Lack of genetic association of cholesteryl ester transfer protein polymorphisms with late onset Alzheimers disease

Neuroscience Letters 381 (2005) 36–41

Lack of genetic association of cholesteryl ester transfer protein polymorphisms with late onset Alzheimers disease Haiyan Zhu a, b , Rangaraj K. Gopalraj a, b , Jeremiah F. Kelly c , David A. Bennett c , Steven Estus a, b, ∗ a

Department of Physiology, University of Kentucky, 800 S. Limestone St., Lexington, KY 40536-0230, USA b Sanders-Brown Center on Aging, University of Kentucky, Lexington, KY, USA c Rush Alzheimers Disease Center, Rush University Medical Center, Chicago, IL, USA Received 22 December 2004; received in revised form 14 January 2005; accepted 27 January 2005

Abstract Dysregulation of cholesterol homeostasis may be associated with the pathogenesis of coronary artery disease (CAD) and Alzheimers disease (AD). Recently, several single nucleotide polymorphisms (SNPs) in cholesteryl ester transfer protein (CETP) were associated with altered plasma CETP concentrations, cholesterol concentrations and CAD. Hence, these CETP SNPs represent excellent candidates for evaluating association with AD. To date, one study has evaluated the association between a single CETP SNP and AD. In this study, we examined three CETP SNPs to evaluate the genetic association of CETP with late onset AD on two study cohorts: the Religious Orders Study (ROS) series, including 85 AD and 70 non-AD individuals, and the University of Kentucky (UKY) series, including 78 AD and 84 non-AD individuals. Significant association between CETP genotypes or haplotypes and late onset AD was not detected in these two study cohorts. Moreover, the CETP genotypes and haplotypes were not significantly associated with AD when the populations were stratified for the presence or absence of apolipoprotein E4 (apoE4). In summary, CETP genetic variants were not associated with AD in two series. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Alzheimers disease; Cholesteryl ester transfer protein; Apolipoprotein E; Polymorphism; Haplotype; Genetic association

Dysregulation of cholesterol homeostasis contributes to the pathogenesis of vascular disease, especially CAD [17]. Loss of cholesterol homeostasis may be reflected in abnormal levels of high-density lipoprotein (HDL), low-density lipoprotein (LDL) or the ratio of these two lipoproteins. HDL and LDL particles are composed of different ratios of triglyceride (TG), cholesterol, and apolipoprotein. HDL contains more cholesterol and less TG compared to lower density lipoprotein particles. A low level of HDL increases the risk for CAD [16]. CETP transfers cholesteryl ester from HDL to lower density lipoprotein particles in exchange for triglycerides, essentially converting HDL to lower density lipoprotein particles. The CETP proximal promoter contains a dietary cholesterol response element [18]. Studies showed that several CETP SNPs independently associated with ∗

Corresponding author. Tel.: +1 859 323 3985x264; fax: +1 859 323 2866. E-mail address: [email protected] (S. Estus).

0304-3940/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2005.01.078

plasma CETP concentrations, which further affected the plasma level of HDL and ratio of LDL to HDL [10,11]. Multiple studies have indicated that a Taq1B restriction fragment length polymorphism, one of the most studied CETP SNPs, is associated with CETP concentration, the plasma HDL level, atherosclerosis progression, and how well patients respond to cholesterol-lowering drugs [12,19]. Hence, CETP SNPs appear to modulate the level of plasma CETP and cholesterol homeostasis. In addition to cholesterol effects on the cardiovascular system, emerging evidence has indicated that cholesterol may influence brain function. For example, the most widely reproduced risk factor for both late onset AD and cardiovascular disease is apoE4, an allele of apoE [13,21]. Also, the brains of rabbits fed with a high cholesterol diet showed increased AD-like ␤-amyloid and apoE immunoreactivities [24,25]. Moreover, some but not all studies have suggested that cholesterol-lowering drugs, such as statins, may reduce the

