- Email: [email protected]
Kupffer cells are a major source of increased platelet activating factor in the CCl4-induced cirrhotic rat liver
Journal of Hepatology 39 (2003) 200–207 www.elsevier.com/locate/jhep
Kupffer cells are a major source of increased platelet activating factor in the CCl4-induced cirrhotic rat liver Yongping Yang1, Stephen A.K. Harvey2, Chandrashekhar R. Gandhi1,3,4,* 1
Department of Surgery, Thomas E. Starzl Transplantation Institute, University of Pittsburgh, E-1542 BST, 200 Lothrop Street, Pittsburgh, PA 15213, USA 2 Department of Ophthalmology, University of Pittsburgh, EEINS, 203 Lothrop Street, Pittsburgh, PA 15213, USA 3 Department of Pathology, University of Pittsburgh, E-1542 BST, 200 Lothrop Street, Pittsburgh, PA 15213, USA 4 VA medical Center, University of Pittsburgh, E-1542 BST, 200 Lothrop Street, Pittsburgh, PA 15213, USA
Background/Aims: Endothelin-1 (ET-1) stimulates the synthesis of platelet-activating factor (PAF) by Kupffer cells in vitro. Hepatic concentrations of both ET-1 (a potent vasoconstrictor) and PAF (a mediator of hepatic vasoconstriction and the cirrhotic hyperdynamic state) increase in cirrhosis. The aim of this study was to determine if the responsiveness of Kupffer cells to produce PAF upon ET-1 challenge is modified by cirrhosis. Methods: Kupffer cells, isolated from the livers of control and CCl4-induced cirrhotic rats, were placed in serum-free medium after overnight culture. PAF and ET-1 receptors, ET-1-induced PAF synthesis, and PAF- and ET-1-induced prostaglandin E2 (PGE2) synthesis were determined 24 h later. Results: Both basal and ET-1-stimulated PAF synthesis was increased in cirrhotic Kupffer cells as indicated by increased cell-associated and released PAF. Cirrhotic Kupffer cells also had elevated densities of functional receptors for both PAF and ET-1 (exclusively ETB), as measured by ligand binding, mRNA expression of the respective receptors, and ligand-stimulated PGE2 synthesis. Conclusions: Cirrhosis sensitizes Kupffer cells to both ET-1 and PAF by elevating their respective receptor levels. Since both mediators individually cause portal hypertension, an increase in ET-1-stimulated PAF synthesis in Kupffer cells will exacerbate the hepatic and extrahepatic complications of cirrhosis. q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. Keywords: Cirrhosis; Kupffer cells; Platelet-activating factor; Endothelin-1; Receptor
1. Introduction Kupffer cells, resident macrophages in the liver, are critically important in the defense against invading microorganisms and foreign molecules [1]. On the other hand, substantial evidence indicates their role in hepatic pathology; for example, selective depletion of Kupffer cells causes attenuation of hepatotoxicity in terms of steatosis, inflammation and necrosis in animal models of liver injury [2 –7]. It is suggested that Kupffer cells are activated in response to various chemical stimuli and promote tissue damage by releasing biologically active mediators such as Received 3 February 2003; received in revised form 25 March 2003; accepted 15 April 2003 * Corresponding author. Tel.: þ1-412-648-9316; fax: þ 1-412-624-6666. E-mail address: [email protected] (C.R. Gandhi). Abbreviations: ET, endothelin; PAF, platelet activating factor; RT-PCR, reverse transcriptase polymerase chain reaction.
prostaglandins, oxygen free radicals, and proinflammatory mediators such as tumor necrosis factor (TNF)-a and interleukin-1 [1,8,9]. Platelet activating factor (PAF; 1-O-alkyl-2-acetyl-snglycero-3-phosphocholine), a phospholipid, exhibits diverse biological activities. The actions of PAF include platelet secretion and aggregation, bronchoconstriction and pulmonary hypertension, systemic anaphylaxis, vascular permeability, endotoxin- and immune factor-induced shock, and systemic hypotension (for review, see refs. [10 – 13]). Portal venous administration of PAF in isolated perfused rat liver increases portal venous pressure and glycogenolysis [14]. Systemic (intravenous) administration of PAF to rats, in vivo, also induces these effects and, in addition, causes immediate decrease in arterial blood pressure [15,16]. PAF acts both as a multifunctional soluble proinflammatory agent and as a specific membrane-bound adhesion molecule [17 –20].
0168-8278/03/$30.00 q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0168-8278(03)00229-0
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
Kupffer cells are the major cell type in the liver to synthesize PAF. Endotoxin [21], endothelin-1 (ET-1) [22] and a number of inflammatory mediators [13] stimulate the synthesis of PAF by Kupffer cells. Hepatic concentrations of ET-1 as well as its receptors increase in cirrhosis [23,24]. In a parallel study, we also observed increased hepatic and circulating PAF concentrations in cirrhotic rats [25]. We hypothesized that the increased PAF in the cirrhotic liver may be due to its enhanced synthesis by the Kupffer cells, with ET-1 playing a major role. Therefore, PAF and ET-1 receptors, and ET-1-induced synthesis of PAF in Kupffer cells derived from cirrhotic rat livers were investigated. The results show increased number of ET-1 (ETB) and PAF receptors, and enhanced basal and ET-1-stimulated synthesis of PAF in cirrhotic Kupffer cells.
2. Materials and methods 2.1. Induction of liver cirrhosis The experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh in accordance with the guidelines of the National Institutes of Health. Cirrhosis was induced in male Sprague–Dawley rats (230–250 g) as described previously [23,26] by intraperitoneal injection of CCl4 (0.15 ml/kg twice a week for 8 weeks) in conjunction with water containing phenobarbital (0.4 g/l) ad lib. Control rats received injections of the vehicle (peanut oil) and phenobarbital water. The average consumption of phenobarbital was about 65 mg/kg per day. Phenobarbital is a potentiator of hepatic cytochrome P450, the microsomal enzyme which oxidizes CCl4 to the hepatotoxic CCl3 radical. Concurrent use of phenobarbital and CCl4 yields a more consistent cirrhotic state more quickly, with lower mortality [27].
201
concentration was determined by a very specific (,0.01% cross reactivity with lysoPAF and other phospholipids) and rapid [3H]PAF scintillation proximity assay (Amersham-Pharmacia Biotech). The assay is highly sensitive and measures PAF (100 samples/kit) in the range of 20 –1300 pg/ tube.
2.4. Determination of the mRNA expression of PAF and ET-1 receptors The mRNA expressions of various transcripts were determined by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR). For normalization, b-actin mRNA expression was determined using the same amount of cDNA. RNA was isolated from the livers using an RNA isolation kit (ToTALLY RNAe, Ambion, Austin, TX). Two mg of total RNA was used for the preparation of cDNA by reverse transcription as described previously [32]. cDNA equivalent of 5 ng of original RNA was used in the PCR. The reaction mixture (50 ml) contained 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 20 pmol of the PCR primers and 2 units of Platinum Taq DNA polymerase (GIBCO-Invitrogen, Carlsbad, CA). The reaction for PAF receptor was carried out for 35 cycles as follows: denaturation at 948C for 1 min, annealing at 608C for 30 s, and extension at 728C for 30 s [33]. Conditions for the PCR for preproET-1, ETA receptor, ETB receptor and b-actin were as described previously [34]. The PCR Primers used were – PAF cDNA: 50 GCCACAACACAGAGGCTTGA30 (F) and 50 TCCATTGCTCTGGGCAGGAA30 (R) [product size, 121 bp]; preproET-1 cDNA: 50 CCAACTCTGGGCTCTCCATGCTGG30 (F) and 50 GAATGGCACTGTGTCTCTGCTCTC30 (R) [product size, 241 bp]; ETA cDNA: 50 CCCTTCGAATACAAGGGCGA30 (F) and 50 GAAGAGGGAACCAGCACAGTTTCTACTTCTGC30 (R) [product size, 291 bp]; ETB cDNA: 50 GGCTGTTCAGTTTTCTACTTCTGC30 (F) and 50 AGAATCCTGCTGAGGTGAAGG30 (R) [product size, 210 bp]; and b-actin cDNA: 50 TTCTACAATGAGCTGCGTGTG30 (F) and 50 TTCATGGATGCCACAGGATTC30 [product size, 561 bp]. The PCR products were resolved in a 2.5% agarose gel (PAF) and 1.2% agarose gel (b-actin, ET-1 and ET receptors) and stained with SYBR Green I (FMC Biproduct, Rockland, ME). The gels were scanned under blue fluorescent light using a phosphorimager and the band intensity was quantified using ImageQuaNT software (Molecular Dynamics, Sunnyvale, CA).
