Lactobacillus casei and its byproducts alter the virulence factors of foodborne bacterial pathogens

Journal of Functional Foods 15 (2015) 418–428

Available online at www.sciencedirect.com

ScienceDirect j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / j ff

Lactobacillus casei and its byproducts alter the virulence factors of foodborne bacterial pathogens Mengfei Peng a, Geetika Reichmann b, Debabrata Biswas a,b,c,* a

Department of Cellular and Molecular Genetics, University of Maryland, College Park, MD 20742, USA Department of Animal and Avian Sciences, University of Maryland, College Park, MD 20742, USA c Center for Food Safety and Security Systems, University of Maryland, College Park, MD 20742, USA b

A R T I C L E

I N F O

A B S T R A C T

Article history:

Introduction of prebiotics and probiotics as daily food supplements is believed to be a prom-

Received 24 November 2014

ising way of controlling enteric or other chronic infections and improving gut health. In this

Received in revised form 25 March

study, the effects of Lactobacillus casei on growth and virulence properties of foodborne enteric

2015

bacterial pathogens enterohemorrhagic Escherichia coli EDL933, Salmonella Typhimurium LT2,

Accepted 27 March 2015

and Listeria monocytogenes LM2 were investigated. Mixed culture of L. casei with each of these

Available online

pathogens showed that L. casei could competitively exclude or inhibit the growth of pathogens by >99% within 48 h. Further investigation revealed that the antimicrobial byproducts

Keywords:

produced by L. casei in cocoa pre-treated cultural supernatant significantly reduced the growth,

Lactobacillus casei

increased the hydrophobicity values, blocked the interaction with human intestinal epi-

Cocoa

thelial cell (INT-407), and altered the virulence genes expression of these bacterial pathogens.

Foodborne pathogen

These results suggest the possibility of applying L. casei with cocoa in preventing/reducing

Pathogen–cell interaction

foodborne pathogen infections in gut environment.

Virulence gene

1.

Introduction

To colonize in the human gastrointestinal (GI) tract, all foodborne pathogens must compete with gut microflora specifically in the large intestine, where a huge amount of resident microbiota are colonized (Sullivan & Nord, 2002). Probiotic such as lactic acid bacteria (LAB) are known to play crucial roles in maintaining the microbial ecosystem of human GI tract by preventing colonization and infection of incoming bacterial pathogens (Campana, Federici, Ciandrini, & Baffone, 2012; Galdeano & Perdigon, 2006; Servin & Coconnier, 2003). Though the molecular basis has not been fully understood, possible mechanisms of the protection against pathogens by probiotics

© 2015 Elsevier Ltd. All rights reserved.

include stimulating innate and acquired immune response of human intestinal cell (Neeser et al., 2000; Reid & Burton, 2002), direct antimicrobial effects (Van de Guchte, Ehrlich, & Maguin, 2001), and competition in receptor mediated colonization to cell hosts (Sherman, Bennett, Hwang, Sherman, & Bevins, 2005). Moreover, Medellin-Pena, Wang, Johnson, Anand, and Griffiths (2007) hypothesized that intestinal bacteria in different genera may all use quorum sensing as regulatory system for the control of virulent genes of foodborne pathogens. They also found that secreted compounds of L. acidophilus inhibited the production of AI-2 molecules of EHEC O157 as well as altered flagella synthesis and motility of the pathogen. Therefore, it is possible that probiotics in the human intestine, particularly in the large intestine, influence the virulence gene expression of other

* Corresponding author. Department of Animal and Avian Sciences, Center for Food Safety and Security Systems, University of Maryland, College Park, MD 20742, USA. Tel.: +1 301 405 3791; fax: +1 301 405 7980. E-mail address: [email protected] (D. Biswas). http://dx.doi.org/10.1016/j.jff.2015.03.055 1756-4646/© 2015 Elsevier Ltd. All rights reserved.

Journal of Functional Foods 15 (2015) 418–428

non-resident bacteria through their quorum sensing system, and thus prevent the pathogenic bacterial infection by affecting or limiting bacterial motility, flagella assembly, specific protein synthesis and secretion, and other pathogenic mechanisms (Sperandio, Lin, & Kaper, 2002). Meanwhile, increased interests have been put on investigating the role of probiotic bacteria for maintaining human health and personal hygiene, including oral health, GI tract health and vaginal hygiene, as well as preventing wound infection during operation (Lin & Pan, 2014; Parvez, Malik, Ah Kang, & Kim, 2006; Wannun, Piwat, & Teanpaisan, 2014). These health promoting activities by LAB have been proposed to be associated with their growth inhibiting effect against human pathogens. Food spoilage-inducing bacterial pathogens such as Escherichia coli O157:H7 (EHEC), Salmonella, and Listeria monocytogenes cause not only numerous illnesses and death, but also huge economical loss (Centers for Disease Control and Prevention (CDC), 2013). Although commonly used synthetic antibiotics efficiently limit the growth of foodborne pathogens, growing numbers of antibiotic-resistance among those human pathogens have been documented (Andersson & Hughes, 2010; DeWaal & Grooters, 2013). However, recent research on LAB revealed their abilities of multiple antimicrobial production (Sharma & Saharan, 2014), which suggests the selection of certain Lactobacillus strains as promising biological preservatives against foodborne bacterial pathogens. Antimicrobial compounds produced by LAB include organic acids, hydrogen peroxide, diacetyl, short-chain fatty acids, small peptide inhibitors, bacteriocins, and bio-surfactants, among which bacteriocins have been recognized as the most potent agent (Miao et al., 2014; Sharma & Saharan, 2014). Nisin for example, produced by Lactococcus lactis, has been approved by the US Food and Drug Administration (FDA) since last decade for food preservation and shelf life extension (Collins, Caitriona, Guinane, & Cotter, 2012). The most common application of Lactobacillus casei, the resident bacteria in human intestine and mouth, is for dairy production such as yogurt, cheese, and ice cream. Recently, an extensive study has been focused on the use of L. casei in preventing antibiotic-associated diarrhea and Clostridium difficile infections (McFarland, 2009). In addition, L. casei has been suggested to be effective in alleviating gastrointestinal pathogenic bacterial infections both in vitro and in vivo (Chung & Yousef, 2010; Forestier, De Champs, Vatoux, & Joly, 2001; Wong et al., 2013), and there is no evidence of any pathogenic behavior on human and animals. Furthermore, our previous study also suggested that potential components (disaccharides and indoles) in cocoa powder could stimulate the growth of L. casei in both de Man–Rogosa–Sharpe (MRS) broth and milk media (Peng, Aryal, Cooper, & Biswas, 2015). Based on the latent beneficial properties reported previously, we aimed to examine the combined growth inhibitory effect of L. casei and cocoa on common foodborne pathogens and to investigate the capacities of this probiotic strain combined with prebiotic-like cocoa in reducing host cell (INT-407) and pathogen interactions at cellular level. In addition, for better understanding of the reduced host cell–pathogen interactions, investigation of their role on expression of foodborne bacterial virulent genes related to flagellation, motility, and cell-specific binding is included as well.