H. Zhu et al. / Neuroscience Letters 381 (2005) 36–41

odds of AD [5,14,26]. However, the relationship between the peripheral and central pools of cholesterol is unclear because their communication is limited due to the poor permeability of cholesterol through the blood–brain barrier (BBB) [3]. Indeed, the brain has its own cholesterol production and circulation pool separated from the peripheral system [3]. Within the brain, cholesterol is shuttled between cells by brain-generated cholesterol apolipoproteins, including apoE, and their receptors. Although 25% of the body cholesterol resides in the brain, 99.5% of this brain cholesterol exists as the free and unesterified form in myelin sheaths and cellular membranes. The primary brain cholesterol metabolite is 24Shydroxycholesterol, which easily passes through the BBB, and is detected in the plasma. In summary, the study of the proteins that modulate brain cholesterol and the SNPs within these proteins that underlie brain cholesterol heterogeneity between individuals is an area of active research. Since CETP SNPs modulate CETP levels and cholesterol in the periphery, CETP may be a reasonable candidate for modulating cholesterol in the brain. CETP may be synthesized in astrocytes as immunostaining with antibodies against CETP labeled astrocytes in control tissue and robustly labeled reactive astrocytes in AD tissue [27]. However, conflicting reports have appeared regarding whether CETP is detectable in the CSF [1,6]. Overall, we interpret these reports as suggesting that CETP may be expressed in astrocytes, but additional studies are necessary to clarify the role of CETP in brain cholesterol homeostasis. Recently, Fidani et al. [7] evaluated the genetic association between the CETP Taq1B SNP and late onset AD. Significant association between Taq1B and AD was not found in that study, which included 102 clinically diagnosed late onset AD patients and a spousal control group with 97 non-AD individuals. However, the authors noticed a trend of a higher frequency of individuals that were homozygous for the minor allele in the non-AD group compared to the AD group [7]. This CETP genotype has been associated with increased HDL and decreased CAD risk [10]. In summary, we hypothesized a genetic association between CETP SNPs and late onset AD because evaluating this hypothesis may contribute to the underlying biology regarding AD and cholesterol homeostasis and because of the suggestive nature of the Fidani et al report [7]. To further elucidate the relationship between CETP SNPs and late onset AD, we examined three CETP SNPs including Taq1B to evaluate the genetic association of CETP with late onset AD on two study cohorts, i.e., the ROS and UKY series. These three CETP SNPs were reported to be tightly associated with the plasma CETP concentration and the level of plasma HDL [10]. The ROS series, derived from the Rush University Medical Center, included 85 individuals with AD (37 male, average age at death was 86.2 ± 6.7 (years, average ± S.D.); 48 female, average age at death was 88.8 ± 5.8) and 70 without cognitive impairment (36 male, average age at death was 80.0 ± 7.1; 34 female, average age at death was 83.8 ± 5.4). Persons with mild cognitive impairment were excluded from the analyses. Each member of the ROS, which

