotransfected. We used a Renilla luciferase vector carrying the Simian vacuolating virus 40 promoter (pRL-SV40) as an internal control vector. For the dual (firefly and Renilla)

Results

Table 2 – Summary of the different markers used. Category

Markers

Pro-neural GABAergic

Mash1, Ngn1, Ngn2, Neurod Dlx2, Dlx5, Gad1, Gad2, Gat1, Gat2, Gat3, Gat4, Vgat, Gabat TH, Dat, Nurr1, Pitx3, Vmat2, Lmx1a, Lmx1b, Msx1, Foxa1, Foxa2, En1, En2, Otx2, Drd1, Drd2, Drd3, Drd4, Drd5, Aadc, Aldh1 Phox2a, Dbh Sert, Tph1, Tph2 Eaat1 Blbp, Sox1, Sox2, Sox3, Nestin, Pax6, Foxg1, Ncam1, Ncam2, Map2, Ret, Bdnf, Gdnf. Egr1, Sall3

Dopaminergic

Noradrenergic Serotonergic Glutamatergic Others

468

E XP ER I ME NT AL CE L L R ES E AR CH 3 1 7 (2 0 11 ) 4 64 – 4 73

Fig. 1 – Transcriptional characterization of KLF7−/− olfactory bulbs at birth. The transcriptional analysis shows a decrease of TH and Dat transcripts in Klf7−/− olfactory (OB) at birth, whereas the GABAergic (Gad1, Gad2, Dlx2) or proneural (Mash1, Ngn1, Ngn2, Neurod) markers analyzed are not changed between wt and Klf7−/− samples, as the dopaminergic marker Nurr1 and the transcription factors Pax6, Egr1, and Sall3. The diagrams show the relative quantization (mean ± SE) of the TH, Dat, Nurr1, Gad1, Gad2, Mash1, Ngn1, Ngn2, Neurod, Dlx2, Pax6, Egr1, and Sall3 amplified products compared to that of hypoxanthine-phosphoribosyl-transferase (Hprt, internal standard). Data are expressed as ratio TH/Hprt, Dat/Hprt, Nurr1/Hprt, Gad1/Hprt, Gad2/Hprt, Mash1/Hprt, Ngn1/Hprt, Ngn2/Hprt, Neurod/ Hprt, Dlx2/Hprt, Pax6/Hprt, Egr1/Hprt, and Sall3/Hprt. Analyses were performed in wt and Klf7−/− OB. Asterisks represent p ≤ 0.05 (*) or p ≤ 0.01 (**) when compared to wt controls (ANOVA, Scheffè F-test).

find any difference in the expression of GABAergic markers, such as glutamate decarboxylase 1-2 (Gad1-2, Fig. 1). Next, we extended this analysis to another DA brain area such as the vMb, where the most important contingent of brain DA neurons resides. We performed a transcriptional characterization of the same markers described above with additional mDA-specific markers. The vMb of neonatal Klf7−/− mice also showed a significant decrease of TH and Dat transcripts when compared to

wt littermates (Fig. 2). In contrast, we did not find any alteration of other DAergic markers, nor did we observe changes in the expression of GABAergic, glutamatergic, or proneural markers (Fig. 2 and data not shown). Because the pons is a brain area where important monoaminergic nuclei are located, in particular, the NE neurons in the locus coeruleus and serotonergic (5-HT) neurons in the raphe nuclei, we also analyzed NE and 5-HT markers in this area. At birth, no

E XP E RI ME N T AL C ELL R ES E AR C H 3 1 7 ( 2 0 11 ) 4 6 4– 4 73

469

Fig. 2 – Transcriptional characterization of KLF7−/− ventral midbrain at birth. The transcriptional analysis shows a decrease of TH and Dat transcripts in Klf7−/− ventral midbrain at birth, whereas the other dopaminergic (Vmat2, Nurr1, Pitx3, Lmx1b, Lmx1a, Ngn2, Otx2), GABAergic (Gad1, Gad2) or glutamatergic (Eaat1) markers analyzed are not changed between wt and Klf7−/− samples. The diagrams show the relative quantization (mean ± SE) of the TH, Dat, Nurr1, Gad1, Gad2, Mash1, Ngn1, Ngn2, Neurod amplified products compared to that of hypoxantine-phosphoribosyl-transferase (Hprt, internal standard). Data are expressed as ratio TH/Hprt, Dat/Hprt, Vmat2/Hprt, Pitx3/Hprt, Nurr1/Hprt, Lmx1b/Hprt, Lmx1a/Hprt, Ngn2/Hprt, Otx2/Hprt, Gad1/Hprt, Gad2/Hprt, and Eaat1/Hprt. Analyses were performed in wt and Klf7−/− OB. Asterisks represent p ≤ 0.01 (**) when compared to wt controls (ANOVA, Scheffè F-test).