2.

Materials and methods

2.1.

Bacterial strains and growth conditions

419

L. casei (ATCC 334) was grown on de Man–Rogosa–Sharpe (MRS) agar overnight at 37 °C under aerobic condition with 5% CO2 (Thermo Fisher Scientific Inc., Waltham, MA, USA). Three foodborne bacterial pathogens Enterohemorrhagic E. coli (EHEC) EDL933 (ATCC700927), Salmonella enterica serovar Typhimurium LT2 (ATCC19585), and L. monocytogenes LM2 (ATCC19115) were grown on MacConkey agar, Luria-Bertani (LB) agar, and BrainHeart Infusion (BHI) agar (EMD Chemicals Inc., Gibbstown, NJ, USA), respectively, overnight at 37 °C under aerobic conditions (Thermo Fisher Scientific).

2.2.

Cell lines and culture conditions

Human intestinal epithelium cell line (INT-407 CCL-6) was purchased from American Type Culture Collection and cultured following the method described by Peng, Bitsko, and Biswas (2015) with slight modification. Briefly, cells were grown at standard condition (37 °C, 5% CO2, 95% humidity) in Dulbecco’s modified Eagle medium (DMEM; HyClone Laboratories Inc., Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS) and 100 µg/mL gentamicin. The cultured cells were seeded at approximately 2 × 105 cells/mL into 24-well tissue culture plates (BD Falcon, Franklin Lakes, NJ, USA) to reach 80–90% confluence monolayer at standard condition. The post-confluent INT-407 epithelial cell monolayers were rinsed with phosphate buffer saline buffer (PBS) and stabilized in antibioticfree DMEM for 1 h prior to the invasion assay.

2.3.

Cocoa powder preparation

Cocoa powder was prepared based on a previous method (Peng, Aryal et al., 2015). Briefly, commercial non-alkali treated cocoa was purchased at the local supermarket (Giant, College Park, MD, USA). Cocoa powder was defatted by using hexane (SigmaAldrich, St. Louis, MO, USA) for 18 h following the method described by Miller et al. (2008) with slight modification. The defatted cocoa was stored at 4 °C and sterilized 2 h under ultraviolet light before experimental use.

2.4.

Mixed culture of L. casei with foodborne pathogens

L. casei, EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 bacterial cells were collected from overnight agar plate culture. A volume of 400 µL L. casei bacterial suspension containing 107 colony forming units (CFUs)/mL was mix-cultured with same amount of EHEC EDL933, S. Typhimurium LT2, or L. monocytogenes LM2, respectively, in 3.6 mL LB/MRS (1:1, v/v) broth in the presence or absence of 3% cocoa powder at 37 °C under aerobic condition. Serial dilutions were performed in PBS, followed by plating on MRS agar (L. casei), MacConkey agar (EHEC EDL933), Xylose Lysine Deoxycholate (XLD) agar (S. Typhimurium LT2), and Oxford Listeria agar base (L. monocytogenes LM2) at 0, 12, 24, 36, and 48 h time points.

420

Journal of Functional Foods 15 (2015) 418–428

2.5. Assay of cell free culture supernatant (CFCS) of L. casei on growth of foodborne pathogens Fresh overnight (18 h) liquid cultures of L. casei in MRS with or without 3% cocoa were centrifuged at 4000 × g for 20 min. Cell free culture supernatants (CFCSs) were collected and filtered by sterile syringe 0.2 µm filter (VWR). Filtered CFCS from L. casei (CFCS1) and filtered CFCS from cocoa supplemented L. casei (CFCS2) were collected and stored at 4 °C. A cell suspension (400 µL) containing 10 7 CFU/mL of EHEC EDL933, S. Typhimurium LT2, or L. monocytogenes LM2 was inoculated in separate culture tubes with 3.6 mL LB/MRS broth (1:1, v/v), LB/MRS broth (1:1, v/v) with 3% (w/v) cocoa powder, LB/CFCS1 (1:1, v/v), or LB/CFCS2 (1:1, v/v), respectively and cultured at 37 °C under aerobic condition. Serial dilutions were performed in PBS, followed by plating on specific agars mentioned above for different pathogens at 0, 4, 8, 24, and 48 h time points.

2.6.

CFCS sensitivity to pH, heat, and enzymes

The pH of CFCS was adjusted from 4.87 either to 1.0, 2.0, 3.0, and 4.0 with 10 M HCl or to 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 with 10 M NaOH measured by FiveEasy™ pH meter (Mettler Toledo, Columbia, MD, USA). After overnight incubation at 4 °C, all pH were adjusted back to 4.87 for further assay. Thermal treatment of CFCS was conducted by incubating CFCS at 40, 60, 80, or 100 °C in a water bath (Isotemp, Thermo Fisher Scientific) for 30 min, and then cooled down at room temperature (25 °C) for further assay. Enzymatic treatments on CFCS were conducted at original pH value (4.87) by using of catalase (25 °C), proteinase K (50 °C), and/or trypsin (25 °C) (Sigma-Aldrich) at a final enzyme concentration of 1 mg/mL. EHEC EDL933 was used as indicator strain for multiple antimicrobial activity tests. The minimum inhibitory concentration (MIC) was evaluated using broth micro-dilution method described previously (Nkanwen, Gatsing, Ngamga, Fodouop, & Tane, 2009). Briefly, CFCS ranging from 1:1 to 1:128 dilutions in LB broth were used as medium for growth of bacteria. An aliquot of 2 µL of bacterial suspension containing approximately 107 CFU/mL was added into 198 µL medium in 96-well plate (Greiner Bio-One Inc., Monroe, NC, USA). The plate was incubated for 24 h at 37 °C under aerobic conditions. MIC was determined as the lowest dilution of CFCS that prevented visible growth of EHEC EDL933 compared with control, and it was recorded in the form of arbitrary unit per mL (AU/mL).