2.2. Preparation of Kupffer cells Kupffer cells were prepared essentially as described previously [28,29]. Briefly, after collagenase (0.025%) and protease (0.05%) digestion of the liver and removal of the hepatocytes and cells debris by low speed centrifugation, Kupffer cells were purified by density gradient centrifugation on a 17.5% (w/v) metrizamide gradient, followed by centrifugal elutriation. The cells were suspended in Williams’ medium E containing 10% fetal calf serum, penicillin and streptomycin, and plated at a density of 0.5 £ 106 cells/cm2. The medium was renewed after 3 h and cells were used for experiments after an overnight incubation. Purity of the cells as determined by immunostaining with ED2 (Kupffer cells), desmin (stellate cells) and factor VIII related antigen (endothelial cells) was greater than 95%.
2.5. Determination of PAF receptor The assay was performed as described [35,36]. The cells were washed and incubated in 50 mM Tris–HCl, pH 7.2, containing 5 mM MgCl2, 125 mM choline chloride, 0.25% BSA and 0.0125–3.2 nM 1-O-[3H]octadecyl-2-O-acetyl-sn-glycero-3-phosphocholine (151 Ci/mmol; 9.96 GBq/ mg; Amersham) ^10 mM unlabelled PAF (1-O-hexadecyl-2-O-acetyl-snglycero-3-phosphocholine; Bachem Americas, King of Prussia, PA) at 228C for 3 h. The reaction was terminated with the addition of ice-cold assay buffer. The cells were washed twice with the assay buffer and digested with 5% sodium dodecyl sulfate. Radioactivity was determined in a b-scintillation counter.
2.3. Determination of PAF in Kupffer cells and the medium
2.6. Determination of endothelin receptors
Lipids from the cells and the medium were extracted as described [30,31]. Briefly, 1 ml of the medium was mixed with methanol (2.5 ml) and chloroform (1.25 ml), and kept at room temperature for 1 h. Chloroform (1.25 ml) and water (1.25 ml) were then added and after 1 h at room temperature, the mixture was centrifuged at 1200 £ g for 15 min. The chloroform layer was aspirated and dried under a stream of nitrogen at 358C. Lipids from the cells were extracted in a mixture of methanol (2.5 ml), chloroform (1.25 ml) and water (1 ml). Rest of the procedure was the same as described above. Lipids were dissolved in 200 ml of chloroform and applied to Bond Elut SI column (Amprep silica mini-columns; Amersham Pharmacia Biotech, Piscataway, NJ). The column was washed with 3 ml of chloroform, 2 ml of chloroform-methanol (6:4, v/v) and 3 ml of chloroform-methanol-28% aqueous ammonia (70:85:7, v/v). PAF was eluted with 2 ml of chloroform-methanol-28% aqueous ammonia (50:50:7, v/v). The eluate was evaporated to dryness under nitrogen, and the residue was dissolved in 200 ml of saline containing 0.1% Triton X-100. PAF
Saturation binding assay was performed for determination of ET receptors as described previously [32,37]. Briefly, the cells were washed with Hank’s balanced salt solution containing 10 mM HEPES, pH 7.4, 0.1% bovine serum albumin (HBSS/BSA) and placed in this medium containing 6.25–800 pM [125I]-ET-1 ^ 1 mM unlabelled ET-1. After incubation at 228C for 3 h, the cells were washed with ice-cold HBSS/BSA and digested with 0.75N NaOH for determination of radioactivity. Specific binding of [125I]-ET-1 was the difference between cell-associated radioactivity in the presence and absence of 1 mM unlabelled ET-1.
2.7. Determination of prostaglandin E2 (PGE2) PGE2 was extracted from the culture medium and analyzed by ELISA using a kit from Amersham Pharmacia Biotech, Inc. following the manufacturer’s instructions.
202
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
2.8. Data analysis The values are presented as averages of triplicate determinations ^SEM. Each experiment was repeated at least three times using cells from different animals. Student’s t-test was employed for statistical comparison of the paired samples. A P value of ,0.05 was considered statistically significant.
3. Results 3.1. Effect of ET-1 on PAF synthesis in activated Kupffer cells Cell-associated PAF and its basal release were significantly increased in the cirrhotic as compared to the control cells (cell-associated, 1.02 ^ 0.06 versus 0.68 ^ 0.07 pg/mg DNA, P , 0:01; released, 1.42 ^ 0.14 versus 0.66 ^ 0.04 pg/mg DNA, P , 0:01) (Fig. 1). ET-1
Fig. 2. [3H]PAF binding to cirrhotic Kupffer cells. Cells were used after overnight culture for receptor binding assay as described in Section 2. Data from saturation binding assay (A); and Scatchard analysis (B) are shown. *P < 0.05 and **P < 0.01 versus control.
stimulated the synthesis of PAF in both control and cirrhotic Kupffer cells. However, the effect was more pronounced in the latter; while significant stimulation of PAF synthesis occurred at 10 nM ET-1 in control cells, in cirrhotic cells statistical significance was observed at 0.1 – 1 nM ET-1 (Fig. 1).
3.2. PAF receptor expression in cirrhotic Kupffer cells
Fig. 1. Effect of ET-1 on PAF synthesis by cirrhotic Kupffer cells. Kupffer cells from control and cirrhotic rats were cultured and stimulated with indicated concentrations of ET-1 for 15 min in serumfree condition. Cellular and released PAF was determined as described in Section 2. *P < 0.05 and **P < 0.01 versus ‘0’; #P < 0.01 versus control.
Scatchard analysis of the saturation binding data (Fig. 2) revealed doubling of the PAF binding capacity in cirrhotic Kupffer cells as compared to the control (Bmax of 17 ^ 1.4 versus 7.6 ^ 0.85 fmol/mg DNA, P , 0:001). There was no significant difference in the PAF receptor affinity between the cells from control and cirrhotic rats (1.19 ^ 0.15 versus 1.46 ^ 0.04 nM, P . 0:05). Consistent with the receptor binding data, the mRNA expression of PAF receptor was increased in the cirrhotic Kupffer cells (Fig. 3).
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
203
PGE2 synthesis in Kupffer cells [28,29]. Consistent with these findings, ET-1 and PAF stimulated PGE2 synthesis in control and cirrhotic Kupffer cells in a concentrationdependent manner; the effect being more pronounced in the latter (Fig. 6). The basal release of PGE2 by cirrhotic Kupffer cells also was greater than by control cells.
4. Discussion In this investigation, we found that the basal and ET-1stimulated synthesis of a potent hepatic vasoconstrictor and systemic hypotensive agent, PAF, are increased in Kupffer cells derived from the cirrhotic rat liver. PAF has been implicated to be an important mediator of hyperdynamic circulation associated with liver cirrhosis. In agreement with the previous reports in cirrhotic humans [39], increased blood PAF levels were observed in CCl4-induced cirrhotic rats [25]. That study [25] also demonstrated higher PAF concentration in hepatic venous blood than in portal venous blood of cirrhotic rats indicating enhanced synthesis in the
Fig. 3. PAF receptor mRNA expression in cirrhotic Kupffer cells. RT-PCR of PAF receptor mRNA was performed with cDNA prepared from RNA samples of control and cirrhotic Kupffer cells. Expression of b-actin mRNA was assessed using the same amount of cDNA. (A) PCR products of PAF and b-actin from control (CT) and cirrhotic (CIR) rat livers are shown. (B) Ratio of the PAF receptor and b-actin mRNA. *P < 0.05 versus control.
3.3. ET-1 receptor expression in cirrhotic Kupffer cells ET-1 binding capacity of the cirrhotic Kupffer cells was twice as much as that of the control cells (1.11 ^ 0.09 versus 0.56 ^ 0.08 fmol/mg DNA, P , 0:05) (Fig. 4), but there was no significant difference in the receptor affinity (Kd of 31.35 ^ 1.35 pM [cirrhotic] and 24.3 ^ 3.3 pM [control], P . 0:05). Consistent with a previous report [38], competition-binding analysis showed ET-1 binding to Kupffer cells exclusively via the ETB receptor (results not shown). As determined by RT-PCR, Kupffer cells were found to express only ETB mRNA (Fig. 5) and no mRNA transcripts for the ETA receptor or the ligand precursor preproET-1 were detected. It should be noted that other hepatic cells (endothelial cells, stellate cells, hepatocytes and biliary epithelial cells) express preproET-1 mRNA. The mRNA expression of ETB receptor was significantly increased in the cirrhotic Kupffer cells relative to the control cells (Fig. 5). 3.4. ET-1- and PAF-induced PGE2 synthesis Previously, both ET-1 and PAF were shown to stimulate
Fig. 4. [125I]ET-1 binding to cirrhotic Kupffer cells. Cells were used after overnight culture for receptor binding assay as described in Section 2. *P < 0.05 versus control.
