mast cells pathway

Journal Pre-proof Lactobacillus casei ATCC 393 alleviates Enterotoxigenic Escherichia coli K88-induced intestinal barrier dysfunction via TLRs/mast cells pathway

Chunlan Xu, Shuqi Yan, Yu Guo, Lei Qiao, Li Ma, Xina Dou, Baohua Zhang PII:

S0024-3205(20)30028-X

DOI:

https://doi.org/10.1016/j.lfs.2020.117281

Reference:

LFS 117281

To appear in:

Life Sciences

Received date:

11 October 2019

Revised date:

26 December 2019

Accepted date:

1 January 2020

Please cite this article as: C. Xu, S. Yan, Y. Guo, et al., Lactobacillus casei ATCC 393 alleviates Enterotoxigenic Escherichia coli K88-induced intestinal barrier dysfunction via TLRs/mast cells pathway, Life Sciences(2020), https://doi.org/10.1016/j.lfs.2020.117281

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2020 Published by Elsevier.

Journal Pre-proof

Lactobacillus casei ATCC 393 alleviates Enterotoxigenic Escherichia coli K88-induced intestinal barrier dysfunction via TLRs/mast cells pathway Chunlan Xu, Shuqi Yan, Yu Guo, Lei Qiao, Li Ma, Xina Dou, Baohua Zhang The Key Laboratory for Space Bioscience and Biotechnology, School of Life Sciences,

Jo ur

na

lP

re

-p

ro

of

Northwestern Polytechnical University, Xi’an, Shaanxi 710072, China



Corresponding author: Chunlan Xu, Associate Professor, School of Life Sciences,

Northwestern Polytechnical University, 127 Youyixi Road Xi’an, Shaanxi, 710072, China. E-mail: [email protected] Telephone: +86-29-88460543, Fax: +86-29-88460332

Journal Pre-proof

Abstract Aims：Mast cells play a crucial role in gastrointestinal physiology and pathophysiology. This study was conducted to investigate the role of mast cells (MCs) in the protective effect of Lactobacillus casei ATCC 393 (L. casei ATCC 393) on intestinal barrier function. Main methods: The regulatory effect of L. casei ATCC 393 on intestinal barrier

of

dysfunction and MCs activation induced by Enterotoxigenic Escherichia coli K88 (ETEC

ro

K88) were evaluated by porcine mucosal mast cells (PMMCs)- porcine jejunal epithelial

-p

cells (IPEC-J2)-L. casei ATCC 393 co-culture experiments in vitro and MCs stabilizer drug

re

experiment in vivo.

lP

Key findings: Results showed that L. casei ATCC 393 pretreatment effectively alleviated the reduction of cell viability and increase of permeability in ETEC K88-infected IPEC-J2

na

cells. L. casei ATCC 393 pretreatment inhibited the increase of proinflammatory cytokines

Jo ur

and some other MCs mediators, and decrease of anti-inflammatory cytokines in ETEC K88-infected PMMCs. Cromolyn sodium or L. casei ATCC 393 prevented ETEC K88-induced increase of intestinal epithelial cell permeability in IPEC-J2 cells when co-cultivation with PMMCs. Furthermore, cromolyn sodium or L. casei ATCC 393 pretreatment attenuated ETEC K88-induced increase of MCs mediators, mast cell proteases (MCPs) and carboxypeptidase A3 (CPA3) mRNA levels, and down-regulation of tight junction proteins, Toll-like receptor 2 and 4 (TLR2 and TLR4) expression levels in mice challenged by ETEC K88.