37

includes older Catholic nuns, brothers, or priests, was examined annually with neurological and cognitive performance testing [2]. Details of the clinical evaluation have been reported previously [2]. The UKY series was a clinically diagnosed case–control study. This series included 78 AD individuals (20 male, average age at diagnosis was 72.6 ± 6.5; 58 female, average age at diagnosis was 74.5 ± 9.2) that were largely identified through the UKY Alzheimers Center Memory Disorders Clinic and 84 non-AD individuals (35 male, average age at diagnosis was 79.7 ± 6.7; 49 female, average age at diagnosis was 80.2 ± 8.8) that were from the Biologically Resilient Adults in Neurological Studies (BRAiNS) program [20]. Some of BRAiNS individuals converted into a diagnosis of AD over time and were included in the AD group [22]. The BRAiNS study consists of community-dwelling volunteers with bi-annual physical and neuropsychological dementia testing after initial screening for alcohol or drug abuse, or psychiatric illness, or dementia. Persons with AD in both series were diagnosed following the recommendations of the joint working group of the National Institute of Neurologic and Communicative Disorders and Stroke and the Alzheimers Disease and Related Disorders Association (NINCDS/ADRDA) as previously described [2,15,22]. Non-AD individuals in both the ROS and UKY series were cognitively intact during the entire study period. The appropriate consent forms were obtained from all subjects following institutional review boardapproved guidelines. Only Caucasians were included in this study. Genomic DNA was extracted from autopsied brain tissue for the ROS series and from peripheral blood leukocytes for the UKY series by standard methods. ApoE genotypes were determined by a restriction fragment length polymorphism approach [9]. CETP genotyping used a TaqMan approach coupled to MGB probes (FAM and VIC dye-labeled) designed by Applied Biosystems (Foster City, CA, USA). The sequence locus for designing the three CETP SNPs assays was AY172980 in NCBI. Forward primer, reverse primer, major allele probe, and minor allele probe were as follows: CETP-2708: 5 CCCTCTGACTCCGGTATTCTTAGAA3 , 5 GAGCGCTTCGGGAATTTGG3 , FAM-TGGGACCAG CACTGA-MGBNFQ, VIC-CTGGGACCAACACTGAMGBNFQ; CETP-971: 5 TGGGCAGCTTTGGTATTGGA3 , 5 CTTGCTCAGTCGCCTCTCA3 , FAM-CCTAGTCCCGAGTTTG-MGBNFQ, VIC-CCCTAGTCCTGAGTTTGMGBNFQ; CETP-Taq1B: 5 GCCAGGTATAGGGATTTGTGTTTGT3 , 5 CCCCTAACCTGGCTCAGATC3 , VICCCCTAACTCGAACCC-MGBNFQ, FAM-CCCTAACTT GAACCC-MGBNFQ. Genomic DNA was denatured at 95◦ for 10 min, and then amplified for 40 cycles by using 92 ◦ C for 15 s and 60 ◦ C for 1 min. Genotypes were determined using an ABI PRISM 7000 sequence detection system (Applied Biosystems, Foster City, CA, USA). The resultant data were analyzed for genotype and allele frequency. Haplotypes were calculated by using the Arlequin software package (version 2.000) [23].

38

H. Zhu et al. / Neuroscience Letters 381 (2005) 36–41

Table 1 Three CETP SNPs selected for AD genetic association study SNP position

Promoter-2708 Promoter-971 Intron1 Taq1B

NCBI refSNP ID

rs12149545 rs4783961 rs708272

Nucleotide exchange (1/2)

Allele frequency

G/A G/A G/A

The three CETP SNPs selected for the study are shown in Table 1. The major allele for each SNP is “G”, marked as “1”. The minor allele for each SNP is “A”, marked as “2”. The observed genotype and allele distributions of the three CETP SNPs in both study cohorts were consistent with Hardy–Weinberg equilibrium. The overall frequency of each SNP in the two series was similar to other reports (Table 1 and [7,10]). χ2 -tests were used to evaluate genotypic and allelic association between the three CETP SNPs and AD in each series. A significant (p ≤ 0.05) association between the CETP SNPs and AD was not observed (Table 2). In the ROS and UKY series, the trend reported by Fidani et al. [7] that the frequency of individuals that were homozygous for the Taq1B minor allele was greater in the non-AD than AD individuals was not reproduced, i.e., the frequencies of nonAD and AD individuals in their study was 21.6% and 13.7%, respectively, while the corresponding frequencies in the ROS series were 14.3% and 16.5%, and the UKY series was 19.5% and 24.7%, respectively. Hence, our study did not confirm the trend suggested by the work of Fidani et al. [7].

ROS series

UKY series

Ref. [10]

Ref. [7]

0.71/0.29 0.52/0.48 0.60/0.40

0.68/0.32 0.49/0.51 0.56/0.44

0.69/0.31 0.51/0.49 0.60/0.40

N/A N/A 0.59/0.41

Late onset AD appears to have multiple genetic risk factors [20]. ApoE4 is the most widely reproduced factor associated with late onset AD, which we confirmed in both of our study cohorts [8,21]. Since the robust effects of apoE4 may overshadow an effect of the CETP SNPs on late onset AD, we analyzed the CETP data further by evaluating only individuals without apoE4 (Table 3). A possible association between the three CETP SNPs and AD was not detected in either study series except the Taq1B (rs708272) SNP in the UKY series. However, this result was not confirmed in the ROS series (Table 3) or in the series by Fidani et al [7]. We also parsed the CETP data to analyze the association between AD and individuals with either one or two copies of apoE4, and did not detect a significant association between the three CETP SNPs and AD in either study series (data not shown). To further investigate the possible effects of the three CETP SNPs in combination and to evaluate other unstudied but tightly linked SNPs, we then evaluated the potential relationship between CETP haplotypes and AD [8]. Unambiguous haplotypes were determined by evaluating only those