2.7.

Cell adhesion and invasion assay

We performed the adherence and invasion assays following the methods described previously by Peng, Bitsko et al. (2015) with some modification. Briefly, the INT407 cells grown in 24-well plate with 800 µL DMEM containing 10% FBS were pretreated with 100 µL DMEM (control), 3% cocoa, 2 × 106 CFU/mL L. casei, CFCS1, or CFCS2 separately for 1 h, with each treatment in triplicate. A 100 µL aliquot of EHEC EDL933, S. Typhimurium LT2, or L. monocytogenes LM2 with multiplicity of infection of about 10 (2 × 106 CFU/mL) were inoculated into triplicate wells. Infected cells were incubated at standard condition for 2 h, and washed three times with DMEM containing 10% FBS.The monolayers were lysed by 0.1% Triton X-100 for 15 min,

serial diluted, and plated on specific agars for adhesive bacterial CFU counting. Cell invasive activity was measured by further 1 h incubation of the washed monolayers in DMEM containing 10% FBS and 100 µg/mL gentamicin followed by threetimes washing, Triton X-100 lysis, serial dilution, and plating on specific agars.

2.8. Evaluation of hydrophobicity of foodborne pathogens treated with CFCSs Cell surface hydrophobicity was determined in accordance with the methods described previously (Ahn, Almario, Salaheen, & Biswas, 2014; Salaheen, Almario, & Biswas, 2014) with some modification. Briefly, EHEC EDL933, S. Typhimurium LT2, or L. monocytogenes LM2 was cultured overnight (18 h) in 5 mL LB broth, and treated with equal volume (5 mL) of LB broth, MRS broth, CFCS1, and CFCS2 separately for 4 h at 37 °C under aerobic condition. Cells were collected and re-suspended in pH 7.4 PBS to adjust the optical density (OD) to 0.5 (Ht0) under 570 nm wavelength. One volume cell suspension was mixed with 2 volumes of n-hexadecane (Sigma-Aldrich), vigorously vortexed, and incubated at room temperature for 5 min. The aqueous phase was collected and the OD (Ht5) was measured at 570 nm by microplate reader (Multiskan FC, Thermo Scientific Inc., Odessa, TX, USA). The hydrophobicity value was calculated by the equation: Hydrophobicity (%) = (1 − Ht5/Ht0) × 100.

2.9.

RNA extraction and cDNA synthesis

The bacterial cell suspensions were rinsed three times with 5 mL ice-cold PBS. The cell pellets were lysed with 1 mL TRIzol reagent (Life Technologies Co., Carlsbad, CA, USA) for 5 min at room temperature. The cell lysates were mixed with 200 µL chloroform, vortexed vigorously, and then kept at room temperature for 3 min. After centrifugation at 13,000 × g for 15 min at 4 °C, the aqueous phase was collected and gently mixed with 500 µL of isopropanol, allowed to stand for 10 min at room temperature, and then centrifuged at 13,000 × g for 15 min at 4 °C. The gel-like RNA pellet was washed with 1 mL 75% ethanol, vortexed 10 s, centrifuged at 7000 × g for 5 min at 4 °C, and then airdried in bio-safety cabinet for 10 min to remove the remaining ethanol. The RNA pellet was dissolved in 50 µL RNase-free water and quantified using a NanoDrop spectrophotometer (Thermo Fisher Scientific). Amount of 1 µg of extracted RNA was mixed with 1 µL of RTS DNase and 5 µL of DNase buffer (MO BOI Laboratories, Inc., Carlsbad, CA, USA) and incubated at 37 °C for 20 min to remove genomic DNA. Then 5 µL RTS DNase Removal Resin was added and re-suspended every 1 min up to 10 min to remove DNase. Supernatant containing RNA was transferred after 13,000 × g centrifugation for 1 min. The synthesis of cDNA was performed according to the qScript cDNA SuperMix protocol (Quanta Biosciences, Gaithersburg, MD, USA). The extracted RNA (1 µg) was mixed with qScript cDNA SuperMix (containing optimized concentrations of MgCl2, deoxyribonucleotide triphosphates, qScript reverse transcriptase, and RNase inhibitor protein). The reaction mixture was incubated subsequently at 25 °C for 5 min, 42 °C for 30 min, and 85 °C for 5 min.

Journal of Functional Foods 15 (2015) 418–428

421

Table 1 – Primers used in real-time RT-PCR analysis. Bacteria

Gene

Primer sequence

EHEC

tufA (Housekeeping gene)

F: ACTTCCCGGGCGACGACACTC R: CGCCCGGCATTACCATCTCTAC F: CCCGAATTCGGCACAAGCATAAGC R: CCCGAATCCGTCTCGCCAGTATTCG F: TACCATCGCAAAAGCAACTCC R: GTCGGCAACGTTAGTGATACC F: ACTTCCAGCCTTCGTTCAGA R: TTCTGGAACGCTTCTTTCGT F: CAGAAGAAGCACCGGCTAAC R: AATGCAGTTCCCAGGTTGAG F: GCAGATGACGGTACATCCAA R: CCAGATCAGGCTGTGCTTTA F: ATGAAGATCACGGTGGAAGG R: TTGCTCTGACGCTCAATGTC F: TTCTGGCTGTCGATAATCTGG R: GGATGGAGCAGAGTTCGCTTA F: TGCCACCTACCGTAACACTG R: CTCATACGTTGCGGACAGAC F: TTAGCTAGTTGGTAGGGT R: AATCCGGACAACGCTTGC F: ATGAAAGTAAATACTAATATC R: TTAGCTGTTAATTAATTGAGT F: ATGCAAACAAAATTGCACTG R: GAATTCGCCGACAACTTACT F: GAATGTAAACTTCGGCGCAATCAG R: GCCGTCGATGATTTGAACTTCATC

eaeA fliC tir S. Typhimurium

16S rRNA (Housekeeping gene) fliC fliD motB nmpC

L. monocytogenes

16S rRNA (Housekeeping gene) flaA fbp iap

2.10.