2

Journal Pre-proof

Significance: These results indicated that intestinal barrier dysfunction caused by ETEC K88 was mediated by intestinal mast cell activation which can be prevented by L. casei ATCC 393 via TLRs signaling pathway. Keywords: probiotics, Lactobacillus casei ATCC 393, intestinal barrier function, mast cells, toll-like receptors

of

1. Introduction

ro

Efficient prevention and cure of intestinal barrier dysfunction in newborns is crucial as

-p

their immature gastrointestinal tract is highly sensitive to pathogenic microorganisms [1-4].

re

In recent years, probiotics with beneficial effects on gut health attract special attention [5].

lP

A line of researches indicate that probiotics possess the ability to counteract the detrimental effects brought by pathogenic microorganisms [1, 6, 7] and modulate intestinal epithelial

na

defense responses via the following mechanism: (1) bacteriocins/defensins secretion; (2)

Jo ur

competitive inhibition; (3) bacterial adhesion/translocation inhibition; (4) luminal pH reduction; (5) mucus layer increase [8]. Lactobacillus johnsonii and Lactobacillus rhamnosus GG exhibited protective effect on intestinal barrier function [1]. As for the fermented dairy products and functional foods, Lactobacillus casei ATCC 393 (L. casei ATCC 393) is widely applied as an important living microorganism [9]. L. casei ATCC 393 exhibits immunomodulatory and anti-infective activities for host [10, 11]. L. casei ATCC 393 can distinctly adherence to the intestinal mucosa in rat [12]. However, the exact protective mechanism of L. casei ATCC 393 on intestinal barrier function remains unclear.

3

Journal Pre-proof

Mast cells (MCs) are widely distributed in the intestinal mucosa. They are sensitive to the stimulus from intestinal lumen such as pathogenic bacteria. ETEC induced MCs activation in late-weaned piglets [13]. MCs are essential to control various pathogenic infection [14] and regulate intestinal epithelial permeability, ion secretion, bacterial defense, innate and adaptive immunity, etc [15]. Porcine MCs challenged by H1N1

of

influenza virus increases the incidence of diseases related with influenza virus by releasing

ro

MCs mediators such as histamine, inflammatory cytokines and chemokines [16]. Mucosal

-p

MCs participate in chronic stress-caused colonic epithelial barrier dysfunction by

re

hyperplasia and activation in rats [17]. Intestinal dysfunction has been proved to be related

lP

to MCs activation. The possible mechanism may be relevant to changes in intestinal epithelial barrier structure and function, and/or immune responses. The uncontrolled MCs

na

activation may affect intestinal homeostasis and cause intestinal barrier dysfunction, even

Jo ur

GI disorders [15]. Therefore, it is important to optimally regulate the activation of MCs. Cromolyn (MCs stabilizer) effectively relieved intestinal barrier dysfunction in early weaning piglets [18]. The number and stability of MCs could be modulated by certain probiotics. Pigs fed diet supplemented with Bifidobacterium lactis NCC 2818 had more MCs than control littermates [19]. L.rhamnosus JB-1 stabilizes MCs in rats [20]. This study was conducted to investigate the protective effect of L. casei ATCC 393 on intestinal barrier dysfunction and the possible relationship with MCs. Our hypothesis was that L. casei ATCC 393 possessed the ability to alleviate intestinal epithelial barrier dysfunction in porcine jejunal epithelial cell line (IPEC-J2) and mice infected with

4

Journal Pre-proof

Enterotoxigenic Escherichia coli K88 (ETEC K88), and the possible mechanism behind these protective effects may be related to TJ proteins expression and MCs activation. Therefore, the regulatory effect of L. casei ATCC 393 on MCs activation induced by ETEC K88 and the relationship of them with intestinal barrier function evaluated by porcine mucosal mast cells (PMMCs)-IPEC-J2-L.casei ATCC 393 co-culture experiments in vitro

of

and mast cell stabilizer drug experiments in vivo.

ro

2. Materials and methods

-p

2.1. Bacterial strains, cell line and reagents

re

L. casei ATCC 393 and ETEC K88 were kept in our laboratory. PMMCs and IPEC-J2

lP

cells were purchased from Cell Resource Center, Shanghai Institute of Life Sciences, Chinese Academy of Sciences (Shanghai, China). FITC-Dextran (4 kDa), cromolyn sodium,

na

deMan, Rogosa and Sharpe (MRS) broth, Luria-Bertani (LB) broth were purchased from