differences were found between the wt and Klf7−/− mice in the expression of dopamine beta hydroxylase (Dbh), which encodes the enzyme that catalyzes NE biosynthesis from L-DOPA, or Phox2a, a TF specifically expressed in NE cell types where it regulates the expression of TH and Dbh (Fig. 3). The genes encoding the serotonergic biosynthetic enzymes, tryptophan hydroxylase 1-2 (Tph1 and Tph2), as well as that encoding the serotonin transporter, Sert, were also not affected (Fig. 3). These findings suggest that, among monoaminergic neurons, only a subset of DA neurons require KLF7 for their formation and/or maintenance. To understand whether Klf7 is able to control directly the expression of both TH and Dat, we scanned the putative promoters sequences of both genes for the presence of KLFs binding motifs. Then we subcloned the regions, showing the higher score, in a luciferase

reporter plasmid. Interestingly, after cotransfection, Klf7 was able to up-regulate the level of the reporter gene only when this was under the control of the Dat promoter (Supp. 1) We also analyzed other brain areas known to be affected in the Klf7−/− mice, such as the cortex and the hippocampus and found no differences in the neuronal, proneural, or brain development markers analyzed in the mutant brains as compared to wt siblings (data not shown). Finally, we examined the protein expression of TH in OB and vMb. In OB we found that immunoreactivity for TH neurons was strongly decreased (Fig. 4A, B). This finding was confirmed by Western blot analysis showing a significant reduction of TH immunoreactivity (Fig. 4E). In the same samples, we did not find any differences in the GABAergic population, as shown by the analysis of the VIAAT/VGAT or calbindin proteins

470

E XP ER I ME NT AL CE L L R ES E AR CH 3 1 7 (2 0 11 ) 4 64 – 4 73

Fig. 3 – Transcriptional characterization of KLF7−/− pons at birth. The transcriptional analysis shows no change in the expression level of noradrenergic (TH, Dbh, Phox2a) or serotonergic (Tph1, Tph2, Sert) transcripts in Klf7−/− pons at birth, when compared to wt controls. The diagrams show the relative quantization (mean ± SE) of the TH, Dbh, Phox2a, Tph1, Tph2, and Sert amplified products compared to that of hypoxanthine-phosphoribosyl-transferase (Hprt, internal standard). Data are expressed as ratio TH/Hprt, Dbh/Hprt, Phox2a/Hprt, Tph1/Hprt, Tph2/Hprt, and Sert/Hprt. Analyses were performed in wt and Klf7−/− OB.

[39] (Fig. 4E, and Supp. 2). Immunohistochemical analysis of TH-positive neurons in vMb did not show any overt change between wt and Klf7−/− mice (Fig. 4C, D), and this was confirmed by Western blot analysis (Fig. 4F). Thus our data indicate that KLF7 absence specifically affects the development and/or maintenance of OB-DA neurons.

Discussion CNS DA neurons share the same neurotransmitter and biosynthetic machinery. Nevertheless, they comprise a heterogeneous group of cells arising from different brain areas, which develop through distinct programs and exert different functions [2–6]. In this study, we have used a genetic approach to investigate whether the TF KLF7 has a role in the neuronal phenotypes of the OB, since this gene has been implicated in CNS development and OB formation [20,23,25]. The OB contains a DAergic population represented by periglomerular interneurons that are critical for both olfactory stimuli identification and detection of odorant intensity [6]. Our data provide evidence that there is a significant decrease in the number of TH-positive neurons in the OB of Klf7−/− mice. Accordingly, we found a significant reduction of both Th and Dat transcripts as well as TH proteins. On the contrary, the expression of GABAergic markers was unaffected. Our luciferase experiments indicate that KLF7 may directly activate the Dat promoter. However, we could not identify the mechanism by which Klf7 controls the mRNA levels of TH. Different explanation might be proposed: a first hypothesis may suggest an indirect control of Klf7, via other not yet identified transcription factors; indeed a second possibility is that Klf7 may directly control TH expression via its binding to an unknown promoter region. To determine whether KFL7 has an effect on other brain DA neurons, we analyzed DAergic markers in the midbrain. In contrast to our