Quantitative RT-PCR assay

The PCR reaction mixture containing 10 µL of PerfeCTa SYBR Green FastMix, 2 µL of each primer (100 nM), 2 µL of cDNA (10 ng), and 4 µL of RNase-free water were amplified using an Eco Real-Time PCR system (Illumine, San Diego, CA, USA) with 30 s denaturation at 95 °C, followed by 40 cycles of 95 °C for 5 s, 55 °C for 15 s, and 72 °C for 10 s. The custom-synthesized oligonucleotide primers (Erofins MWG Operon, Huntsville, AL, USA) for EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 are summarized in Table 1. The relative transcription levels of target genes were estimated by the comparative fold change. The CT values of target genes in treated bacterial cells were compared to those in untreated bacterial cells and normalized to the housekeeping gene.

2.11.

Statistical analysis

Data were analyzed by the Statistical Analysis System software (SAS). The one-way analysis of variance (ANOVA) for each single time point followed by Tukey’s test was used to evaluate the treatments and determine the significant differences among control and treatments based on significant level of 0.05.

3.

Results

3.1. Competitively exclusion of foodborne pathogens in mixed culture To determine the effect of probiotic and its byproducts on the growth of enteric bacterial pathogens, we co-cultured EHEC EDL933, S. Typhimurium LT2, or L. monocytogenes LM2 with L. casei

in medium to support the growth of both bacteria. In this cocultured or mixed culture condition, the growth of L. casei was only promoted slightly at a negligible level (p < 0.05) (Fig. 1). In the same study, we found the growth of each of these bacterial pathogens drastically inhibited in the presence of L. casei (Fig. 1). Two pathogens EHEC EDL933 and S. Typhimurium LT2 were completely excluded from the cultural medium by L. casei at 48 and 36 h, respectively (Fig. 1A and B). Growth of L. monocytogenes LM2 was also reduced by 5.26 log CFU/mL at 48 h (Fig. 1C).

3.2. Effect of CFCS on growth inhibition of foodborne enteric pathogens Both CFCS1 and CFCS2 showed growth inhibitory effects on EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 in a dose-dependent manner based on the amount of L. casei cells inoculated for collecting CFCSs. CFCS1 (pH = 4.87) and CFCS2 (pH = 5.24), obtained from overnight culture started with the initial inocula of 106 CFU/mL (OD 0.1) and ended with 2 × 109 CFU/mL (CFCS1) and 1010 CFU/mL (CFCS2) final concentration of L. casei overnight inoculation, reduced 3.27 and 4.73 log CFU/mL EHEC EDL933 (Fig. 2A), 4.31 and 5.12 log CFU/mL S.Typhimurium LT2 (Fig. 2B), 3.16 and 4.33 log CFU/mL L. monocytogenes LM2 (Fig. 2C), respectively, at 48 h, compared with control in LB/MRS (1:1, v/v). In the same study, CFCS1 (pH = 4.61) and CFCS2 (pH = 5.12), collected from the overnight culture started with initial inocula of 107 CFU/mL (OD 1.0) and ended with 5 × 109 CFU/mL (CFCS1) and 3 × 1010 CFU/mL (CFCS2) final concentration of L. casei, showed higher antimicrobial effects on the growth of all three enteric foodborne bacterial pathogens and both CFCS1 and CFCS2 were able to exclude all three foodborne pathogens within 48 h (Fig. 2). However, 3% cocoa only exhibited significant

422

Journal of Functional Foods 15 (2015) 418–428

Fig. 1 – Comparison in growth conditions of both L. casei and foodborne pathogens including EHEC EDL933 (A), S. Typhimurium LT2 (B), and L. monocytogenes LM2 (C) between single and mixed culture at 0, 12, 24, 36, and 48 h. Error bars indicate standard deviation from 6 parallel trails. Asterisks (*) at each time point indicate the significant growth in mixed culture when compared with single culture as a control at p < 0.05.

inhibitory effect on growth of EHEC EDL933 and S.Typhimurium LT2 within short time period (0.82 log CFU/mL EHEC reduction at 4 h, 0.70 log CFU/mL EHEC EDL933 reduction at 8 h, and 0.70 log CFU/mL ST at 4 h).

Table 2 – Effects of pH, heat treatment, and enzyme on cell-free cultural supernatant from L. casei. Treatment

Antimicrobial activity

pH = 4.87 25 °C pH 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0 10.0 Heat (°C) 40 60 80 100 Enzyme Catalase (1.0 mg/mL) Proteinase K Trypsin Catalase + Proteinase K Catalase + Trypsin Proteinase K + Trypsin Catalase + Proteinase K + Trypsin

++

Control

++: Antimicrobial activity >50 AU/mL. +: Antimicrobial activity >5 AU/mL. −: Non-detected antimicrobial activity.

++ ++ ++ ++ ++ + + + − − ++ ++ + + + + + − − + −

3.3.

Characterization of CFCS antimicrobial activity

The effects of pH, heat, and enzyme treatments on antimicrobial activity of CFCS are summarized in Table 2. Original collected CFCS with pH value of 4.87 at room temperature (25 °C) (control) exhibited strong (>50 AU/mL) antimicrobial activity on EHEC. HCl treatment on CFCS maintained its antimicrobial activity, whereas NaOH treatment reduced the antimicrobial activity of CFCS. CFCS showed moderate (>5 AU/mL) antimicrobial activity when first adjusted to pH from 6.0 to 8.0 for incubation and then converted back to pH 4.87, whereas no antimicrobial property was detected when pH value first adjusted higher than 9.0. CFCS remained its strong (>50 AU/mL) antimicrobial activity with 30 min incubation at both 40 and 60 °C. However, when the thermal treatment increased to 80 and 100 °C, antimicrobial activity of CFCS was reduced to moderate (>5 AU/mL). Moreover, three kinds of enzymatic treatments (catalase, proteinase K, and trypsin) on CFCS all decreased its antimicrobial activity but remained within detectable level (>5 AU/mL). Combined enzymatic treatments of catalase and protease(s) further reduced the antimicrobial activity of CFCS to non-detectable level.

3.4.