204
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
and CCl4-treated rats at 1 and 2 weeks during CCl4 treatment [25], suggesting that the early rise [40] may be due to the effect of inflammatory mediators released in the liver in response to the toxin. The system then adapts to these changes but with persistence of inflammation, PAF synthesis is again increased. ET-1 may be responsible for the increased PAF synthesis in the injured liver. ET-1 induces synthesis of PAF in cultured rat Kupffer cells [22], and hepatic levels of ET-1 increase progressively during the development of CCl4-induced cirrhosis in rats [26]. In the cells from control rats, ET-1 stimulated the synthesis of PAF at 10 nM concentration, while significantly increased PAF synthesis occurred at ET-1 concentration of less than 1 nM in cirrhotic Kupffer cells suggesting that their sensitivity to ET-1 action is enhanced relative to the control cells. In addition to the enhanced synthesis, the extent of PAF release
Fig. 5. mRNA expression of preproendothelin-1 and ET-1 receptor subtypes in cirrhotic Kupffer cells. RT-PCR for PAF receptor mRNA was performed with cDNA prepared from RNA samples of control and cirrhotic Kupffer cells. Expression of b-actin mRNA was assessed using the same amount of cDNA. (A) PCR products of PAF and b-actin from control (CT) and cirrhotic (CIR) rat livers are shown. (B) Ratio of the PAF receptor and b-actin mRNA. *P < 0.001 versus control.
cirrhotic livers. The results of the present study suggest the possibility that the enhanced synthesis and release of PAF by Kupffer cells contributes to its elevated circulating concentration in cirrhotic rats. The basal levels of cellassociated and secreted PAF were significantly higher in Kupffer cells from cirrhotic as compared to the control rats. Inflammatory cytokines such as interleukin (IL)-1 and TNF are known to stimulate the synthesis of PAF [13]. The mRNA expression and the synthesis of these two cytokines are increased in Kupffer cells of the CCl4-cirrhotic rats [9]. It is reasonable to conclude that their autocrine effects may be an important mechanism of increased basal synthesis of PAF in cirrhotic Kupffer cells. A schematic (Fig. 7) summarizes changes previously known to occur in the Kupffer cell during cirrhosis, and includes the novel changes reported in this paper. All these changes are discussed in detail below. The PAF concentration in the liver has been shown to increase shortly (2 h) after CCl4 administration [40]. However, hepatic PAF concentrations are similar in control
Fig. 6. Effect of PAF and ET-1 on PGE2 synthesis in cirrhotic Kupffer cells. Cells were placed in serum-free medium after overnight culture, and were challenged with PAF or ET-1 24 h later. PGE2 in the medium was measured by ELISA After 15-min incubation. *P < 0.05, **P < 0.01, and ***P < 0.001 versus ‘0’; @P < 0.05 and #P < 0.01 versus control.
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
205
Fig. 7. Effects of stimulated synthesis of PAF in Kupffer cells in cirrhosis. Increased ET-1 released by stellate cells and endothelial cells in the cirrhotic liver acts on upregulated ETB receptors in Kupffer cells (presumably by the action of reactive oxygen species, ROS, generated by infiltrating neutrophils and by setllate cells) and stimulates the synthesis of PAF. Likewise, autocrine actions of proinflammatory mediators such as IL-1 and TNF-a also may stimulate PAF synthesis by Kupffer cells. PAF then acts on hepatic vascular smooth muscle cells and stellate cells and contributes to portal hypertension by causing their contraction. Its spillover into the systemic circulation is likely a cause of hypotension associated with cirrhosis. Autocrine PAF and paracrine ET-1 can act on their respective upregulated receptors in Kupffer cells to cause the synthesis and release of prostaglandin E2, which in turn may act to limit the hepatic injury.
also was increased in cirrhotic Kupffer cells, the ratio of released versus cell-associated PAF being about 1 for control and 1.5 for cirrhotic cells. This ratio was maintained under both basal and ET-1-stimulated conditions. Clearly, Kupffer cells appear to be major contributors to increased hepatic as well as circulating PAF in cirrhosis. Consistent with the increased sensitivity to ET-1-induced PAF synthesis, the receptor density for ET-1 is increased in the cirrhotic Kupffer cells. While the mechanisms of this phenomenon are not known, oxygen-free radicals cause up-regulation of ET-1 receptors in cultured stellate cells [41]. It is likely that a similar mechanism may cause increase in the ET receptors in Kupffer cells considering that the chronically injured liver is a site of perpetual inflammation, and thereby under constant oxidative stress. Interestingly, PAF has been shown to stimulate the generation of reactive oxygen species in Kupffer cells [42]. However, it should be noted that the ability of Kupffer cells to generate reactive oxygen species is depressed in CCl4-induced cirrhosis [43]. Thus the source of reactive oxygen species could be infiltrating blood cells such as
neutrophils [44 –46] or even neighboring stellate cells [47] in the diseased liver. Previous work has shown that PAF stimulates phosphoinositide metabolism and synthesis of eicosanoids in rat Kupffer cells [28,29]. Thus the increase in the PAF receptor density and the enhanced basal synthesis of prostaglandin E2 in Kupffer cells from cirrhotic rats suggest an autocrine loop of the PAF action. One of the major characteristics of liver cirrhosis is proliferation of activated stellate cells, which are responsible for excessive deposition of fibrous tissue and the contractile component of portal hypertension [48]. Activated stellate cells also synthesize greater amounts of ET-1 [23,37,49]. It has been shown that PGE2, an hepatoprotective eicosanoid, can inhibit growth factorinduced proliferation of activated stellate cells by causing inhibition of MAP kinase activity [50]. Combining these observations, it is reasonable to assume that enhanced synthesis of PGE2 (basal as well as ET-1- and PAFstimulated) in cirrhotic Kupffer cells may be a mechanism of limiting the liver injury. In conclusion, the findings of this paper suggest that
206
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
activated Kupffer cells are a main source of increased hepatic and systemic PAF in cirrhotic rats, and their enhanced responses to ET-1 is an integral part of this mechanism.
Acknowledgements This work was supported by a grant from NIH (DK 54411) and a VA Merit award.