Table 2 CETP genotypic and allelic frequencies for ROS and UKY series Subject

ROS series

CETP SNPs

rs12149545

Genotype 1/1 1/2 2/2 Allele 1 2

rs4783961

Genotype 1/1 1/2 2/2 Allele 1 2

rs708272 (Taq1B)

Genotype 1/1 1/2 2/2 Allele 1 2

UKY series

AD n (%)

Non-AD n (%)

χ2

85 (100.0) 41 (48.2) 36 (42.4) 8 (9.4)

69 (100.0) 39 (56.5) 24 (34.8) 6 (8.7)

1.09 (0.58)

170 (100.0) 118 (69.4) 52 (30.6)

138 (100.0) 102 (73.9) 36 (26.1)

85 (100.0) 20 (23.5) 45 (52.9) 20 (23.5)

AD n (%)

Non-AD n (%)

χ2 (p-value)

76 (100.0) 38 (50.0) 29 (38.2) 9 (11.8)

83 (100.0) 37 (44.6) 38 (45.8) 8 (9.6)

0.97 (0.61)

0.76 (0.38)

152 (100.0) 105 (69.1) 47 (30.9)

166 (100.0) 112 (67.5) 54 (32.5)

70 (100.0) 21 (30.0) 33 (47.1) 16 (22.9)

0.87 (0.65)

78 (100.0) 22 (28.2) 37 (47.4) 19 (24.2)

84 (100.0) 18 (21.4) 43 (51.2) 23 (27.4)

1.01 (0.60)

170 (100.0) 85 (50.0) 85 (50.0)

140 (100.0) 75 (53.6) 65 (46.4)

0.39 (0.53)

156 (100.0) 81 (51.9) 75 (48.1)

168 (100.0) 79 (47.0) 89 (53.0)

0.78 (0.38)

85 (100.0) 29 (34.1) 42 (49.4) 14 (16.5)

70 (100.0) 25 (35.7) 35 (50.0) 10 (14.3)

0.15 (0.93)

77 (100.0) 30 (39.0) 28 (36.4) 19 (24.7)

82 (100.0) 24 (29.3) 42 (51.2) 16 (19.5)

3.57 (0.17)

170 (100.0) 100 (58.8) 70 (41.2)

140 (100.0) 85 (60.7) 55 (39.3)

0.11 (0.74)

154 (100.0) 88 (57.1) 66 (42.9)

164 (100.0) 90 (54.9) 74 (45.1)

0.17 (0.68)

(p-value)

0.09 (0.76)

H. Zhu et al. / Neuroscience Letters 381 (2005) 36–41

39

Table 3 CETP genotypic and allelic frequencies in individuals without apoE4 for ROS and UKY series Subject

ROS series

CETP SNPs

rs12149545

Genotype 1/1 1/2 2/2 Allele 1 2

rs4783961

Genotype 1/1 1/2 2/2 Allele 1 2

rs708272 (Taq1B)

Genotype 1/1 1/2 2/2 Allele 1 2

UKY series

AD n (%)

Non-AD n (%)

χ2

50 (100.0) 23 (46.0) 23 (46.0) 4 (8.0)

56 (100.0) 31 (55.4) 19 (33.9) 6 (10.7)

1.63 (0.44)

100 (100.0) 69 (69.0) 31 (31.0)

112 (100.0) 81 (72.3) 31 (27.7)

50 (100.0) 11 (22.0) 30 (60.0) 9 (18.0)

AD n (%)

Non-AD n (%)

χ2 (p-value)

34 (100.0) 18 (52.9) 10 (29.4) 6 (17.7)

56 (100.0) 26 (46.4) 25 (44.6) 5 (8.9)

2.76 (0.25)

0.28 (0.60)

68 (100.0) 46 (67.6) 22 (32.4)

112 (100.0) 77 (68.8) 35 (31.3)

56 (100.0) 17 (30.4) 26 (46.4) 13 (23.2)

1.97 (0.37)

35 (100.0) 10 (28.6) 16 (45.7) 9 (25.71)