Reduction in pathogen–host cell interactions

Pre-treatment with 3% cocoa, L. casei cells, CFCS1, and CFCS2 reduced the pathogenic cell adhesive and invasive activities of three enteric bacterial pathogens (Fig. 3). In this study, we observed that 3% cocoa reduced the adherence and invasive abilities of EHEC EDL933 by 77.58 and 97.23%, S. Typhimurium LT2 by 93.41 and 100%, and L. monocytogenes LM2 by 37.41 and 100%, respectively. In the same study, we found that

Journal of Functional Foods 15 (2015) 418–428

423

Fig. 2 – Inhibitory effects of cell-free cultural supernatants from L. casei on growth of EHEC EDL933 (A), S. Typhimurium LT2 (B), and L. monocytogenes LM2 (C) at 0, 4, 8, 24, and 48 h. Error bars indicate standard deviation from 6 parallel trails. Bars with different letters (a through d) at single time period within each strain are significantly different at p < 0.05.

pre-treatment with L. casei cells could also competitively inhibit the pathogen–host cell interactions. For EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2, 62.12, 68.51, and 58.53% of cell-adhesive activities as well as 77.50, 93.97, and 79.85% of cell-invasive activities were reduced. Likewise, CFCS1 significantly inhibited adhesion abilities of three foodborne pathogens (56.40% for EHEC EDL933, 85.28% for S. Typhimurium LT2, and 24.11% for L. monocytogenes LM2) and invasion abilities

of S. Typhimurium LT2 (92.25%) and L. monocytogenes LM2 (95.86%). Furthermore, CFCS2 showed more intensive effect compared with CFCS1, in which adhesion abilities of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 were reduced by 80.81, 97.35, and 30.47%, respectively. We also found that in the presence CFCS2, invasion abilities of EHEC EDL933, S. Typhimurium LT2 and L. monocytogenes LM2 were reduced by 98.98, 100, and 100%, respectively.

424

Journal of Functional Foods 15 (2015) 418–428

Fig. 3 – Cell adhesion (A, C, and E) and invasion (B, D, and F) levels of EHEC EDL933 (A and B), S. Typhimurium LT2 (C and D), and L. monocytogenes LM2 (E and F) to INT407 cells with pre-treatment of 3% cocoa, L. casei bacterial cells, and cell-free cultural supernatants of L. casei. A constant multiplicity of infection = 10 is applied in each sub-figure. Error bars indicate standard deviation from 6 parallel trails. Bars with different letters (a through d) within each pathogen are significantly different at p < 0.05.

3.5.

Alteration of bacterial cell surface hydrophobicity

In the presence of 3% cocoa, CFCS1, and CFCS2, the cell surface hydrophobicity values of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 were decreased significantly (Table 3).In comparison with control, L. monocytogenes LM2 cells treated with 3% cocoa significantly reduced the cell surface hydrophobicity value by 28.50%, whereas no significant change in EHEC EDL933 and S. Typhimurium LT2 was observed. In the same study, EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 cells treated with CFCS1 showed significant reduction of cell surface hydrophobicity by 55.63, 52.06, and 55.72% folds, respectively;

Table 3 – Cell surface hydrophobicity values of foodborne pathogens.* Treatment Bacteria EHEC Control 3% Cocoa CFCS1 CFCS2

S. Typhimurium L. monocytogenes

6.099 ± 0.634 5.392 ± 0.666a 2.706 ± 0.592b 1.243 ± 0.578c a

5.603 ± 1.455a 4.260 ± 1.394a,b 2.686 ± 0.338b 1.440 ± 0.534b,c

6.962 ± 1.539a 4.978 ± 0.474b 3.083 ± 0.678c 1.506 ± 0.618d

Values with different superscript letters (a–c) within an individual column are significantly different at p < 0.05. * Data in the table represent ‘mean ± standard deviation’ of triplicate.

Journal of Functional Foods 15 (2015) 418–428

425

similarly, EHEC EDL933, S. Typhimurium LT2, and L. monocytogenesLM2 cells with CFCS2 treatment decreased the hydrophobicity values much effectively by 79.62, 74.30, and 78.37% folds, respectively.

3.6.

Effects on virulent gene expression

To further investigate the effects of 3% cocoa, L. casei CFCS1, and L. casei CFCS2 on each of these enteric bacterial pathogens (EHEC EDL933, S. Typhimurium LT2, or L. monocytogenes LM2) and host intestinal epithelial INT-407 cell interactions, the relative expression levels of major virulent genes related to attachment and invasion were determined using qRT-PCR (Fig. 4). Fold-change of EHEC EDL933 virulence genes were shown in Fig. 4A. In the presence of 3% cocoa, CFCS1, and CFCS2 significantly reduced the relative expression level of eaeA gene by 1.68, 1.79, and 4.57-fold, respectively. In the same study, relative expression level of fliC gene of EHEC EDL933 were upregulated by 3% cocoa (6.89-fold), CFCS1 (7.95-fold), and CFCS2 (8.25-fold). Whereas compared with control, the relative expression level of tir gene in EHEC EDL933 showed no significant fold change when treated by cocoa or CFCSs. For S. Typhimurium LT2 (Fig. 4B), in the presence of 3% cocoa, CFCS1, and CFCS2, significant down-regulation of the relative expression level of nmpC gene by 3.31, 100.75, and 28.57-fold, respectively, was found. Meanwhile, fliC gene was up-regulated by 2.00, 2.54, and 7.61-fold by 3% cocoa, CFCS1, and CFCS2, respectively. When compared with control, expression level of fliD gene was only increased by CFCS1 (1.97-fold) and CFCS2 (4.38-fold), whereas expression level of motB gene was increased by 3% cocoa (1.61-fold) and CFCS2 (4.68-fold), respectively. Fold-change of L. monocytogenes LM2 virulence genes were shown in Fig. 4C. The expression level of fbp gene was reduced significantly by 3% cocoa (1.49-fold), CFCS1 (3.73-fold), and CFCS2 (6.13-fold). Meanwhile treatment of 3% cocoa, CFCS1, and CFCS2 also significantly up-regulated the relative expression level of flaA gene of L. monocytogenes LM2 by 1.61, 2.97, and 5.24-fold, respectively. Additionally, the expression level of iap gene in L. monocytogenes LM2 was also decreased by CFCS1 (5.49-fold) and CFCS2 (11.36-fold), but no significant change was found by cocoa treatment.

4.

Discussion

Probiotics can be found in various different foods as supplement, and they are believed to play very important roles in regulation of proper intestinal function, digestion by balancing intestinal microflora, and disease progressions including growth inhibition of bacterial pathogens to various degrees (Anas, Eddine, & Mebrouk, 2008; Coman et al., 2014; Rodriguez et al., 2012). In consistence with previous studies, we observed the antimicrobial property of L. casei against EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 in mixed cultures. In order to test our hypothesis that the antimicrobial activity of L. casei comes from its produced metabolites or byproducts, we further investigated the effects of CFCS collected from overnight culture of L. casei on growth of three foodborne pathogens. In agreement with former researchers

Fig. 4 – Relative expression of multiple virulence genes from EHEC EDL933 (A), S. Typhimurium LT2 (B), and L. monocytogenes LM2 (C) when treated with 3% cocoa and cell-free cultural supernatants from L. casei. The relative transcription levels of target genes are shown in the form of comparative fold change with gene expression in control being 1. Error bars indicate standard deviation from 6 parallel trails. Bars with different letters (a through d) are significantly different among treatments and control at p < 0.05.