Jo ur

Sigma-Aldrich (St. Louis, MO). TRIzol Reagent and reagents for cell culture were purchased from Gibco-Invitrogen. interleukin-4 (IL-4),interleukin-6 (IL-6), interleukin-10 (IL-10), transforming growth factor-β (TGF-β)，interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), interferon-γ (IFN-γ), β-hexosaminidase, tryptase, myeloperoxidase (MPO) and histamine assay Kits were purchased from R&D Systems (Minneapolis, MN, USA). The Zonula occludens-1 (ZO-1), Occludin, Claudin-1, c-fos, Toll-like receptor 2 (TLR2), Toll-like receptor 4 (TLR4) and β-actin primary antibodies and secondary horseradish peroxidase (HRP) antibodies were obtained from Abcam Biotechnology (Cambridge, MA, USA). RIPA lysis buffer and Bicinchoninic acid (BCA) protein assay Kit were purchased

5

Journal Pre-proof

from Solarbio Life Sciences Biotech Co. (Beijing, China). Cell Counting Kit-8 (CCK-8) and Hoechst 33,342 staining Kit were purchased from Beyotime Biotechnology (Shanghai, China). 2.2. Preparation of bacterial resuspension ETEC K88 was cultivated in LB broth with shaking at the speed of 120 rpm at 37 °C

of

overnight. L. casei ATCC 393 was incubated in MRS broth or MRS with agarose at 37 °C for

ro

24 h without shaking. Bacteria pellets were collected by centrifuging at 4 °C, 5,000×g for 10

-p

min, and then washed three times with phosphate buffer saline (PBS, pH7.4). The obtained

re

bacteria were resuspended in fresh fetal bovine serum (FBS)-free cell culture medium.

lP

2.3. Cell culture conditions

PMMCs and IPEC-J2 cells were cultured in DMEM/HIGH Glucose medium and

na

DMEM/F12 medium with 10% FBS and 1% antibiotic mixture (100 μg/mL streptomycin

respectively.

Jo ur

and 100 U/mL penicillin) at 37 °C under a humidified atmosphere containing 5% CO2,

2.4. Protective effect of L. casei ATCC 393 on IPEC-J2 cells infected by ETEC K88 First, the effect of L. casei ATCC 393 and ETEC K88 on the viability of IPEC-J2 cells were evaluated. IPEC-J2 cells (1×104 cells/well) were seeded in 96-well plates (Corning, NY, USA), and then incubated with different concentrations of L. casei ATCC 393 for 3 h or ETEC K88 for 2 h after reaching 90% confluence. Finally, the culture medium was discarded. Cells in each well were washed three times with PBS to remove the residual

6

Journal Pre-proof

bacteria. Cell viability was detected and quantified by CCK-8 assay Kit according to the manufacturer’s instruction. 1×105 IPEC-J2 cells were seeded in 6-well plates (Corning, NY, USA) for 24 h to allow cells attachment. The infective groups were cultivated with ETEC K88 (1×107 CFU/mL) for 2 h after administration with L. casei ATCC 393 (1×108 CFU/mL) for 3 h. In order to ensure

of

the same CFU of bacteria in each experiment, we calculated CFU according to the methods

ro

reported by Chen et al.[21]. After the above treatments, cell morphology was observed.

-p

Moreover, living cells counts were evaluated by Hoechst 33,342 staining Kit. ALP activity

re

in cell culture medium was detected by ALP Activity Assay Kit.

lP

The effect of inactivated L. casei ATCC 393 on IPEC-J2 cells infected by ETEC K88 was also investigated. First, L. casei ATCC 393 was inactivated at 121℃ for 15 min. The infective

na

groups were cultivated with ETEC K88 at the concentration of 1×107 CFU/mL for 2 h after

Jo ur

administration with inactivated L. casei ATCC 393 (1×108 CFU/mL) for 3 h. After those treatments, cell morphology was observed by microscope and cell viability was detected by CCK-8 assay Kit.