57 (100.0) 12 (21.1) 31 (54.4) 14 (24.6)

0.84 (0.66)

100 (100.0) 52 (52) 48 (48)

112 (100.0) 60 (53.6) 52 (46.4)

0.05 (0.82)

70 (100.0) 36 (51.4) 34 (48.6)

114 (100.0) 55 (48.2) 59 (51.8)

0.18 (0.68)

50 (100.0) 16 (32.0) 24 (48.0) 10 (20.0)

56 (100.0) 20 (35.7) 26 (46.4) 10 (17.9)

0.19 (0.91)

34 (100.0) 16 (47.1) 10 (29.4) 8 (23.5)

56 (100.0) 16 (28.6) 32 (57.1) 8 (14.3)

6.54 (0.04)

100 (100.0) 56 (56.0) 44 (44.0)

112 (100.0) 66 (58.9) 46 (41.1)

0.19 (0.67)

68 (100.0) 42 (61.8) 26 (38.2)

112 (100.0) 64 (57.1) 48 (42.9)

0.37 (0.54)

(p-value)

0.02 (0.88)

Table 4 Complete data from ROS and UKY series rs12149545 G(1)/A(2)

rs4783961 G(1)/A(2)

rs708272 G(1)/A(2)

Haplotypes

ROS AD n (%)

Non-AD n (%)

AD n (%)

Non-AD n (%)

1/1

1/1

1/1 1/2 2/2

111/111 111/112 112/112

14 (16.5) 6 (7.1) 0 (0.0)

15 (21.7) 5 (7.2) 1 (1.4)

15 (19.7) 5 (6.6) 1 (1.3)

10 (12.2) 7 (8.5) 1 (1.2)

1/2

1/1 1/2 1/2 2/2

111/121 111/122a 112/121a 112/122

14 (16.5) 2 (2.4) 1 (1.2) 2 (2.4)

8 (11.6) 5 (7.2) 3 (4.3) 0 (0.0)

12 (15.8) 0 (0.0) 1 (1.30) 0 (0.0)

11 (13.4) 1 (1.2) 1 (1.2) 1 (1.2)

2/2

1/1 1/2

121/121 121/122

1 (1.2) 1 (1.2)

1 (1.4) 1 (1.4)

3 (3.9) 1 (1.3)

3 (3.7) 2 (2.4)

1/1

1/2

111/212a

0 (0.0)

0 (0.0)

1 (1.3)

0 (0.0)

1/2 2/2

111/222a 112/222a

22 (25.9) 4 (4.7)

14 (20.3) 2 (2.9)

15 (19.7) 8 (10.5)

24 (29.3) 4 (4.9)

2/2

1/2 2/2

121/222a 122/222

9 (10.6) 1 (1.2)

7 (10.1) 1 (1.4)

4 (5.3) 1 (1.3)

7 (8.5) 2 (2.4)

2/2

1/2 2/2

221/222 222/222

1 (1.2) 7 (8.2)

0 (0.0) 6 (8.7)

0 (0.0) 9 (11.8)

0 (0.0) 8 (9.8)

85 (100.0)

69 (100.0)

76 (100.0)

82 (100.0)

1/2

1/2

2/2

Total a

Haplotypes were calculated for these genotypes by using Arlequin software analysis [25].

UKY

40

H. Zhu et al. / Neuroscience Letters 381 (2005) 36–41

Table 5 CETP haplotypes in ROS and UKY series Haplotypes

111 112 121 122 212 221 222 Total chromosomes

ROS series

UKY series

AD n (%)

Non-AD n (%)

Total n (%)

AD n (%)

Non-AD n (%)

Total n (%)

72 (42.0) 13 (7.9) 27 (16.1) 6 (3.3) 0 (0.0) 1 (0.7) 51 (29.9)

62 (45.0) 12 (8.6) 21 (15.1) 7 (5.2) 0 (0.0) 0 (0.0) 36 (26.1)

134 (43.3) 25 (8.2) 48 (15.7) 13 (3.3) 0 (0.0) 1 (0.4) 87 (28.2)

63 (41.5) 16 (10.3) 24 (15.7) 2 (1.5) 1 (0.8) 0 (0.0) 46 (30.3)