(Coconnier, Lievin, Bernet-Camard, Hudault, & Servin, 1997), we found that CFCS of L. casei inhibited the growth of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 strains. Additionally, we observed that 3% supplemented medium could stimulate the growth and increase the amount of byproducts of L. casei (Peng, Aryal et al., 2015) and 3% cocoa containing CFCS (CFCS2) exhibited stronger inhibitory effects on multiple foodborne bacterial pathogens. This study also indicated that the intensive antimicrobial effects of CFCSs depended

426

Journal of Functional Foods 15 (2015) 418–428

on the amount of metabolites/byproducts L. casei produced overnight in the medium. To characterize the CFCS’s activity, CFCS of L. casei with pH, temperature, and enzymatic treatments on growth of EHEC was also examined. We detected attenuated antimicrobial property of CFCS at high pH treatment condition, which revealed the crucial role of the ionic state of lactic acids produced and secreted by L. casei in exclusion of foodborne pathogens in acidic conditions (Adams & Hall, 2007; Gyawali & Ibrahim, 2012; Salaheen, White, Bequette, & Biswas, 2014). Discounted antimicrobial activity of CFCS processed by high temperature (80 and 100 °C) as well as enzyme (catalase, proteinase K, or trypsin) treatments indicated that in spite of lactic acids, hydrogen peroxide and antimicrobial polypeptides in CFCS also contribute to antimicrobial activity (Atassi & Servin, 2010; Wannun et al., 2014; Xu et al., 2008). Simultaneously, combined enzymatic treatments with catalase + proteinase K, catalase + trypsin, and catalase + proteinase K + trypsin showed the minimum or no antimicrobial activity, which further proved the synergistic antimicrobial effects of hydrogen peroxide and antimicrobial polypeptides in CFCS. To investigate the role of L. casei cells in co-culture condition and CFCSs on pathogen–host INT-407 cell interactions, we examined their inhibitory effects on cell adhesive and invasive activities, cell surface hydrophobicity, and cell attachmentrelated gene expression of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 strains. Both pre-treatment of L. casei cells and CFCSs significantly reduced the cell adhesion and invasion abilities of three pathogens, which is in agreement with previous studies on anti-adherence properties of Lactobacillus strains against multiple bacterial pathogens (Bendali, Hebraud, & Sadoun, 2014; Campana et al., 2012; Spurbeck & Arvidson, 2010; Tuomola, Ouwehand, & Salminen, 1999). By sharing similar carbohydrate-binding specificities displayed by cell surface proteins, L. casei is hypothesized to decrease the adhesive and invasive activities of pathogens by preoccupying the surface receptors on INT407 cells (Jean-Richard et al., 2000; Salaheen, White et al., 2014). Furthermore, antioxidant containing products like cocoa is known to block the level of host cell–pathogen interactions especially bacterial invasion abilities by inhibiting inflammatory responses in intestinal epithelial cells (Kim et al., 2010; Peng, Aryal et al., 2015). In thisstudy, CFCS2 combined the capabilities of both CFCS1 and antioxidants-rich cocoa and exhibited the most intensive properties on limiting pathogen–cell interactions. Additionally, Saran, Bisht, Singh, and Teotia (2012) demonstrated the positive correlation between bacterial cell surface hydrophobicity and cell attachment activities. Therefore, the noticeable reduction in cell surface hydrophobicity of three foodborne pathogens with CFCS treatments could be another identical indicator of their attenuated adhesion activities on human gastro-intestinal cells in this study. We assessed the relative expression levels of multiple virulence genes of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 strains, which are summarized in Table 1. Based on our findings, with the exception of tir (EHEC intimin translocation) gene, all genes for specific cell attachment and infection including eaeA (EHEC intimin adherence protein synthesis), fbp (L. monocytogenes fibronectin-binding-protein synthesis), and iap (L. monocytogenes invasion-associated protein

synthesis) were negatively affected by CFCSs. The significant down-regulations of these genes, in supporting previous studies (Dowd, Killinger-Mann, Blanton, San Francisco, & Brashears, 2007; Medellin-Pena et al., 2007), somehow provide us an explanation for the reduced cell adhesion and invasion abilities. A significant increase (4–8 folds) in relative expression of all flagellin synthesis and bacterial motility associated genes (fliC, fliD, flaA, and motB) were detected when the bacterial cells were pretreated with CFCS2. Generally, flagella ensure bacterial motility and are involved in their initial interaction with intestinal cells of the host (La Ragione, Cooley, Velge, Jepson, & Woodward, 2003). It is likely that the observed up-regulation of flagella/ motility associated genes would be correlated with emergent flagellin synthesis and flagella production in response to induced stress in the presence of multiple antimicrobial components (peroxide, polypeptides, phenolic compounds, flavonoids and many other) containing CFCS2. This result agrees with previous study that under stressed condition, survival strategy such as up-regulating flagellar biosynthesis and motility will be induced by bacterial pathogens (Bradley, Beach, de Koning, Pratt, & Osuna, 2007; Salaheen, Nguyen, Hewes, & Biswas, 2014). The mechanism behind up-regulation of flagella/ motility associated genes remains unknown, but these differentially transcribed genes contribute to the pathogenesis of foodborne pathogens, especially bacterial motility and initial host cell attachment, as response to the attenuated specific cell surface binding activities. Finally, it is of note that significant down-regulation of nmpC gene (encodes Salmonella outer membrane-associated protein) is associated with bacterial membrane disruption and increased permeability.

5.

Conclusion

The stimulation of L. casei growth and abundance of natural food or drink supplement in gastrointestinal tract is a potential way of controlling foodborne bacterial enteric pathogens. Our finding suggests that: (1) by secreting or producing antimicrobial byproducts including lactic acids, hydrogen peroxide, and polypeptides, L. casei effectively inhibit the growth of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2; (2) L. casei could reduce the adherence and invasion abilities of EHEC EDL933, S. Typhimurium LT2, and L. monocytogenes LM2 strains by either competitively occupying the cell surface receptors or producing antioxidants; (3) the expression of host colonizationassociated genes could be altered in the presence of CFCS; and (4) cocoa exerted prebiotic-like effects on L. casei, which induced more intensive antimicrobial effects on these enteric bacterial pathogens. However, further studies are needed to quantify the cocoa-stimulated antimicrobial byproducts of L. casei in CFCS2, and to investigate the interaction between CFCSs and bacterial pathogens at both cellular and molecular levels.