References [1] Decker K. Biologically active products of stimulated liver macrophages (Kupffer cells). Eur J Biochem 1990;192:245– 261. [2] Arthur MJ, Bentley IS, Tanner AR, Saunders PK, Millward-Sadler GH, Wright R. Oxygen-derived free radicals promote hepatic injury in the rat. Gastroenterology 1985;89:1114–1122. [3] Shiratori Y, Kawase T, Shiina S, Okano K, Sugimoto T, Teraoka H, et al. Modulation of hepatotoxicity by macrophages in the liver. Hepatology 1988;8:815– 821. [4] Nagakawa J, Hishinuma I, Hirota K, Miyamoto K, Yamanaka T, Tsukidate K, et al. Involvement of tumor necrosis factor-alpha in the pathogenesis of activated macrophage-mediated hepatitis in mice. Gastroenterology 1990;99:758–765. [5] Adachi Y, Bradford BU, Gao W, Bojes HK, Thurman RG. Inactivation of Kupffer cells prevents early alcohol-induced liver injury. Hepatology 1994;20:453–460. [6] Edwards MJ, Keller BJ, Kauffman FC, Thurman RG. The involvement of Kupffer cells in carbon tetrachloride toxicity. Toxicol Appl Pharmacol 1993;119:275 –279. [7] Przybocki JM, Reuhl KR, Thurman RG, Kauffman FC. Involvement of non-parenchymal cells in oxygen-dependent hepatic injury by allyl alcohol. Toxicol Appl Pharmacol 1992;115:57–63. [8] Thurman RG, Bradford BU, Iimuro Y, Knecht KT, Arteel GE, Yin M, et al. The role of gut-derived bacterial toxins and free radicals in alcohol-induced liver injury. J Gastroenterol Hepatol 1998; 13(Suppl.):S39–S50. [9] Luckey SW, Petersen DR. Activation of Kupffer cells during the course of carbon tetrachloride-induced liver injury and fibrosis in rats. Exp Mol Pathol 2001;71:226–240. [10] Snyder F. Platelet-activating factor and related acetylated lipids as potent biologically active cellular mediators. Am J Physiol 1990;259: C697–C708. [11] Chao W, Olson MS. Platelet-activating factor: receptors and signal transduction. Biochem J 1993;292:617 –629. [12] Prescott SM, Zimmerman GY, Stafforini DM, McIntyre TM. Plateletactivating factor and related lipid mediators. Ann Rev Biochem 2000; 69:419–445. [13] Montrucchio G, Alloatti G, Camussi G. Role of platelet-activating factor in cardiovascular pathophysiology. Physiol Rev 2000;80: 1669–1699. [14] Buxton DB, Fisher RA, Hanahan DJ, Olson MS. Platelet-activating factor-mediated vasoconstriction and glycogenolysis in the perfused rat liver. J Biol Chem 1986;261:644–649. [15] Hines KL, Braillon A, Fisher RA. PAF increases hepatic vascular resistance and glycogenolysis in vivo. Am J Physiol 1991;260: G471–G480. [16] Kleber G, Braillon A, Gaudin C, Champigneulle B, Cailmail S, Lebrec D. Hemodynamic effects of endotoxin and platelet activating factor in cirrhotic rats. Gastroenterology 1992;103:282 –288. [17] Lorant DE, Patel KD, McIntyre TM, McEver RP, Prescott SM, Zimmerman GA. Coexpression of GMP-140 and PAF by endothelium
[18] [19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30] [31]
[32]
[33]
[34]
[35]
[36]
[37]
stimulated by histamine or thrombin: a juxtacrine system for adhesion and activation of neutrophils. J Cell Biol 1991;115:223–234. Braquet P, Touqui L, Shen TY, Vargaftig BB. Perspectives in plateletactivating factor research. Pharmacol Rev 1987;39:97–145. Braquet P, Paubert-Braquet M, Bourgain RH, Bussolino F, Hosford D. PAF/cytokine auto-generated feedback networks in microvascular immune injury: consequences in shock, ischemia and graft rejection. J Lipid Mediat 1989;1:75–112. Zimmerman GA, Prescott SM, McIntyre TM. Endothelial cell interactions with granulocytes: tethering and signaling molecules. Immunol Today 1992;13:93–100. Zhou W, Chao W, Levine BA, Olson MS. Role of platelet-activating factor in hepatic responses after bile duct ligation in rats. Am J Physiol 1992;263:G587 –G592. Mustafa SB, Gandhi CR, Harvey SAK, Olson MS. Endothelin stimulates platelet activating factor synthesis by cultured rat Kupffer cells. Hepatology 1995;21:545– 553. Gandhi CR, Sproat LA, Subbotin VM. Increased hepatic endothelin-1 levels and endothelin receptor density in cirrhotic rats. Life Sci 1996; 58:55–62. Gandhi CR, Kang Y, De Wolf A, Madariaga J, Aggarwal S, Scott V, et al. Altered endothelin homeostasis in patients undergoing liver transplantation. Liver Transplant Surg 1996;2:362–369. Yang Y, Nemoto E, Harvey SAK, Gandhi CR. Increased hepatic platelet activating factor (PAF) and PAF receptors in CCl4-induced liver cirrhosis: implications for chronic liver injury. Hepatology 2002; 36:A252. Gandhi CR, Nemoto E, Watkins SC, Subbotin VM. An endothelin receptor antagonist TAK-044 ameliorates carbon tetrachlorideinduced acute liver injury and portal hypertension in rats. Liver 1998;18:39–48. McLean EK, McLean AEM, Sutton PM. Instant cirrhosis. An improved method for producing cirrhosis of the liver in rats by simultaneous administration of carbon tetrachloride and phenobarbitone. Br J Exp Pathol 1969;50:502– 506. Gandhi CR, Hanahan DJ, Olson MS. Two distinct pathways of platelet-activating factor-induced hydrolysis of phosphoinositides in primary cultures of rat Kupffer cells. J Biol Chem 1990;265: 18234–18241. Gandhi CR, Stephenson K, Olson MS. A comparative study of endothelin- and platelet-activating factor-mediated signal transduction and prostaglandin synthesis in rat Kupffer cells. Biochem J 1992; 281:485–492. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959;37:911–917. Shinozaki K, Kawasaki T, Kambayashi J, Sakon M, Shiba E, Uemura Y, et al. A new method of purification and sensitive bioassay of platelet-activating factor (PAF) in human whole blood. Life Sci 1994; 54:429–437. Gandhi CR, Uemura T, Kuddus R. Endotoxin causes up-regulation of endothelin receptors in cultured hepatic stellate cells via nitric oxidedependent and -independent mechanisms. Br J Pharmacol 2000;131: 319 –327. Bito H, Honda Z, Nakamura M, Shimizu T. Cloning, expression and tissue distribution of rat platelet-activating-factor-receptor cDNA. Eur J Biochem 1994;221:211 –218. Anselmi K, Subbotin VM, Nemoto E, Gandhi CR. Accelerated reversal of carbon tetrachloride-induced cirrhosis in rats by endothelin receptor antagonist TAK-044. J Gastroenterol Hepatol 2002;17: 589 –597. Gomez J, Bloom JW, Yamamura HI, Halonen M. Characterization of receptors for platelet-activating factor in guinea pig lung membranes. Am J Respir Cell Mol Biol 1990;3:259–264. Ibe BO, Sander FC, Raj JU. Platelet-activating factor receptors in lamb lungs are downregulated immediately after birth. Am J Physiol 2000;278:H1168–H1176. Gandhi CR, Kuddus RH, Uemura T, Rao AS. Endothelin stimulates
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
[38]
[39]
[40]
[41]
[42]
[43]
[44]
transforming growth factor-b1 and collagen synthesis in stellate cells from control but not cirrhotic rat liver. Eur J Pharmacol 2000;406: 311–318. Stephenson K, Harvey SA, Mustafa SB, Eakes AT, Olson MS. Endothelin association with the cultured rat Kupffer cell: characterization and regulation. Hepatology 1995;22:896–905. Caramelo C, Fernandez-Gallardo S, Santos JC, Inarrea P, SanchezCrespo M, Lopez-Novoa JM, et al. Increased levels of plateletactivating factor in blood from patients with cirrhosis of the liver. Eur J Clin Invest 1987;17:7– 11. Marathe GK, Harrison KA, Roberts 2nd LJ, Morrow JD, Murphy RC, Tjoelker LW, et al. Identification of platelet-activating factor as the inflammatory lipid mediator in CCl4-metabolizing rat liver. J Lipid Res 2001;42:587–596. Gabriel A, Kuddus RH, Rao AS, Watkins WD, Gandhi CR. Superoxide-induced changes in endothelin (ET) receptors in hepatic stellate cells. J Hepatology 1998;29:614–627. Dieter P, Schulze-Specking A, Decker K. Differential inhibition of prostaglandin and superoxide production by dexamethasone in primary cultures of rat Kupffer cells. Eur J Biochem 1986;159: 451–457. Arii S, Monden K, Itai S, Sasaoki T, Adachi Y, Funaki N, et al. Depressed function of Kupffer cells in rats with CCl4-induced liver cirrhosis. Res Exp Med (Berl) 1990;190:173–182. Bautista AP, Meszaros K, Bojta J, Spitzer JJ. Superoxide anion generation in the liver during the early stage of endotoxemia in rats. J Leukoc Biol 1990;48:123– 128.
207
[45] Pesonen EJ, Hockerstedt K, Makisalo H, Vuorte J, Jansson SE, Orpana A, et al. Transhepatic neutrophil and monocyte activation during clinical liver transplantation. Transplantation 2000;69: 1458– 1464. [46] Svegliati-Baroni G, Saccomanno S, van Goor H, Jansen P, Benedetti A, Moshage H. Involvement of reactive oxygen species and nitric oxide radicals in activation and proliferation of rat hepatic stellate cells. Liver 2001;21:1–12. [47] Li L, Tao J, Davaille J, Feral C, Mallat A, Rieusset J, et al. 15-deoxyDelta 12,14-prostaglandin J2 induces apoptosis of human hepatic myofibroblasts. A pathway involving oxidative stress independently of peroxisome-proliferator-activated receptors. J Biol Chem 2001; 276:38152–38158. [48] Friedman SL. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem 2000;275:2247–2250. [49] Pinzani M, Milani S, De Franco R, Grappone C, Caligiuri A, Gentilini A, et al. Endothelin 1 is overexpressed in human cirrhotic liver and exerts multiple effects on activated hepatic stellate cells. Gastroenterology 1996;110:534 –548. [50] Mallat A, Preaux AM, Serradeil-Le Gal C, Raufaste D, Gallois C, Brenner DA, et al. Growth inhibitory properties of endothelin-1 in activated human hepatic stellate cells: a cyclic adenosine monophosphate-mediated pathway. Inhibition of both extracellular signalregulated kinase and c-Jun kinase and upregulation of endothelin B receptors. J Clin Invest 1996;98:2771 –2778.