63 (38.4) 15 (9.2) 27 (16.5) 6 (3.6) 0 (0.0) 0 (0.0) 53 (32.3)

126 (39.9) 31 (9.7) 51 (16.1) 8 (2.6) 1 (0.4) 0 (0.0) 99 (31.3)

170 (100.0)

138 (100.0)

308 (100.0)

152 (99.9)

164 (100.0)

318 (100.0)

Table 6 CETP haplotypes in individuals without apoE4 allele in ROS and UKY series Haplotypes

111 112 121 122 222 Total chromosomes

ROS series

UKY series

AD n (%)

Non-AD n (%)

Total n (%)

AD n (%)

Non-AD n (%)

Total n (%)

43 (43.2) 9 (8.8) 13 (12.8) 4 (4.2) 31 (31.0)

51 (45.8) 9 (7.8) 15 (13.1) 6 (5.6) 31 (27.7)

94 (44.6) 18 (8.3) 28 (13.2) 10 (4.9) 62 (29.3)

32 (47.1) 4 (5.9) 10 (14.7) 0 (0.0) 22 (32.4)

46 (41.1) 9 (8.0) 18 (16.0) 4 (3.6) 35 (31.3)

78 (43.6) 13 (7.2) 28 (15.5) 4 (2.2) 57 (31.7)

100 (100.0)

112 (100.0)

212 (100.3)

68 (100.1)

112 (100.0)

180 (100.2)

subjects that were either homozygous for each of the three polymorphisms or heterozygous at only one of the three polymorphisms (Table 4). To increase the power of our analysis, we used Arlequin to calculate CETP ambiguous haplotypes in the ROS and UKY series as well (Table 5). An association between the CETP haplotypes and AD was not detected in either series (Table 5). Similarly, an association between CETP haplotypes and AD was not discerned in subjects without (Table 6) or with apoE4 (data not shown) in either series. We have considered the possibility that our study may lack sufficient statistical power to detect an association between CETP genotypes or haplotypes and AD. To evaluate this possibility, we performed a series of power analyses on genotype and haplotype data from the combined ROS and UKY series. For the genotype data, we found that the power value was ≥0.93 for each association except for that between AD and individuals that were 2/2 Taq1B homozygous, which had a power value of 0.55. For the analysis of haplotypes with a frequency ≥5%, we found that our study had a power of ≥0.88. The high statistical power of these results generally reflects that their relative risks approached one and that the p values derived from χ2 analyses were typically ≥0.85. The lower power for the Taq1B SNP association with AD reflects that although the relative risk was modest, i.e., 1.1, the associated p-value trended modestly towards significance, i.e., p = 0.41. Interestingly, we calculate that with this relative risk and a power of 0.80, we would require 7734 AD and 7734 non-AD individuals to demonstrate a significant association between this Taq1B SNP and AD (p = 0.05). Hence, although the Taq1B SNP may merit further studies involving very large populations, the results obtained with the other CETP SNPs and haplotypes appear likely to be true negative associations.

In conclusion, in the present study involving rs12149545, rs4783961, and rs708272, we did not find a significant genotypic or haplotypic association between CETP and AD in the two studied cohorts. This result is somewhat surprising given that in the peripheral system, CETP SNPs apparently modulate CETP concentration, HDL levels in the plasma, and the risk of CAD [4]. There are several possible interpretations of our study. First, CETP expression in the brain may be restricted to astrocytes [27], suggesting an astrocyte specific promoter, and hence the promoter SNPs that modulate CETP expression in the periphery may not be functional in the brain. Second, the levels of HDL and other lipoprotein particles in the brain may be modulated predominately by proteins other than CETP. Thus, CETP may not modulate cholesterol sufficiently in the brain for these promoter SNPs to have a discernible effect on the odds of AD. Third, we speculate that additional CETP SNPs and/or haplotypes that we have not evaluated may modulate AD risk, or that our study may not be sufficiently large and hence statistically powerful to detect a modest effect of these SNPs. We anticipate that the results presented here will facilitate an eventual meta-analysis with sufficient power to discern between these latter two possibilities.