Acknowledgment This work was supported by the start-up package of Dr. Debabrata Biswas (#2-93108), Department of Animal and Avian Sciences, University of Maryland – College Park.

Journal of Functional Foods 15 (2015) 418–428

REFERENCES

Adams, M. R., & Hall, C. J. (2007). Growth inhibition of food-borne pathogens by lactic and acetic acids and their mixtures. International Journal of Food Science and Technology, 23(3), 287– 292. Ahn, J., Almario, J. A., Salaheen, S., & Biswas, D. (2014). Physicochemical, mechanical, and molecular properties of nonlysogenic and P22-lysogenic Salmonella Typhimurium treated with citrus oil. Journal of Food Protection, 77(5), 758–764. Anas, M., Eddine, H. J., & Mebrouk, K. (2008). Antimicrobial activity of Lactobacillus species isolated from Algerian raw goat’s milk against Staphylococcus aureus. World Journal of Dairy & Food Sciences, 3(2), 39–49. Andersson, D. I., & Hughes, D. (2010). Antibiotic resistance and its cost: Is it possible to reverse resistance? Nature Reviews. Microbiology, 8(4), 260–271. Atassi, F., & Servin, A. L. (2010). Individual and co-operative roles of lactic acid and hydrogen peroxide in the killing activity of enteric strain Lactobacillus johnsonii NCC933 and vaginal strain Lactobacillus gasseri KS120.1 against enteric, uropathogenic and vaginosis-associated pathogens. FEMS Microbiology Letters, 304(1), 29–38. Bendali, F., Hebraud, M., & Sadoun, D. (2014). Anti-bacterial and anti-adherence activities of a probiotic strain of Lactobacillus paracasei against Listeria monocytogenes. International Journal of Applied Microbiology and Biotechnology Research, 2, 52–63. Bradley, M. D., Beach, M. B., de Koning, A. P., Pratt, T. S., & Osuna, R. (2007). Effects of Fis on Escherichia coli gene expression during different growth stages. Microbiology (Reading, England), 153(9), 2922–2940. Campana, R., Federici, S., Ciandrini, E., & Baffone, W. (2012). Antagonistic activity of Lactobacillus acidophilus ATCC 4356 on the growth and adhesion/invasion characteristics of human Campylobacter jejuni. Current Microbiology, 64, 371–378. Centers for Disease Control and Prevention (CDC) (2013). Incidence and trends of infection with pathogens transmitted commonly through food – Foodborne diseases active surveillance network, 10 U.S. sites, 1996–2012. Morbidity and Mortality Weekly Report, 62(15), 283–287. Chung, H., & Yousef, A. E. (2010). Synergistic effect of high pressure processing and Lactobacillus casei antimicrobial activity against pressure resistant Listeria monocytogenes. New Biotechnology, 27(4), 403–408. Coconnier, M., Lievin, V., Bernet-Camard, M., Hudault, S., & Servin, A. L. (1997). Antibacterial effect of the adhering human Lactobacillus acidophilus strain LB. Antimicrobial Agents and Chemotherapy, 41(5), 1046–1052. Collins, B., Caitriona, M., Guinane, P. D., & Cotter, C. H. (2012). Assessing the contributions of the LiaS histidine kinase to the innate resistance of Listeria monocytogenes to nisin, cephalosporins, and disinfectants. Applied and Environmental Microbiology, 78(8), 2923–2929. Coman, M. M., Verdenelli, M. C., Cecchini, C., Silvi, S., Orpianesi, C., Boyko, N., & Cresci, A. (2014). In vitro evaluation of antimicrobial activity of Lactobacillus rhamnosus IMC 501, Lactobacillus Paracasei IMC 502 and SYNBIO against pathogens. Journal of Applied Microbiology, 117, 518–527. DeWaal, J. D., & Grooters, S. V. (2013). The food safety modernization act – A series on what is essential for a food professional to know. Center for Science in the Public Interest White Paper. Dowd, S. E., Killinger-Mann, K., Blanton, J., San Francisco, M., & Brashears, M. (2007). Positive adaptive state: Microarray evaluation of gene expression in Salmonella enterica Typhimurium exposed to nalidixic acid. Foodborne Pathogens, 4, 187–200.