findings in the OB, we did not observe any evident decrease in the number of TH-positive cells in Klf7−/− vMb as compared to the wt siblings, nor we detected altered innervations in the striatum (data not shown). Transcriptional analysis showed a partial disparity between TH mRNA and protein levels in the vMb: TH mRNA was reduced but not the protein, underscoring the importance of TH analysis at the protein level. Discrepancies between mRNA and proteins under basal or pathological conditions are probably due to translational and/or posttranslational regulation of protein synthesis, or release and transport of TH. Other laboratories have described conditions where protein and mRNA levels in neurons were not in agreement, as in the case of BDNF, NGF, synapsin 1, NMDA receptor subunit NR2b, cyclooxygenase-2, as well as TH and TPHs in the midbrain [40–44]. Further experiments will be needed to clarify this point. Our finding that lack of KLF7 affects OB but not midbrain DA neurons is consistent with data from the TF Sall3−/− mice. Indeed Sall-3 mutant animals show TH expression in the substantia nigra and nigrostriatal pathway but not in the OB. This suggests that independent pathways regulate dopaminergic maturation in distinct neural regions [36]. The difference between these two DA neuronal populations may depend on their different ontogenetic history and developmental molecular programs. In this regard, it is worth noting how the Nurr1 gene, whose expression is required for mDA neuron formation, is dispensable for the development OB-DA neurons even though it is expressed in these cells [45,46]. Accordingly, Nurr1 gene expression is not altered in the OB of Klf7−/− mice. The homeodomain protein Pitx3, a TF that also plays an essential role in midbrain mDA neurons development and function, is not expressed in OB-DA neurons [47]. In addition to the DAergic phenotype, we have analyzed the expression of a wide range of markers of several neuronal subtypes, all of which failed to show any alterations in the Klf7−/− mice. In particular GABAergic, glutamatergic, serotonergic and noradrenergic

E XP E RI ME N T AL C ELL R ES E AR C H 3 1 7 ( 2 0 11 ) 4 6 4– 4 73

471

Fig. 4 – TH-positive neurons and protein are strongly decreased in Klf7−/− olfactory bulbs at birth. The immunohistochemical analysis shows that TH-positive neurons are strongly decreased in the olfactory bulbs (OB) (A) but not in the ventral midbrain (vMb) (C) of Klf7−/− when compared to wt mice. Total amount of TH-positive neurons is shown in OB (B) and vMb (D). The Western blot analysis shows that the total amount of TH protein is decreased in the OB (E) but not in the vMb (F) of Klf7−/− mice when compared to wt mice. The diagrams show the relative quantization (mean ± SE) of TH or VIAAT/VGAT protein levels compared to that of βACTIN. Data are expressed as ratio TH/βACTIN or VIAAT-VGAT/βACTIN. Arrows indicate embryo orientation (rostral, R; caudal, C; dorsal, D; ventral, V; right, R; left, L). Asterisks represent p ≤ 0.05 (*) when compared to wt controls (ANOVA, Scheffè F-test). Scale bar is 300 μm (A) or 1200 μm (C).

neuronal markers were properly expressed in the brain areas analyzed. These findings suggest a selective role for KLF7 in OB-DA neuron development and/or maintenance, although the mechanisms involved are still unclear. OB-DA neurons are the only DAergic population that undergoes proliferation and migration not only during embryogenesis but also in adult life. It is worth noticing that since KLF7 is expressed in the RMS, we cannot exclude a possible role of KLF7 in the regulation of OB-DA neuron generation and/or migration from the SVZ through the RMS [23]. Previous data support this hypothesis since Klf7−/− neural stem cells exhibit a deficit in

the neurogenic marker BLBP/FABP7 [20] and KLF7 directly activates the cell adhesion molecule gene L1cam [48]. Altogether these findings provide evidence that KLF7 is a new player in OB-DA neuron formation. OB-DA neurons are partially resistant to cell death in PD [49] and can easily integrate into preexisting circuits [6,50], thus understanding the genetic pathways important for their generation and/or survival can be useful to unravel the cascade of events that could protect DA neurons from neurodegeneration. Since after administration of the DA neurotoxins MPTP in mice and monkeys [51,52] increased neurogenesis

472

E XP ER I ME NT AL CE L L R ES E AR CH 3 1 7 (2 0 11 ) 4 64 – 4 73

of OB/DA neurons occurs, OB neural stem cells could provide a new DA cell source, at least in part resistant to PD-induced neurodegeneration, for cell-based regenerative medicine. Supplementary materials related to this article can be found online at doi:10.1016/j.yexcr.2010.11.006.