Acknowledgments The authors thank the UKY AD Research Center including William Markesbery and members of the Estus laboratory for helpful discussion. They also thank Joseph Pulliam for isolating the DNA from the ROS series. We thank the participants in the Religious Orders Study, the BRAiNS Study, and

H. Zhu et al. / Neuroscience Letters 381 (2005) 36–41

the patients at the UKY AD Center. This project was funded by the NIH (R01AG21545, 2P50AG05144, R01AG21362, P30AG10161, and R01AG15819).

[14]

References [15] [1] J.J. Albers, J.H. Tollefson, G. Wolfbauer, R.E. Albright Jr., Cholesteryl ester transfer protein in human brain, Int. J. Clin. Lab. Res. 21 (1992) 264–266. [2] D.A. Bennett, R.S. Wilson, J.A. Schneider, D.A. Evans, L.A. Beckett, N.T. Aggarwal, L.L. Barnes, J.H. Fox, J. Bach, Natural history of mild cognitive impairment in older persons, Neurology 59 (2002) 198–205. [3] I. Bjorkhem, S. Meaney, Brain cholesterol: long secret life behind a barrier, Arterioscler. Thromb. Vasc. Biol. 24 (2004) 806– 815. [4] S.M. Boekholdt, J.A. Kuivenhoven, G.K. Hovingh, J.W. Jukema, J.J. Kastelein, A. Van Tol, CETP gene variation: relation to lipid parameters and cardiovascular risk, Curr. Opin. Lipidol. 15 (2004) 393–398. [5] J.D. Buxbaum, E.I. Cullen, L.T. Friedhoff, Pharmacological concentrations of the HMG-CoA reductase inhibitor lovastatin decrease the formation of the Alzheimer beta-amyloid peptide in vitro and in patients, Front. Biosci. 7 (2002) a50–a59. [6] N. Demeester, G. Castro, C. Desrumaux, C. De Geitere, J.C. Fruchart, P. Santens, E. Mulleners, S. Engelborghs, P.P. De Deyn, J. Vandekerckhove, M. Rosseneu, C. Labeur, Characterization and functional studies of lipoproteins, lipid transfer proteins, and lecithin:cholesterol acyltransferase in CSF of normal individuals and patients with Alzheimer’s disease, J. Lipid Res. 41 (2000) 963– 974. [7] L. Fidani, A. Goulas, R. Crook, R.C. Petersen, E. Tangalos, A. Kotsis, J. Hardy, An association study of the cholesteryl ester transfer protein TaqI B polymorphism with late onset Alzheimer’s disease, Neurosci. Lett. 357 (2004) 152–154. [8] R.K. Gopalraj, H. Zhu, J.F. Kelly, M. Mendiondo, J.F. Pulliam, D.A. Bennett, S. Estus, Genetic association of low density lipoprotein receptor and Alzheimer’s Disease, Neurobiol. Aging 26 (2005) 1–7. [9] J.E. Hixson, D.T. Vernier, Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with HhaI, J. Lipid Res. 31 (1990) 545–548. [10] A.H. Klerkx, M.W. Tanck, J.J. Kastelein, H.O. Molhuizen, J.W. Jukema, A.H. Zwinderman, J.A. Kuivenhoven, Haplotype analysis of the CETP gene: not TaqIB, but the closely linked –629C → A polymorphism and a novel promoter variant are independently associated with CETP concentration, Hum. Mol. Genet. 12 (2003) 111–123. [11] H. Knoblauch, A. Bauerfeind, C. Krahenbuhl, A. Daury, K. Rohde, S. Bejanin, L. Essioux, H. Schuster, F.C. Luft, J.G. Reich, Common haplotypes in five genes influence genetic variance of LDL and HDL cholesterol in the general population, Hum. Mol. Genet. 11 (2002) 1477–1485. [12] J.A. Kuivenhoven, J.W. Jukema, A.H. Zwinderman, P. de Knijff, R. McPherson, A.V. Bruschke, K.I. Lie, J.J. Kastelein, The Regression Growth Evaluation Statin Study Group, The role of a common variant of the cholesteryl ester transfer protein gene in the progression of coronary atherosclerosis., N. Engl. J. Med. 338 (1998) 86–93. [13] T. Kuusi, M.S. Nieminen, C. Ehnholm, H. Yki-Jarvinen, M. Valle, E.A. Nikkila, M.R. Taskinen, Apoprotein E polymorphism and coronary artery disease. Increased prevalence of apolipoprotein E-4