Kupffer cells are a major source of increased platelet activating factor in the CCl4-induced cirrhotic rat liver Yongping Yang1, Stephen A.K. Harvey2, Chandrashekhar R. Gandhi1,3,4,* 1
Department of Surgery, Thomas E. Starzl Transplantation Institute, University of Pittsburgh, E-1542 BST, 200 Lothrop Street, Pittsburgh, PA 15213, USA 2 Department of Ophthalmology, University of Pittsburgh, EEINS, 203 Lothrop Street, Pittsburgh, PA 15213, USA 3 Department of Pathology, University of Pittsburgh, E-1542 BST, 200 Lothrop Street, Pittsburgh, PA 15213, USA 4 VA medical Center, University of Pittsburgh, E-1542 BST, 200 Lothrop Street, Pittsburgh, PA 15213, USA
Background/Aims: Endothelin-1 (ET-1) stimulates the synthesis of platelet-activating factor (PAF) by Kupffer cells in vitro. Hepatic concentrations of both ET-1 (a potent vasoconstrictor) and PAF (a mediator of hepatic vasoconstriction and the cirrhotic hyperdynamic state) increase in cirrhosis. The aim of this study was to determine if the responsiveness of Kupffer cells to produce PAF upon ET-1 challenge is modified by cirrhosis. Methods: Kupffer cells, isolated from the livers of control and CCl4-induced cirrhotic rats, were placed in serum-free medium after overnight culture. PAF and ET-1 receptors, ET-1-induced PAF synthesis, and PAF- and ET-1-induced prostaglandin E2 (PGE2) synthesis were determined 24 h later. Results: Both basal and ET-1-stimulated PAF synthesis was increased in cirrhotic Kupffer cells as indicated by increased cell-associated and released PAF. Cirrhotic Kupffer cells also had elevated densities of functional receptors for both PAF and ET-1 (exclusively ETB), as measured by ligand binding, mRNA expression of the respective receptors, and ligand-stimulated PGE2 synthesis. Conclusions: Cirrhosis sensitizes Kupffer cells to both ET-1 and PAF by elevating their respective receptor levels. Since both mediators individually cause portal hypertension, an increase in ET-1-stimulated PAF synthesis in Kupffer cells will exacerbate the hepatic and extrahepatic complications of cirrhosis. q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. Keywords: Cirrhosis; Kupffer cells; Platelet-activating factor; Endothelin-1; Receptor
1. Introduction Kupffer cells, resident macrophages in the liver, are critically important in the defense against invading microorganisms and foreign molecules [1]. On the other hand, substantial evidence indicates their role in hepatic pathology; for example, selective depletion of Kupffer cells causes attenuation of hepatotoxicity in terms of steatosis, inflammation and necrosis in animal models of liver injury [2 –7]. It is suggested that Kupffer cells are activated in response to various chemical stimuli and promote tissue damage by releasing biologically active mediators such as Received 3 February 2003; received in revised form 25 March 2003; accepted 15 April 2003 * Corresponding author. Tel.: þ1-412-648-9316; fax: þ 1-412-624-6666. E-mail address: [email protected] (C.R. Gandhi). Abbreviations: ET, endothelin; PAF, platelet activating factor; RT-PCR, reverse transcriptase polymerase chain reaction.
prostaglandins, oxygen free radicals, and proinflammatory mediators such as tumor necrosis factor (TNF)-a and interleukin-1 [1,8,9]. Platelet activating factor (PAF; 1-O-alkyl-2-acetyl-snglycero-3-phosphocholine), a phospholipid, exhibits diverse biological activities. The actions of PAF include platelet secretion and aggregation, bronchoconstriction and pulmonary hypertension, systemic anaphylaxis, vascular permeability, endotoxin- and immune factor-induced shock, and systemic hypotension (for review, see refs. [10 – 13]). Portal venous administration of PAF in isolated perfused rat liver increases portal venous pressure and glycogenolysis [14]. Systemic (intravenous) administration of PAF to rats, in vivo, also induces these effects and, in addition, causes immediate decrease in arterial blood pressure [15,16]. PAF acts both as a multifunctional soluble proinflammatory agent and as a specific membrane-bound adhesion molecule [17 –20].
0168-8278/03/$30.00 q 2003 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. doi:10.1016/S0168-8278(03)00229-0
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
Kupffer cells are the major cell type in the liver to synthesize PAF. Endotoxin [21], endothelin-1 (ET-1) [22] and a number of inflammatory mediators [13] stimulate the synthesis of PAF by Kupffer cells. Hepatic concentrations of ET-1 as well as its receptors increase in cirrhosis [23,24]. In a parallel study, we also observed increased hepatic and circulating PAF concentrations in cirrhotic rats [25]. We hypothesized that the increased PAF in the cirrhotic liver may be due to its enhanced synthesis by the Kupffer cells, with ET-1 playing a major role. Therefore, PAF and ET-1 receptors, and ET-1-induced synthesis of PAF in Kupffer cells derived from cirrhotic rat livers were investigated. The results show increased number of ET-1 (ETB) and PAF receptors, and enhanced basal and ET-1-stimulated synthesis of PAF in cirrhotic Kupffer cells.
2. Materials and methods 2.1. Induction of liver cirrhosis The experimental protocols were approved by the Institutional Animal Care and Use Committee of the University of Pittsburgh in accordance with the guidelines of the National Institutes of Health. Cirrhosis was induced in male Sprague–Dawley rats (230–250 g) as described previously [23,26] by intraperitoneal injection of CCl4 (0.15 ml/kg twice a week for 8 weeks) in conjunction with water containing phenobarbital (0.4 g/l) ad lib. Control rats received injections of the vehicle (peanut oil) and phenobarbital water. The average consumption of phenobarbital was about 65 mg/kg per day. Phenobarbital is a potentiator of hepatic cytochrome P450, the microsomal enzyme which oxidizes CCl4 to the hepatotoxic CCl3 radical. Concurrent use of phenobarbital and CCl4 yields a more consistent cirrhotic state more quickly, with lower mortality [27].
201
concentration was determined by a very specific (,0.01% cross reactivity with lysoPAF and other phospholipids) and rapid [3H]PAF scintillation proximity assay (Amersham-Pharmacia Biotech). The assay is highly sensitive and measures PAF (100 samples/kit) in the range of 20 –1300 pg/ tube.
2.4. Determination of the mRNA expression of PAF and ET-1 receptors The mRNA expressions of various transcripts were determined by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR). For normalization, b-actin mRNA expression was determined using the same amount of cDNA. RNA was isolated from the livers using an RNA isolation kit (ToTALLY RNAe, Ambion, Austin, TX). Two mg of total RNA was used for the preparation of cDNA by reverse transcription as described previously [32]. cDNA equivalent of 5 ng of original RNA was used in the PCR. The reaction mixture (50 ml) contained 10 mM Tris–HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTPs, 20 pmol of the PCR primers and 2 units of Platinum Taq DNA polymerase (GIBCO-Invitrogen, Carlsbad, CA). The reaction for PAF receptor was carried out for 35 cycles as follows: denaturation at 948C for 1 min, annealing at 608C for 30 s, and extension at 728C for 30 s [33]. Conditions for the PCR for preproET-1, ETA receptor, ETB receptor and b-actin were as described previously [34]. The PCR Primers used were – PAF cDNA: 50 GCCACAACACAGAGGCTTGA30 (F) and 50 TCCATTGCTCTGGGCAGGAA30 (R) [product size, 121 bp]; preproET-1 cDNA: 50 CCAACTCTGGGCTCTCCATGCTGG30 (F) and 50 GAATGGCACTGTGTCTCTGCTCTC30 (R) [product size, 241 bp]; ETA cDNA: 50 CCCTTCGAATACAAGGGCGA30 (F) and 50 GAAGAGGGAACCAGCACAGTTTCTACTTCTGC30 (R) [product size, 291 bp]; ETB cDNA: 50 GGCTGTTCAGTTTTCTACTTCTGC30 (F) and 50 AGAATCCTGCTGAGGTGAAGG30 (R) [product size, 210 bp]; and b-actin cDNA: 50 TTCTACAATGAGCTGCGTGTG30 (F) and 50 TTCATGGATGCCACAGGATTC30 [product size, 561 bp]. The PCR products were resolved in a 2.5% agarose gel (PAF) and 1.2% agarose gel (b-actin, ET-1 and ET receptors) and stained with SYBR Green I (FMC Biproduct, Rockland, ME). The gels were scanned under blue fluorescent light using a phosphorimager and the band intensity was quantified using ImageQuaNT software (Molecular Dynamics, Sunnyvale, CA).