Acknowledgments We wish to thank Prof. Carla Perrone-Capano (University Federico II) for reading the manuscript and Luigi Leone (IGB) for technical help. This work was supported by MIUR PRIN 2007F7AJYJ_004 and 2007STRNHK_002, by the Italian Ministry of Health Younginvestigator project “under-40 call 2007”, by MERIT Program RBNE08LN4P_002, and by FIRB International 2006 RBIN062YH4. S.S. was supported by funds from the Canadian Institutes of Health Research (MOP-13957) and by a Chercheur National Award from the Fonds de la Recherche en Sante du Quebec.

REFERENCES

[1] A. Björklund, S.B. Dunnett, Dopamine neuron systems in the brain: an update, Trends Neurosci. 30 (2007) 194–202. [2] C. Perrone-Capano, U. di Porzio, Genetic and epigenetic control of midbrain dopaminergic neuron development, Int. J. Dev. Biol. 44 (2000) 679–687. [3] C. Perrone-Capano, P. Da Pozzo, U. di Porzio, Epigenetic cues in midbrain dopaminergic neuron development, Neurosci. Biobehav. Rev. 24 (2000) 119–124. [4] A. Abeliovich, R. Hammond, Midbrain dopamine neuron differentiation: factors and fates, Dev. Biol. 304 (2007) 447–454. [5] C. Perrone-Capano, F. Volpicelli, U. di Porzio, The molecular code involved in midbrain dopaminergic neuron development and maintenance, Rend. Lincei 19 (2008) 271–290. [6] J.W. Cave, H. Baker, Dopamine systems in the forebrain, Adv. Exp. Med. Biol. 651 (2009) 15–35. [7] J. Glowinski, A. Niecoullon, A. Chéramy, Regulations of the activity of the nigrostriatal dopaminergic pathways by cortical, cerebellar, and sensory neuronal afferences, Adv. Biochem. Psychopharmacol. 19 (1978) 75–87. [8] P.H. van Domburg, H.J. ten Donkelaar, The human substantia nigra and ventral tegmental area. A neuroanatomical study with notes on aging and aging diseases, Adv. Anat. Embryol. Cell Biol. 121 (1991) 1–132. [9] P. Voorn, A. Kalsbeek, B. Jorritsma-Byham, H.J. Groenewegen, The pre- and postnatal development of the dopaminergic cell groups in the ventral mesencephalon and the dopaminergic innervation of the striatum of the rat, Neuroscience 25 (1988) 857–887. [10] U. di Porzio, A. Zuddas, D.B. Cosenza-Murphy, J.L. Barker, Early appearance of tyrosine hydroxylase immunoreactive cells in the mesencephalon of mouse embryos, Int. J. Dev. Neurosci. 8 (1990) 523–532. [11] A. Lees, J. Hardy, T. Revesz, Parkinson's disease, Lancet 373 (2009) 2055–2066. [12] E.H. Simpson, C. Kellendonk, E. Kandel, A possible role for the striatum in the pathogenesis of the cognitive symptoms of schizophrenia, Neuron 65 (2010) 585–596. [13] S.L. Ang, Transcriptional control of midbrain dopaminergic neuron development, Development 133 (2006) 3499–3506. [14] M.P. Smidt, J.P. Burbach, How to make a mesodiencephalic dopaminergic neuron, Nat. Rev. Neurosci. 8 (2007) 21–32.