2.5. Effect of L. casei ATCC 393 on intestinal epithelial permeability IPEC-J2 cells were seeded into 24-well Transwell plates (Corning, NY, USA) overnight to allow cells attachment. Then cells were pretreated with L. casei ATCC 393 (1×108 CFU/mL) or FBS-free DMEM/F12 medium for 3 h, and then challenged with ETEC K88 (1×107 CFU/mL) or FBS-free DMEM/F12 medium for 2 h. Then TEER was determined with a Millicell Electrical Resistance System (Millipore, Billerica, MA, USA). In order to evaluate

7

Journal Pre-proof

the FITC-Dextran fluxes across IPEC-J2, 2.2 mg/mL FITC-Dextran was added to the upper chamber of the Transwells and continuously co-incubated for 2 h after TEER was detected. 100 μL culture medium were collected from the apical side and basolateral side, to measure FITC-Dextran concentrations by Multimode Microplate Reader (BioTeck, USA). 2.6. Effects of L. casei ATCC 393 on the expression levels of tight junction Proteins

of

1×105 IPEC-J2 cells were seeded into 6-well plates and cultivated until reaching

ro

80%~90% confluence. After treated with L. casei ATCC 393 (1×108 CFU/mL) at 37 °C for 3

-p

h, the infective group and the L. casei ATCC 393 -protective group were continuously

re

cultivated with ETEC K88 (1×107 CFU/mL) for 2 h. Then cells were washed three times

lP

with PBS. Total protein was extracted by dissolving cells in 500 μL cell RIPA lysis buffer. The protein concentration was measured by the BCA Protein Assay Kit. 40 μg of protein

na

sample was loaded to 10% sodium dodecyl sulfate polyacrylamide gel after boiling with

Jo ur

loading buffer at 95 °C for 5 min. Then, the proteins were transferred to polyvinylidene difluoride (PVDF) membrane (Millipore, Massachusetts, USA). After being blocked with 5% skim milk blocking buffer for 2 h, the PVDF membranes with proteins were incubated with primary antibodies for Zonula occludens-1 (ZO-1), Occludin and β-actin at 4 °C overnight, and then incubated with secondary antibodies for 2 h after washing three times with tris buffered saline with Tween 20 (TBST). The immunoreactive bands were visualized by Clarity Western ECL substrate Kit (BioRad, CA, United States). The gray values of the bands were analyzed by the built-in software. 2.7. Effect of L. casei ATCC 393 on mast cells activation

8

Journal Pre-proof

PMMCs (5×105 cells/well) were incubated in 24-well plates for 24 h. Cells from L. casei ATCC 393 treatment groups were exposed to L. casei ATCC 393 (1×108 CFU/mL) for 3 h. Other groups were given an equal volume of FBS-free DMEM/F12 medium. Then cells from ETEC K88 infective groups were exposed to ETEC K88 (1×107 CFU/mL) for 2 h. Finally, cell culture medium of each experimental group were collected for analysis of MCs

of

mediators including β-hexosaminidase and tryptase activities, proinflammatory and

ro

anti-inflammatory cytokines levels by corresponding ELISA Kits.