2.2. Preparation of Kupffer cells Kupffer cells were prepared essentially as described previously [28,29]. Briefly, after collagenase (0.025%) and protease (0.05%) digestion of the liver and removal of the hepatocytes and cells debris by low speed centrifugation, Kupffer cells were purified by density gradient centrifugation on a 17.5% (w/v) metrizamide gradient, followed by centrifugal elutriation. The cells were suspended in Williams’ medium E containing 10% fetal calf serum, penicillin and streptomycin, and plated at a density of 0.5 £ 106 cells/cm2. The medium was renewed after 3 h and cells were used for experiments after an overnight incubation. Purity of the cells as determined by immunostaining with ED2 (Kupffer cells), desmin (stellate cells) and factor VIII related antigen (endothelial cells) was greater than 95%.
2.5. Determination of PAF receptor The assay was performed as described [35,36]. The cells were washed and incubated in 50 mM Tris–HCl, pH 7.2, containing 5 mM MgCl2, 125 mM choline chloride, 0.25% BSA and 0.0125–3.2 nM 1-O-[3H]octadecyl-2-O-acetyl-sn-glycero-3-phosphocholine (151 Ci/mmol; 9.96 GBq/ mg; Amersham) ^10 mM unlabelled PAF (1-O-hexadecyl-2-O-acetyl-snglycero-3-phosphocholine; Bachem Americas, King of Prussia, PA) at 228C for 3 h. The reaction was terminated with the addition of ice-cold assay buffer. The cells were washed twice with the assay buffer and digested with 5% sodium dodecyl sulfate. Radioactivity was determined in a b-scintillation counter.
2.3. Determination of PAF in Kupffer cells and the medium
2.6. Determination of endothelin receptors
Lipids from the cells and the medium were extracted as described [30,31]. Briefly, 1 ml of the medium was mixed with methanol (2.5 ml) and chloroform (1.25 ml), and kept at room temperature for 1 h. Chloroform (1.25 ml) and water (1.25 ml) were then added and after 1 h at room temperature, the mixture was centrifuged at 1200 £ g for 15 min. The chloroform layer was aspirated and dried under a stream of nitrogen at 358C. Lipids from the cells were extracted in a mixture of methanol (2.5 ml), chloroform (1.25 ml) and water (1 ml). Rest of the procedure was the same as described above. Lipids were dissolved in 200 ml of chloroform and applied to Bond Elut SI column (Amprep silica mini-columns; Amersham Pharmacia Biotech, Piscataway, NJ). The column was washed with 3 ml of chloroform, 2 ml of chloroform-methanol (6:4, v/v) and 3 ml of chloroform-methanol-28% aqueous ammonia (70:85:7, v/v). PAF was eluted with 2 ml of chloroform-methanol-28% aqueous ammonia (50:50:7, v/v). The eluate was evaporated to dryness under nitrogen, and the residue was dissolved in 200 ml of saline containing 0.1% Triton X-100. PAF
Saturation binding assay was performed for determination of ET receptors as described previously [32,37]. Briefly, the cells were washed with Hank’s balanced salt solution containing 10 mM HEPES, pH 7.4, 0.1% bovine serum albumin (HBSS/BSA) and placed in this medium containing 6.25–800 pM [125I]-ET-1 ^ 1 mM unlabelled ET-1. After incubation at 228C for 3 h, the cells were washed with ice-cold HBSS/BSA and digested with 0.75N NaOH for determination of radioactivity. Specific binding of [125I]-ET-1 was the difference between cell-associated radioactivity in the presence and absence of 1 mM unlabelled ET-1.
2.7. Determination of prostaglandin E2 (PGE2) PGE2 was extracted from the culture medium and analyzed by ELISA using a kit from Amersham Pharmacia Biotech, Inc. following the manufacturer’s instructions.
202
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
2.8. Data analysis The values are presented as averages of triplicate determinations ^SEM. Each experiment was repeated at least three times using cells from different animals. Student’s t-test was employed for statistical comparison of the paired samples. A P value of ,0.05 was considered statistically significant.
3. Results 3.1. Effect of ET-1 on PAF synthesis in activated Kupffer cells Cell-associated PAF and its basal release were significantly increased in the cirrhotic as compared to the control cells (cell-associated, 1.02 ^ 0.06 versus 0.68 ^ 0.07 pg/mg DNA, P , 0:01; released, 1.42 ^ 0.14 versus 0.66 ^ 0.04 pg/mg DNA, P , 0:01) (Fig. 1). ET-1
Fig. 2. [3H]PAF binding to cirrhotic Kupffer cells. Cells were used after overnight culture for receptor binding assay as described in Section 2. Data from saturation binding assay (A); and Scatchard analysis (B) are shown. *P < 0.05 and **P < 0.01 versus control.
stimulated the synthesis of PAF in both control and cirrhotic Kupffer cells. However, the effect was more pronounced in the latter; while significant stimulation of PAF synthesis occurred at 10 nM ET-1 in control cells, in cirrhotic cells statistical significance was observed at 0.1 – 1 nM ET-1 (Fig. 1).
3.2. PAF receptor expression in cirrhotic Kupffer cells
Fig. 1. Effect of ET-1 on PAF synthesis by cirrhotic Kupffer cells. Kupffer cells from control and cirrhotic rats were cultured and stimulated with indicated concentrations of ET-1 for 15 min in serumfree condition. Cellular and released PAF was determined as described in Section 2. *P < 0.05 and **P < 0.01 versus ‘0’; #P < 0.01 versus control.
Scatchard analysis of the saturation binding data (Fig. 2) revealed doubling of the PAF binding capacity in cirrhotic Kupffer cells as compared to the control (Bmax of 17 ^ 1.4 versus 7.6 ^ 0.85 fmol/mg DNA, P , 0:001). There was no significant difference in the PAF receptor affinity between the cells from control and cirrhotic rats (1.19 ^ 0.15 versus 1.46 ^ 0.04 nM, P . 0:05). Consistent with the receptor binding data, the mRNA expression of PAF receptor was increased in the cirrhotic Kupffer cells (Fig. 3).
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
203
PGE2 synthesis in Kupffer cells [28,29]. Consistent with these findings, ET-1 and PAF stimulated PGE2 synthesis in control and cirrhotic Kupffer cells in a concentrationdependent manner; the effect being more pronounced in the latter (Fig. 6). The basal release of PGE2 by cirrhotic Kupffer cells also was greater than by control cells.
4. Discussion In this investigation, we found that the basal and ET-1stimulated synthesis of a potent hepatic vasoconstrictor and systemic hypotensive agent, PAF, are increased in Kupffer cells derived from the cirrhotic rat liver. PAF has been implicated to be an important mediator of hyperdynamic circulation associated with liver cirrhosis. In agreement with the previous reports in cirrhotic humans [39], increased blood PAF levels were observed in CCl4-induced cirrhotic rats [25]. That study [25] also demonstrated higher PAF concentration in hepatic venous blood than in portal venous blood of cirrhotic rats indicating enhanced synthesis in the
Fig. 3. PAF receptor mRNA expression in cirrhotic Kupffer cells. RT-PCR of PAF receptor mRNA was performed with cDNA prepared from RNA samples of control and cirrhotic Kupffer cells. Expression of b-actin mRNA was assessed using the same amount of cDNA. (A) PCR products of PAF and b-actin from control (CT) and cirrhotic (CIR) rat livers are shown. (B) Ratio of the PAF receptor and b-actin mRNA. *P < 0.05 versus control.
3.3. ET-1 receptor expression in cirrhotic Kupffer cells ET-1 binding capacity of the cirrhotic Kupffer cells was twice as much as that of the control cells (1.11 ^ 0.09 versus 0.56 ^ 0.08 fmol/mg DNA, P , 0:05) (Fig. 4), but there was no significant difference in the receptor affinity (Kd of 31.35 ^ 1.35 pM [cirrhotic] and 24.3 ^ 3.3 pM [control], P . 0:05). Consistent with a previous report [38], competition-binding analysis showed ET-1 binding to Kupffer cells exclusively via the ETB receptor (results not shown). As determined by RT-PCR, Kupffer cells were found to express only ETB mRNA (Fig. 5) and no mRNA transcripts for the ETA receptor or the ligand precursor preproET-1 were detected. It should be noted that other hepatic cells (endothelial cells, stellate cells, hepatocytes and biliary epithelial cells) express preproET-1 mRNA. The mRNA expression of ETB receptor was significantly increased in the cirrhotic Kupffer cells relative to the control cells (Fig. 5). 3.4. ET-1- and PAF-induced PGE2 synthesis Previously, both ET-1 and PAF were shown to stimulate
Fig. 4. [125I]ET-1 binding to cirrhotic Kupffer cells. Cells were used after overnight culture for receptor binding assay as described in Section 2. *P < 0.05 versus control.