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

41

in angiographically verified coronary patients, Arteriosclerosis 9 (1989) 237–241. G. Li, R. Higdon, W.A. Kukull, E. Peskind, K. Van Valen Moore, D. Tsuang, G. van Belle, W. McCormick, J.D. Bowen, L. Teri, G.D. Schellenberg, E.B. Larson, Statin therapy and risk of dementia in the elderly: a community-based prospective cohort study, Neurology 63 (2004) 1624–1628. G. McKhann, D. Drachman, M. Folstein, R. Katzman, D. Price, E.M. Stadlan, Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s Disease, Neurology 34 (1984) 939–944. M. Miller, J. Rhyne, S. Hamlette, J. Birnbaum, A. Rodriguez, Genetics of HDL regulation in humans, Curr. Opin. Lipidol. 14 (2003) 273–279. D.T. Nash, Cardiovascular risk beyond LDL-C levels. Other lipids are performers in cholesterol story, Postgrad. Med. 116 (2004) 11–15. H.C. Oliveira, R.A. Chouinard, L.B. Agellon, C. Bruce, L. Ma, A. Walsh, J.L. Breslow, A.R. Tall, Human cholesteryl ester transfer protein gene proximal promoter contains dietary cholesterol positive responsive elements and mediates expression in small intestine and periphery while predominant liver and spleen expression is controlled by 5 -distal sequences. Cis-acting sequences mapped in transgenic mice, J. Biol. Chem. 271 (1996) 31831–31838. K.W. Park, J.H. Choi, H.K. Kim, S. Oh, I.H. Chae, H.S. Kim, B.H. Oh, M.M. Lee, Y.B. Park, Y.S. Choi, The association of cholesteryl ester transfer protein polymorphism with high-density lipoprotein cholesterol and coronary artery disease in Koreans, Clin. Genet. 63 (2003) 31–38. A. Rocchi, S. Pellegrini, G. Siciliano, L. Murri, Causative and susceptibility genes for Alzheimer’s disease: a review, Brain Res. Bull. 61 (2003) 1–24. A.M. Saunders, W.J. Strittmatter, D. Schmechel, P.H. GeorgeHyslop, M.A. Pericak-Vance, S.H. Joo, B.L. Rosi, J.F. Gusella, D.R. Crapper-MacLachlan, M.J. Alberts, Association of apolipoprotein E allele epsilon 4 with late-onset familial and sporadic Alzheimer’s disease, Neurology 43 (1993) 1467–1472. F.A. Schmitt, M.M. Wetherby, D.R. Wekstein, C.M. Dearth, W.R. Markesbery, Brain donation in normal aging: procedures, motivations, and donor characteristics from the Biologically Resilient Adults in Neurological Studies (BRAiNS) Project, Gerontologist 41 (2001) 716–722. S. Schneider, D. Roessli, L. Excoffier, Arlequin: a Software for Population Genetics Data Analysis, University of Geneva, Switzerland, 2000. D.L. Sparks, H. Liu, D.R. Gross, S.W. Scheff, Increased density of cortical apolipoprotein E immunoreactive neurons in rabbit brain after dietary administration of cholesterol, Neurosci. Lett. 187 (1995) 142–144. D.L. Sparks, S.W. Scheff, J.C. Hunsaker III, H. Liu, T. Landers, D.R. Gross, Induction of Alzheimer-like beta-amyloid immunoreactivity in the brains of rabbits with dietary cholesterol, Exp. Neurol. 126 (1994) 88–94. K.P. Townsend, D.R. Shytle, Y. Bai, N. San, J. Zeng, M. Freeman, T. Mori, F. Fernandez, D. Morgan, P. Sanberg, J. Tan, Lovastatin modulation of microglial activation via suppression of functional CD40 expression, J. Neurosci. Res. 78 (2004) 167. T. Yamada, M. Kawata, H. Arai, M. Fukasawa, K. Inoue, T. Sato, Astroglial localization of cholesteryl ester transfer protein in normal and Alzheimer’s disease brain tissues, Acta Neuropathol. (Berl.) 90 (1995) 633–636.