-p

2.8. Effect of mast cell stabilizer and L. casei ATCC 393 on ETEC K88-induced porcine

re

intestinal barrier dysfunction

lP

5.5×104 IPEC-J2 cells and 4×105 PMMCs cells were seeded into the upper and lower chamber of 24-well transwell plates, respectively. PMMCs cells were pretreated with or

na

without cromolyn sodium (5 μM) for 12 h or pretreated with or without L. casei ATCC 393

Jo ur

resuspension solution (1×108 CFU/mL) for 3 h, and then challenged with ETEC K88 resuspension solution (1×107 CFU/mL) or FBS-free DMEM/F12 medium for 2 h. Then TEER and the paracellular passage of FITC-Dextran in IPEC-J2 challenged by ETEC K88 and mast cells blockade were measured according to the above mentioned method. 2.9. Role of mast cells in the protective effect of L. casei ATCC 393 on intestinal barrier function in mice The animal experiment was approved by the Lab Animal Ethics & Welfare Committee of the Northwestern Polytechnical University (The project identification code: 2018012) on 20th March, 2018. Moreover, all procedures were in accordance with the National Institutes

9

Journal Pre-proof

of Health guidelines for the care and use of experimental animals. Briefly, fifty healthy male C57BL/6 mice with average body weight of 22 ± 2 g were purchased from the Experimental Animal Center of Xi’an Jiaotong University, and maintained at the Animal Experimental Center of Northwestern Polytechnical University with relative humidity of 50%, 25 ℃ and a 12 h light and dark cycle. After the adaptive period of 7 days, these

of

experimental mice were assigned randomly to five groups with 10 mice per group: normal

ro

control group, ETEC K88-infective model group, L. casei ATCC 393 protective group,

-p

Mast cell stabilizer group and L. casei ATCC 393+Mast cell stabilizer group. The mice in

re

L. casei ATCC 393 protective group were orally administrated with 200 μL L. casei ATCC

lP

393 resuspension solution (5×108 CFU/mL) for 14 days. Other mice were orally given the same volume of MRS broth per day. On days 10, 12, 14, 16, 18, and 20, mice from other

na

groups were orally given 200 μL ETEC K88 resuspension solution (1×108 CFU/mL) beside

Jo ur

control group administrated with LB broth. On days 8, 13 and 18, mast cell stabilizer groups were given cromolyn sodium by intraperitoneal injection (10 mg/kg. B.W.), other groups were given saline vehicle by intraperitoneal injection. The weight and diarrhea were observed and recorded daily. After treatment, mice were anesthetized with ether. Blood were collected from heart for later preparation of serum. Then, the abdomen was opened immediately, duodenum and ileum were collected. Intestinal morphology was evaluated by hematoxylin-eosin (H.E.) staining. Total number of MCs in ileum was detected by toluidine blue (T.B.) staining. The c-fos expression levels in ileum were evaluated by Immunofluorescence Technique. Serum β-hexosaminidase, Tryptase and MPO activities,

10

Journal Pre-proof

and histamine, TNF-α, IFN-γ, IL-6 and IL-1β levels were determined by using commercial ELISA Kits. The mRNA levels of mast cell protease (MCPs) and carboxypeptidase A3 (CPA3) in ileum were detected by Real-Time Polymerase Chain Reaction (PCR). Primers sequences were listed in Table 1. Occludin, Claudin-1, TLR2 and TLR4 protein levels in ileum were measured by Western Blot.

of

2.10. Statistical analysis

ro

All experimental data were statistically analyzed by SPSS v.19.0 (SPSS Inc., Chicago, IL, USA) and expressed as mean ± standard error of mean (S.E.M.). The statistical

-p

significance was calculated by one-way analysis of variance (ANOVA) or Student’s

lP

least three independent experiments.

re

t-test. P<0.05 were considered significant significance. All assays were performed in at

na

Table 1. Sequences of oligonucleotide primers used for MCPs and CPA3 mRNA levels

Gene Producta

Jo ur

analysis. Primer

Directionb Sequence (5’ to 3’) F

β-actin

Product size (bp)