204
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
and CCl4-treated rats at 1 and 2 weeks during CCl4 treatment [25], suggesting that the early rise [40] may be due to the effect of inflammatory mediators released in the liver in response to the toxin. The system then adapts to these changes but with persistence of inflammation, PAF synthesis is again increased. ET-1 may be responsible for the increased PAF synthesis in the injured liver. ET-1 induces synthesis of PAF in cultured rat Kupffer cells [22], and hepatic levels of ET-1 increase progressively during the development of CCl4-induced cirrhosis in rats [26]. In the cells from control rats, ET-1 stimulated the synthesis of PAF at 10 nM concentration, while significantly increased PAF synthesis occurred at ET-1 concentration of less than 1 nM in cirrhotic Kupffer cells suggesting that their sensitivity to ET-1 action is enhanced relative to the control cells. In addition to the enhanced synthesis, the extent of PAF release
Fig. 5. mRNA expression of preproendothelin-1 and ET-1 receptor subtypes in cirrhotic Kupffer cells. RT-PCR for PAF receptor mRNA was performed with cDNA prepared from RNA samples of control and cirrhotic Kupffer cells. Expression of b-actin mRNA was assessed using the same amount of cDNA. (A) PCR products of PAF and b-actin from control (CT) and cirrhotic (CIR) rat livers are shown. (B) Ratio of the PAF receptor and b-actin mRNA. *P < 0.001 versus control.
cirrhotic livers. The results of the present study suggest the possibility that the enhanced synthesis and release of PAF by Kupffer cells contributes to its elevated circulating concentration in cirrhotic rats. The basal levels of cellassociated and secreted PAF were significantly higher in Kupffer cells from cirrhotic as compared to the control rats. Inflammatory cytokines such as interleukin (IL)-1 and TNF are known to stimulate the synthesis of PAF [13]. The mRNA expression and the synthesis of these two cytokines are increased in Kupffer cells of the CCl4-cirrhotic rats [9]. It is reasonable to conclude that their autocrine effects may be an important mechanism of increased basal synthesis of PAF in cirrhotic Kupffer cells. A schematic (Fig. 7) summarizes changes previously known to occur in the Kupffer cell during cirrhosis, and includes the novel changes reported in this paper. All these changes are discussed in detail below. The PAF concentration in the liver has been shown to increase shortly (2 h) after CCl4 administration [40]. However, hepatic PAF concentrations are similar in control
Fig. 6. Effect of PAF and ET-1 on PGE2 synthesis in cirrhotic Kupffer cells. Cells were placed in serum-free medium after overnight culture, and were challenged with PAF or ET-1 24 h later. PGE2 in the medium was measured by ELISA After 15-min incubation. *P < 0.05, **P < 0.01, and ***P < 0.001 versus ‘0’; @P < 0.05 and #P < 0.01 versus control.
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
205
Fig. 7. Effects of stimulated synthesis of PAF in Kupffer cells in cirrhosis. Increased ET-1 released by stellate cells and endothelial cells in the cirrhotic liver acts on upregulated ETB receptors in Kupffer cells (presumably by the action of reactive oxygen species, ROS, generated by infiltrating neutrophils and by setllate cells) and stimulates the synthesis of PAF. Likewise, autocrine actions of proinflammatory mediators such as IL-1 and TNF-a also may stimulate PAF synthesis by Kupffer cells. PAF then acts on hepatic vascular smooth muscle cells and stellate cells and contributes to portal hypertension by causing their contraction. Its spillover into the systemic circulation is likely a cause of hypotension associated with cirrhosis. Autocrine PAF and paracrine ET-1 can act on their respective upregulated receptors in Kupffer cells to cause the synthesis and release of prostaglandin E2, which in turn may act to limit the hepatic injury.
also was increased in cirrhotic Kupffer cells, the ratio of released versus cell-associated PAF being about 1 for control and 1.5 for cirrhotic cells. This ratio was maintained under both basal and ET-1-stimulated conditions. Clearly, Kupffer cells appear to be major contributors to increased hepatic as well as circulating PAF in cirrhosis. Consistent with the increased sensitivity to ET-1-induced PAF synthesis, the receptor density for ET-1 is increased in the cirrhotic Kupffer cells. While the mechanisms of this phenomenon are not known, oxygen-free radicals cause up-regulation of ET-1 receptors in cultured stellate cells [41]. It is likely that a similar mechanism may cause increase in the ET receptors in Kupffer cells considering that the chronically injured liver is a site of perpetual inflammation, and thereby under constant oxidative stress. Interestingly, PAF has been shown to stimulate the generation of reactive oxygen species in Kupffer cells [42]. However, it should be noted that the ability of Kupffer cells to generate reactive oxygen species is depressed in CCl4-induced cirrhosis [43]. Thus the source of reactive oxygen species could be infiltrating blood cells such as
neutrophils [44 –46] or even neighboring stellate cells [47] in the diseased liver. Previous work has shown that PAF stimulates phosphoinositide metabolism and synthesis of eicosanoids in rat Kupffer cells [28,29]. Thus the increase in the PAF receptor density and the enhanced basal synthesis of prostaglandin E2 in Kupffer cells from cirrhotic rats suggest an autocrine loop of the PAF action. One of the major characteristics of liver cirrhosis is proliferation of activated stellate cells, which are responsible for excessive deposition of fibrous tissue and the contractile component of portal hypertension [48]. Activated stellate cells also synthesize greater amounts of ET-1 [23,37,49]. It has been shown that PGE2, an hepatoprotective eicosanoid, can inhibit growth factorinduced proliferation of activated stellate cells by causing inhibition of MAP kinase activity [50]. Combining these observations, it is reasonable to assume that enhanced synthesis of PGE2 (basal as well as ET-1- and PAFstimulated) in cirrhotic Kupffer cells may be a mechanism of limiting the liver injury. In conclusion, the findings of this paper suggest that
206
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
activated Kupffer cells are a main source of increased hepatic and systemic PAF in cirrhotic rats, and their enhanced responses to ET-1 is an integral part of this mechanism.
Acknowledgements This work was supported by a grant from NIH (DK 54411) and a VA Merit award.