[15] A. Alvarez-Buylla, M. Garcia-Verdugo, Neurogenesis in adult subventricular zone, J. Neurosci. 22 (2002) 629–634. [16] G.L. Ming, H. Song, Adult neurogenesis in the mammalian central nervous system, Annu. Rev. Neurosci. 28 (2005) 223–250. [17] J.J. Bieker, Kruppel-like factors: three fingers in many pies, J. Biol. Chem. 276 (2001) 34355–34358. [18] D.L. Moore, M.G. Blackmore, Y. Hu, K.H. Kaestner, J.L. Bixby, V.P. Lemmon, J.L. Goldberg, KLF family members regulate intrinsic axon regeneration ability, Science 326 (2009) 298–301. [19] K.N. Scobie, B.J. Hall, K.C. Klemenhagen, Y. Fuji-Kuriyama, A. Ghosh, R. Hen, A. Sahay, Krüppel-like factor 9 is necessary for late-phase neuronal maturation in the developing dentate gyrus and during adult hippocampal neurogenesis, J. Neurosci. 29 (2009) 9875–9887. [20] M. Caiazzo, L. Colucci-D'Amato, M.T. Esposito, S. Stifani, F. Ramirez, U. di Porzio, Transcription factor KLF7 regulates differentiation of neuroectodermal and mesodermal cell lineages, Exp. Cell Res. 316 (2010) 2365–2376. [21] G. Spittau, N. Happel, M. Behrendt, T.I. Chao, K. Krieglstein, B. Spittau, Tieg1/Klf10 is upregulated by NGF and attenuates cell cycle progression in the pheochromocytoma cell line PC12, J. Neurosci. Res. 88 (2010) 2017–2025. [22] N. Matsumoto, F. Laub, R. Aldabe, W. Zhang, F. Ramirez, T. Yoshida, M. Terada, Cloning the cDNA for a new human zinc finger protein defines a group of closely related Kruppel-like transcription factors, J. Biol. Chem. 273 (1998) 28229–28237. [23] F. Laub, R. Aldabe, V. Jr, S. Ohnishi Friedrich, T. Yoshida, F. Ramirez, Developmental expression of mouse Kruppel-like transcription factor KLF7 suggests a potential role in neurogenesis, Dev. Biol. 233 (2001) 305–318. [24] Allen Developing Mouse Brain Atlas [Internet]. Seattle (WA): Allen Institute for Brain Science. ©2009. Available from: http:// developingmouse.brain-map.org. [25] F. Laub, C. Dragomir, F. Ramirez, Mice without transcription factor KLF7 provide new insight into olfactory bulb development, Brain Res. (2006) 108–113. [26] F. Laub, L. Lei, H. Sumiyoshi, D. Kajimura, C. Dragomir, S. Smaldone, A.C. Puche, T.J. Petros, C. Mason, L.F. Parada, F. Ramirez, Transcription factor KLF7 is important for neuronal morphogenesis in selected regions of the nervous system, Mol. Cell. Biol. 25 (2005) 5699–5711. [27] N. Sherwood, S.P. Timiras, A stereotaxic atlas of the developing rat brain, second ed.University of California press, Berkeley, 1970. [28] L. Kruger, S. Saporta, L.W. Swanson, Photographic atlas of the rat brain: the cell and fiber architecture illustrated in three planes with stereotaxic coordinates, third ed.Cambridge University Press, Cambridge, 1995. [29] F. Volpicelli, C. Consales, M. Caiazzo, L. Colucci-D'amato, C. Perrone-Capano, U. di Porzio, Enhancement of dopaminergic differentiation in proliferating midbrain neuroblasts by sonic hedgehog and ascorbic acid, Neural Plast. 11 (2004) 45–57. [30] F. Volpicelli, M. Caiazzo, D. Greco, C. Consales, L. Leone, C. Perrone-Capano, L. Colucci-D'Amato, U. di Porzio, Bdnf gene is a downstream target of Nurr1 transcription factor in rat midbrain neurons in vitro, J. Neurochem. 102 (2007) 441–453. [31] R. Pernas-Alonso, F. Morelli, U. di Porzio, C. Perrone-Capano, Multiplex semi-quantitative reverse transcriptase-polymerase chain reaction of low abundance neuronal mRNAs, Brain Res. Brain Res. Protoc. 4 (1999) 395–406. [32] G.L. Manglapus, S.L. Youngentob, J.E. Schwob, Expression patterns of basic helix–loop–helix transcription factors define subsets of olfactory progenitor cells, J. Comp. Neurol. 479 (2004) 216–233. [33] E. Cau, G. Gradwohl, C. Fode, F. Guillemot, Mash1 activates a cascade of bHLH regulators in olfactory neuron progenitors, Development 124 (1997) 1611–1621. [34] E. Cau, S. Casarosa, F. Guillemot, Mash1 and Ngn1 control distinct steps of determination and differentiation in the olfactory sensory neuron lineage, Development 129 (2002) 1871–1880.