GAGACCTTCAACACCCCAGCC 161

R

AGACGCAGGATGGCATGGG

F

CAGATGTGGTGGGTTTCTCA

MCP-1

177 R

GCTCACATCATGAGCTCCAA

F

AGGCCCTACTATTCCTGATGG

R

ATGTAAGGACGGGAGTGTGG

F

GCTACCTGTGGTGGGTTTCT

R

TCACATCATGAGCTCCAAGG

MCP-2

100

MCP-4

100

11

Journal Pre-proof F

CAGGCCCTGGATCAATAAGA

MCP-5

554 R

GGCACACAAAACCTGCACTA

F

CTATCCAGGGTCAGGCAAGA

R

GACAGGGGAGACAGAGGACA

F

GACCCCAACAAGGTCAGAGT

R

TGTAGAAGTCGGGGTGTGTG

F

TCCAGGAACCAAAACTCCAC

R

CATTGAGGCATGGTTTGTG

MCP-6

515

MCP-7

583

ro

MCP, mast cell protease; CPA, carboxypeptidase A3. bF, forward; R, reverse.

-p

a

240

of

CPA3

re

3. Results

lP

3.1. Protective effect of L. casei ATCC 393 on ETEC K88-inudced IPEC-J2 cells injury As shown in Fig. 1A, L. casei ATCC 393 did not exhibit cytotoxicity on IPEC-J2 cells.

na

However, ETEC K88 significantly reduced the viability of IPEC-J2. In terms of cell

Jo ur

morphology and number of living cells (Fig. 1B, C, D and E), we found that pretreatment of L. casei ATCC 393 significantly antagonized the toxic effect of ETEC K88 on IPEC-J2 cells. Moreover, ALP activity in cell culture medium from L. casei ATCC 393 was lower than that from ETEC K88 treatment alone (Fig. 1F). However, as shown in Fig. S1 A, inactivated L. casei ATCC 393 did not exhibit cytotoxicity on IPEC-J2 cells compared with the control. In terms of cell morphology and cell viability (Fig. S1 B), we found that pretreatment of inactivated L. casei ATCC 393 did not alleviate the cytotoxic effect of ETEC K88 on IPEC-J2 cells.

12

Jo ur

na

lP

re

-p

ro

of

Journal Pre-proof

Fig. 1. L. casei ATCC 393 alleviated the cytotoxity of ETEC K88 on porcine intestinal epithelial cells. (A) Effect of Lactobacillus casei ATCC 393 or ETEC K88 on the growth of porcine intestinal epithelial cells. IPEC-J2 cells at a density of 1×105 cells/mL were seeded in 96-well plates for 24 h. Then cells were cultivated in the presence of L. casei ATCC 393 (0-4×108 CFU/mL) for 3 h or ETEC K88 (0-8×107 CFU/mL) for 2 h. Cell viability was 13

Journal Pre-proof

quantified by CCK-8 assay. Different concentration of L. casei ATCC 393 treatment groups vs. control. (B) Effect of ETEC K88 with or without L. casei ATCC 393 pretreatment on the viability of IPEC-J2. Cells were treated with L. casei ATCC 393 resuspension solution (0.5, 1 or 2×108 CFU/mL) for 3 h before challenged by ETEC K88 (1×107 CFU/mL) for 2 h. (C) Cells were treated with L. casei ATCC 393 resuspension solution (1 ×108 CFU/mL) for 3 h

of

before challenged by ETEC K88 (1×107 CFU/mL) for 2 h. Cell morphology was observed

ro

by inverted microscope. (D) Living cells were observed by fluorescence microscope with

-p

Hoechst 33342 staining. (E) Quantitative analysis of living cells by Hoechst 33342 staining.

re

(F) Alkaline phosphatase (ALP) activity in the cell medium. The values given are means

lP

±S.E.M. of three separate experiments. *P < 0.05, ***P < 0.001.

na

3.2. Effect of L. casei ATCC 393 on intestinal epithelium permeability in vitro

Jo ur

ETEC K88 treatment caused the reduction in TEER when compared with the normal Control (Fig. 2A). However, pretreatment with L. casei ATCC 393 significantly inhibited the reduction of TEER caused by ETEC K88. Furthermore, the paracellular passage of FITC-Dextran in IPEC-J2 cells challenged by ETEC K88 was higher than that from the pretreatment with L. casei ATCC 393 group (Fig. 2B). As shown in Fig. 2C. when compared with the Control group, ETEC K88 challenge markedly down-regulated Occludin and ZO-1 expression levels. Conversely, pretreatment with L. casei ATCC 393 alleviated the above effects.