References [1] Decker K. Biologically active products of stimulated liver macrophages (Kupffer cells). Eur J Biochem 1990;192:245– 261. [2] Arthur MJ, Bentley IS, Tanner AR, Saunders PK, Millward-Sadler GH, Wright R. Oxygen-derived free radicals promote hepatic injury in the rat. Gastroenterology 1985;89:1114–1122. [3] Shiratori Y, Kawase T, Shiina S, Okano K, Sugimoto T, Teraoka H, et al. Modulation of hepatotoxicity by macrophages in the liver. Hepatology 1988;8:815– 821. [4] Nagakawa J, Hishinuma I, Hirota K, Miyamoto K, Yamanaka T, Tsukidate K, et al. Involvement of tumor necrosis factor-alpha in the pathogenesis of activated macrophage-mediated hepatitis in mice. Gastroenterology 1990;99:758–765. [5] Adachi Y, Bradford BU, Gao W, Bojes HK, Thurman RG. Inactivation of Kupffer cells prevents early alcohol-induced liver injury. Hepatology 1994;20:453–460. [6] Edwards MJ, Keller BJ, Kauffman FC, Thurman RG. The involvement of Kupffer cells in carbon tetrachloride toxicity. Toxicol Appl Pharmacol 1993;119:275 –279. [7] Przybocki JM, Reuhl KR, Thurman RG, Kauffman FC. Involvement of non-parenchymal cells in oxygen-dependent hepatic injury by allyl alcohol. Toxicol Appl Pharmacol 1992;115:57–63. [8] Thurman RG, Bradford BU, Iimuro Y, Knecht KT, Arteel GE, Yin M, et al. The role of gut-derived bacterial toxins and free radicals in alcohol-induced liver injury. J Gastroenterol Hepatol 1998; 13(Suppl.):S39–S50. [9] Luckey SW, Petersen DR. Activation of Kupffer cells during the course of carbon tetrachloride-induced liver injury and fibrosis in rats. Exp Mol Pathol 2001;71:226–240. [10] Snyder F. Platelet-activating factor and related acetylated lipids as potent biologically active cellular mediators. Am J Physiol 1990;259: C697–C708. [11] Chao W, Olson MS. Platelet-activating factor: receptors and signal transduction. Biochem J 1993;292:617 –629. [12] Prescott SM, Zimmerman GY, Stafforini DM, McIntyre TM. Plateletactivating factor and related lipid mediators. Ann Rev Biochem 2000; 69:419–445. [13] Montrucchio G, Alloatti G, Camussi G. Role of platelet-activating factor in cardiovascular pathophysiology. Physiol Rev 2000;80: 1669–1699. [14] Buxton DB, Fisher RA, Hanahan DJ, Olson MS. Platelet-activating factor-mediated vasoconstriction and glycogenolysis in the perfused rat liver. J Biol Chem 1986;261:644–649. [15] Hines KL, Braillon A, Fisher RA. PAF increases hepatic vascular resistance and glycogenolysis in vivo. Am J Physiol 1991;260: G471–G480. [16] Kleber G, Braillon A, Gaudin C, Champigneulle B, Cailmail S, Lebrec D. Hemodynamic effects of endotoxin and platelet activating factor in cirrhotic rats. Gastroenterology 1992;103:282 –288. [17] Lorant DE, Patel KD, McIntyre TM, McEver RP, Prescott SM, Zimmerman GA. Coexpression of GMP-140 and PAF by endothelium
[18] [19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30] [31]
[32]
[33]
[34]
[35]
[36]
[37]
stimulated by histamine or thrombin: a juxtacrine system for adhesion and activation of neutrophils. J Cell Biol 1991;115:223–234. Braquet P, Touqui L, Shen TY, Vargaftig BB. Perspectives in plateletactivating factor research. Pharmacol Rev 1987;39:97–145. Braquet P, Paubert-Braquet M, Bourgain RH, Bussolino F, Hosford D. PAF/cytokine auto-generated feedback networks in microvascular immune injury: consequences in shock, ischemia and graft rejection. J Lipid Mediat 1989;1:75–112. Zimmerman GA, Prescott SM, McIntyre TM. Endothelial cell interactions with granulocytes: tethering and signaling molecules. Immunol Today 1992;13:93–100. Zhou W, Chao W, Levine BA, Olson MS. Role of platelet-activating factor in hepatic responses after bile duct ligation in rats. Am J Physiol 1992;263:G587 –G592. Mustafa SB, Gandhi CR, Harvey SAK, Olson MS. Endothelin stimulates platelet activating factor synthesis by cultured rat Kupffer cells. Hepatology 1995;21:545– 553. Gandhi CR, Sproat LA, Subbotin VM. Increased hepatic endothelin-1 levels and endothelin receptor density in cirrhotic rats. Life Sci 1996; 58:55–62. Gandhi CR, Kang Y, De Wolf A, Madariaga J, Aggarwal S, Scott V, et al. Altered endothelin homeostasis in patients undergoing liver transplantation. Liver Transplant Surg 1996;2:362–369. Yang Y, Nemoto E, Harvey SAK, Gandhi CR. Increased hepatic platelet activating factor (PAF) and PAF receptors in CCl4-induced liver cirrhosis: implications for chronic liver injury. Hepatology 2002; 36:A252. Gandhi CR, Nemoto E, Watkins SC, Subbotin VM. An endothelin receptor antagonist TAK-044 ameliorates carbon tetrachlorideinduced acute liver injury and portal hypertension in rats. Liver 1998;18:39–48. McLean EK, McLean AEM, Sutton PM. Instant cirrhosis. An improved method for producing cirrhosis of the liver in rats by simultaneous administration of carbon tetrachloride and phenobarbitone. Br J Exp Pathol 1969;50:502– 506. Gandhi CR, Hanahan DJ, Olson MS. Two distinct pathways of platelet-activating factor-induced hydrolysis of phosphoinositides in primary cultures of rat Kupffer cells. J Biol Chem 1990;265: 18234–18241. Gandhi CR, Stephenson K, Olson MS. A comparative study of endothelin- and platelet-activating factor-mediated signal transduction and prostaglandin synthesis in rat Kupffer cells. Biochem J 1992; 281:485–492. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 1959;37:911–917. Shinozaki K, Kawasaki T, Kambayashi J, Sakon M, Shiba E, Uemura Y, et al. A new method of purification and sensitive bioassay of platelet-activating factor (PAF) in human whole blood. Life Sci 1994; 54:429–437. Gandhi CR, Uemura T, Kuddus R. Endotoxin causes up-regulation of endothelin receptors in cultured hepatic stellate cells via nitric oxidedependent and -independent mechanisms. Br J Pharmacol 2000;131: 319 –327. Bito H, Honda Z, Nakamura M, Shimizu T. Cloning, expression and tissue distribution of rat platelet-activating-factor-receptor cDNA. Eur J Biochem 1994;221:211 –218. Anselmi K, Subbotin VM, Nemoto E, Gandhi CR. Accelerated reversal of carbon tetrachloride-induced cirrhosis in rats by endothelin receptor antagonist TAK-044. J Gastroenterol Hepatol 2002;17: 589 –597. Gomez J, Bloom JW, Yamamura HI, Halonen M. Characterization of receptors for platelet-activating factor in guinea pig lung membranes. Am J Respir Cell Mol Biol 1990;3:259–264. Ibe BO, Sander FC, Raj JU. Platelet-activating factor receptors in lamb lungs are downregulated immediately after birth. Am J Physiol 2000;278:H1168–H1176. Gandhi CR, Kuddus RH, Uemura T, Rao AS. Endothelin stimulates
Y. Yang et al. / Journal of Hepatology 39 (2003) 200–207
[38]
[39]
[40]
[41]
[42]
[43]
[44]
transforming growth factor-b1 and collagen synthesis in stellate cells from control but not cirrhotic rat liver. Eur J Pharmacol 2000;406: 311–318. Stephenson K, Harvey SA, Mustafa SB, Eakes AT, Olson MS. Endothelin association with the cultured rat Kupffer cell: characterization and regulation. Hepatology 1995;22:896–905. Caramelo C, Fernandez-Gallardo S, Santos JC, Inarrea P, SanchezCrespo M, Lopez-Novoa JM, et al. Increased levels of plateletactivating factor in blood from patients with cirrhosis of the liver. Eur J Clin Invest 1987;17:7– 11. Marathe GK, Harrison KA, Roberts 2nd LJ, Morrow JD, Murphy RC, Tjoelker LW, et al. Identification of platelet-activating factor as the inflammatory lipid mediator in CCl4-metabolizing rat liver. J Lipid Res 2001;42:587–596. Gabriel A, Kuddus RH, Rao AS, Watkins WD, Gandhi CR. Superoxide-induced changes in endothelin (ET) receptors in hepatic stellate cells. J Hepatology 1998;29:614–627. Dieter P, Schulze-Specking A, Decker K. Differential inhibition of prostaglandin and superoxide production by dexamethasone in primary cultures of rat Kupffer cells. Eur J Biochem 1986;159: 451–457. Arii S, Monden K, Itai S, Sasaoki T, Adachi Y, Funaki N, et al. Depressed function of Kupffer cells in rats with CCl4-induced liver cirrhosis. Res Exp Med (Berl) 1990;190:173–182. Bautista AP, Meszaros K, Bojta J, Spitzer JJ. Superoxide anion generation in the liver during the early stage of endotoxemia in rats. J Leukoc Biol 1990;48:123– 128.
207
[45] Pesonen EJ, Hockerstedt K, Makisalo H, Vuorte J, Jansson SE, Orpana A, et al. Transhepatic neutrophil and monocyte activation during clinical liver transplantation. Transplantation 2000;69: 1458– 1464. [46] Svegliati-Baroni G, Saccomanno S, van Goor H, Jansen P, Benedetti A, Moshage H. Involvement of reactive oxygen species and nitric oxide radicals in activation and proliferation of rat hepatic stellate cells. Liver 2001;21:1–12. [47] Li L, Tao J, Davaille J, Feral C, Mallat A, Rieusset J, et al. 15-deoxyDelta 12,14-prostaglandin J2 induces apoptosis of human hepatic myofibroblasts. A pathway involving oxidative stress independently of peroxisome-proliferator-activated receptors. J Biol Chem 2001; 276:38152–38158. [48] Friedman SL. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem 2000;275:2247–2250. [49] Pinzani M, Milani S, De Franco R, Grappone C, Caligiuri A, Gentilini A, et al. Endothelin 1 is overexpressed in human cirrhotic liver and exerts multiple effects on activated hepatic stellate cells. Gastroenterology 1996;110:534 –548. [50] Mallat A, Preaux AM, Serradeil-Le Gal C, Raufaste D, Gallois C, Brenner DA, et al. Growth inhibitory properties of endothelin-1 in activated human hepatic stellate cells: a cyclic adenosine monophosphate-mediated pathway. Inhibition of both extracellular signalregulated kinase and c-Jun kinase and upregulation of endothelin B receptors. J Clin Invest 1996;98:2771 –2778.