E XP E RI ME N T AL C ELL R ES E AR C H 3 1 7 ( 2 0 11 ) 4 6 4– 4 73

[35] M.S. Brill, M. Snapyan, H. Wohlfrom, J. Ninkovic, M. Jawerka, G.S. Mastick, R. Ashery-Padan, A. Saghatelyan, B. Berninger, M. Götz, A dlx2- and pax6-dependent transcriptional code for periglomerular neuron specification in the adult olfactory bulb, J. Neurosci. (2008) 6439–6452. [36] S. Harrison, M. Parrish, P. Monaghan, Sall3 is required for the terminal maturation of olfactory glomerular interneurons, J. Comp. Neurol. 507 (2008) 1780–1794. [37] N. Akiba, S. Jo, Y. Akiba, H. Baker, J.W. Cave, Expression of EGR-1 in a subset of olfactory bulb dopaminergic cells, J. Mol. Histol. (2009) 151–155. [38] S. Parrish-Aungst, M.T. Shipley, F. Erdelyi, G. Szabo, A.C. Puche, Quantitative analysis of neuronal diversity in the mouse olfactory bulb, J. Comp. Neurol. 501 (2007) 825–836. [39] C. Sagné, S. El Mestikawy, M.F. Isambert, M. Hamon, J.P. Henry, B. Giros, B. Gasnier, Cloning of a functional vesicular GABA and glycine transporter by screening of genome databases, FEBS Lett. 417 (1997) 177–183. [40] H. Nawa, J. Carnahan, C. Gall, BDNF protein measured by a novel enzyme immunoassay in normal brain and after seizure: partial disagreement with mRNA levels, Eur. J. Neurosci. 7 (1995) 1527–1535. [41] H. Shozuhara, H. Onodera, S.R. Katoh, K. Kato, Y. Yamasaki, K. Kogure, Temporal profiles of nerve growth factor beta-subunit level in rat brain regions after transient ischemia, J. Neurochem. 59 (1992) 175–180. [42] M. Saldaña, L. Pujols, J. Mullol, J. Roca-Ferrer, A. Cardozo, E. Aguilar, M. Bonastre, C. Marin, Relevance of COX-2 gene expression in dementia with lewy bodies associated with Alzheimer pathology, Mov. Disord. 23 (2008) 804–810. [43] J.A. Maffucci, D.M. Walker, A. Ikegami, M.J. Woller, A.C. Gore, NMDA receptor subunit NR2b: effects on LH release and GnRH gene expression in young and middle-aged female rats, with modulation by estradiol, Neuroendocrinology 87 (2008) 129–141.

473

[44] D. Koubi, L. Bezin, J.M. Cottet-Emard, A. Gharib, P. Bobillier, N. Sarda, Regulation of expression and enzymatic activities of tyrosine and tryptophan hydroxylases in rat brain after acute electroconvulsive shock, Brain Res. 905 (2001) 161–170. [45] R.H. Zetterstrom, L. Solomin, L. Jansson, L. Olson, B.J. Hoffer, T. Perlmann, Dopamine neuron agenesis in Nurr1-deficient mice, Science 276 (1997) 248–250. [46] W. Le, O.M. Conneely, L. Zou, Y. He, O. Saucedo-Cardenas, J. Jankovic, D.R. Moiser, S.H. Appel, Selective agenesis of mesencephalic dopaminergic neurons in Nurr1-deficient mice, Exp. Neurol. 159 (1999) 451–458. [47] M.P. Smidt, H.S. van Schaick, C. Lanctot, J.J. Tremblay, J.J. Cox, A.A. van der Kleij, G. Wolterink, J. Drouin, J.P. Burbach, A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 13305–13310. [48] D. Kajimura, C. Dragomir, F. Ramirez, F. Laub, Identification of genes regulated by transcription factor KLF7 in differentiating olfactory sensory neurons, Gene 388 (2007) 34–42. [49] E. Huisman, H.B. Uylings, P.V. Hoogland, A 100% increase of dopaminergic cells in the olfactory bulb may explain hyposmia in Parkinson's disease, Mov. Disord. 19 (2004) 687–692. [50] P.M. Lledo, A. Saghatelyan, Integrating new neurons into the adult olfactory bulb: joining the network, life–death decisions, and the effects of sensory experience, Trends Neurosci. 28 (2005) 248–254. [51] S. Belzunegui, W. San Sebastián, A. Garrido-Gil Test, The number of dopaminergic cells is increased in the olfactory bulb of monkeys chronically exposed to MPTP, Synapse 61 (2007) 1006–1012. [52] Y. Mitsumoto, A. Mori, S. Ohashi, M. Nakai, T. Moriizum, Differential effects of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine in the olfactory bulb and the striatum in mice, Neurosci. Res. 51 (2005) 111–115.