427

Forestier, C., De Champs, C., Vatoux, C., & Joly, B. (2001). Probiotic activities of Lactobacillus casei rhamnosus: In vitro adherence to intestinal cells and antimicrobial properties. Research in Microbiology, 152, 167–173. Galdeano, M. C., & Perdigon, G. (2006). The probiotic bacterium Lactobacillus casei induces activation of the gut mucosal immune system through the innate immunity. Clinical and Vaccine Immunology, 13(12), 219–226. Gyawali, R., & Ibrahim, S. A. (2012). Synergistic effect of copper and lactic acid against Salmonella and Escherichia coli O157:H7: A review. Emirates Journal of Food and Agriculture, 24(1), 1–11. Jean-Richard, N., Dominique, G., Martine, R., Alain, S., Susann, T., & Karl-Anders, K. (2000). Lactobacillus johnsonii La1 shares carbohydrate-binding specificities with several enteropathogenic bacteria. Glycobiology, 10(11), 1193–1199. Kim, M., Ashida, H., Ogawa, M., Yoshikawa, Y., Mimuro, H., & Sasakawa, C. (2010). Bacterial interactions with the host epithelium. Cell Host & Microbe, 8, 20–35. La Ragione, R. M., Cooley, W. A., Velge, P., Jepson, M. A., & Woodward, M. J. (2003). Membrane ruffling and invasion of human and avian cell lines is reduced for aflagellate mutants of Salmonella enterica serotype Enteritidis. International Journal of Medical Microbiology, 293(4), 261–272. Lin, T. H., & Pan, T. M. (2014). Inhibitory effect of Lactobacillus paracasei subsp. paracasei NTU 101 on rat dental caries. Journal of Functional Foods, 10, 223–231. McFarland, L. V. (2009). Evidence-based review of probiotics for antibiotic-associated diarrhea and Clostridium difficile infections. Anaerobe, 15(6), 274–280. Medellin-Pena, M. J., Wang, H., Johnson, R., Anand, S., & Griffiths, M. W. (2007). Probiotics affect virulence-related gene expression in Escherichia coli O157:H7. Applied and Environmental Microbiology, 73(13), 4259–4267. Miao, J., Guo, H., Ou, Y., Liu, G., Fang, X., Liao, Z., Ke, C., Chen, Y., Zhao, L., & Cao, Y. (2014). Purification and characterization of bacteriocin F1, a novel bacteriocins produced by Lactobacillus paracasei subsp. tolerans FX-6 from Tibetan kefir, a traditional fermented milk from Tibet, China. Food Control, 42, 48–53. Miller, K. B., Hurst, W. J., Payne, M. J., Stuart, D. A., Apgar, J., Sweigart, D. S., & Ou, B. (2008). Impact of alkalization on the antioxidant and flavanols content of commercial cocoa powders. Journal of Agricultural and Food Chemistry, 56, 8527– 8533. Neeser, J. R., Granato, D., Rouvet, M., Servin, A., Teneberg, S., & Karlsson, K. A. (2000). Lactobacillus johnsonii La1 shares carbohydrate-binding specificities with several enteropathogenic bacteria. Glycobiology, 10, 1193–1199. Nkanwen, E. R. S., Gatsing, D., Ngamga, D., Fodouop, S. P. C., & Tane, P. (2009). Antibacterial agents from the leaves of Crinum purpurascens herb (Amaryllidaceae). African Health Sciences, 9, 264–269. Parvez, S., Malik, K. A., Ah Kang, S., & Kim, H. Y. (2006). Probiotics and their fermented food products are beneficial for health. Journal of Applied Microbiology, 100, 1171–1185. Peng, M., Aryal, U., Cooper, B., & Biswas, D. (2015). Metabolites produced during the growth of probiotics in cocoa supplementation and the limited role of cocoa in host-enteric bacterial pathogen interactions. Food Control, 53, 124–133. Peng, M., Bitsko, E., & Biswas, D. (2015). Functional properties of peanut fractions on the growth of probiotics and foodborne bacterial pathogens. Journal of Food Science, 80(3), M635–M641. Reid, G., & Burton, J. (2002). Use of Lactobacillus to prevent infection by pathogenic bacteria. Microbes and Infection, 4, 319– 324. Rodriguez, E., Arques, J. L., Rodriguez, R., Peiroten, A., Landete, J. M., & Medina, M. (2012). Antimicrobial properties of probiotic strains isolated from breast-fed infants. Journal of Functional Foods, 4(2), 542–551.

428

Journal of Functional Foods 15 (2015) 418–428

Salaheen, S., Almario, J. A., & Biswas, D. (2014). Inhibition of growth and alteration of host cell interactions of Pasteurella multocida with natural byproducts. Poultry Science, 93(6), 1375– 1382. Salaheen, S., Nguyen, C., Hewes, D., & Biswas, D. (2014). Cheap extraction of antibacterial compounds of berry pomace and their mode of action against the pathogen Campylobacter jejuni. Food Control, 46, 174–181. Salaheen, S., White, B., Bequette, B. J., & Biswas, D. (2014). Peanut fractions boost the growth of Lactobacillus casei that alters the interactions between Campylobacter jejuni and host epithelial cells. Food Research International, 62, 1141–1146. Saran, S., Bisht, M. S., Singh, K., & Teotia, U. V. S. (2012). Comparing adhesion attributes of two isolates of Lactobacillus acidophilus for assessment of prebiotics, honey and inulin. International Journal of Scientific Research Publications, 2, 1–7. Servin, A. L., & Coconnier, M. H. (2003). Adhesion of probiotic strains to the intestinal mucosa and the interaction with pathogens. Best Practice & Research Clinical Gastroenterology, 17, 741–754. Sharma, D., & Saharan, B. S. (2014). Simultaneous production of biosurfactants and bacteriocins by probiotic Lactobacillus casei MRTL3. International Journal of Microbiology, 2014(5), 1–7. Sherman, M. P., Bennett, S. H., Hwang, F. F., Sherman, J., & Bevins, C. L. (2005). Paneth cells and antibacterial host defense in neonatal small intestine. Infection and Immunity, 73, 6143–6146. Sperandio, V., Lin, E. C. C., & Kaper, J. B. (2002). Quorum-sensing Escherichia coli regulator A: A regulator of the LysR family involved in the regulation of the locus of enterocyte

effacement pathogenicity island in enterohemorrhagic E. coli. Infection and Immunity, 70, 3085–3093. Spurbeck, R. R., & Arvidson, C. G. (2010). Lactobacillus jensenii surface-associated proteins inhibit Neisseria gonorrhoeae adherence to epithelial cells. Infection and Immunity, 78(7), 3103–3111. Sullivan, A., & Nord, C. E. (2002). The place of probiotics in human intestinal infections. International Journal of Antimicrobial Agents, 20, 313–319. Tuomola, E. M., Ouwehand, A. C., & Salminen, S. J. (1999). The effect of probiotic bacteria on the adhesion of pathogens to human intestinal mucus. FEMS Immunology and Medical Microbiology, 26, 137–142. Van de Guchte, M., Ehrlich, S. D., & Maguin, E. (2001). Production of growth-inhibiting factors by Lactobacillus delbrueckii. Journal of Applied Microbiology, 91, 147–153. Wannun, P., Piwat, S., & Teanpaisan, R. (2014). Purification and characterization of bacteriocin produced by oral Lactobacillus paracasei SD1. Anaerobe, 27, 17–21. Wong, S., Jamous, A., O’Driscoll, J., Sekhar, R., Weldon, M., Yau, C. Y., Hirani, S. P., Grimble, G., & Forbes, A. (2013). A Lactobacillus casei Shirota probiotic drink reduces antibiotic-associated diarrhoea in patients with spinal cord injuries: A randomised controlled trial. British Journal of Nutrition, 111(4), 672–678. Xu, H. Y., Tian, W. H., Wan, C. X., Jia, L. J., Wang, L. Y., Yuan, J., Liu, C. M., Zeng, M., & Wei, H. (2008). Antagonistic potential against pathogenic microorganisms and hydrogen peroxide production of indigenous Lactobacilli isolated from vagina of Chinese pregnant women. Biomedical and Environmental Sciences, 21(5), 365–371.