14

-p

ro

of

Journal Pre-proof

re

Fig. 2. Effect of L. casei ATCC 393 on the permeability of porcine intestinal epithelial

lP

cells. (A) Transepithelial electrical resistance (TEER) after different treatment in IPEC-J2 cells. Pre-treatment with L. casei ATCC 393 partially offset the decrease in TEER caused

na

by ETEC K88. (B) Effect of L. casei ATCC 393 on FITC-Dextran fluxes across IPEC-J2

Jo ur

challenged by ETEC K88. (C) Effect of ETEC K88 with or without L. casei ATCC 393 pretreatment on the Occludin and ZO-1 protein expression. The expression levels of different tight junction proteins in IPEC-J2 from each experimental groups analyzed by Western Blot. 1, Control; 2, ETEC K88; 3, L. casei ATCC 393+ ETEC K88; 4, L. casei ATCC 393. ZO-1, Zonula occludens 1. All data were presented as mean ±S.E.M. of three independent experiments. *P < 0.05, **P < 0.01.

3.3. Effect of L. casei ATCC 393 on porcine mucosal mast cells activation

15

Journal Pre-proof

As shown in Fig. 3, β-hexosaminidase and tryptase activities, and levels of proinflammatory cytokines TNF-α, IFN-γ, IL-1β levels in PMMCs exposed to ETEC K88 were higher than those in normal control cells. Moreover, ETEC K88 caused the reduce of reduced the level of anti-inflammatory cytokines including IL-10 and TGF-β levels in PMMCs compared with the control group. Conversely, pretreatment with L. casei ATCC

of

393 alleviated the increase of β-hexosaminidase and tryptase activity, and the increase of

ro

TNF-α, IFN-γ and IL-1β levels in PMMCs and the decrease of IL-10 and TGF-β induced by

Jo ur

na

lP

re

-p

ETEC K88.

16

Jo ur

na

lP

re

-p

ro

of

Journal Pre-proof

Fig. 3. Effect of L. casei ATCC 393 and mast cell stabilizer on the release of MCs mediators in porcine mucosal mast cells (PMMCs) challenged by ETEC K88. The activity of β-hexosaminidase and tryptase, and the levels ofIL-4, IL-6, IL-10, TNF-α, IFN-γ and TGF-β in cell culture medium were determined by corresponding ELISA Kits. All data were presented as mean ± S.E.M. of three separate experiments. *P < 0.05, **P < 0.01, ***P < 0.001. interleukin-1β, IL-1β; tumor necrosis factor-α, TNF-α; interferon-γ, IFN-γ;

17

Journal Pre-proof

interleukin-4, IL-4; interleukin-10, IL-10; transforming growth factor-β, TGF-β.

3.4. Effect of mast cell stabilizer and L. casei ATCC 393 on ETEC K88 -induced intestinal epithelial barrier dysfunction IPEC-J2 cells were co-cultured with PMMCs cells. PMMCs cells were administrated with

of

cromolyn sodium before challenged by ETEC K88. Intestinal epithelial barrier function was

ro

measured. The results showed that pretreatment of cromolyn sodium or L. casei ATCC 393

-p

pretreatment effectively prevented ETEC K88-induced reduction of TEER in IPEC-J2 cells

re

(Fig. 4A) and significantly inhibited ETEC K88-induced increase in FITC-Dextran fluxes

Jo ur

na

lP

across IPEC-J2 cells (Fig. 4B).

Fig. 4. Effect of L. casei ATCC 393 and mast cell stabilizer on the permeability of porcine intestinal epithelial cells. (A) Transepithelial electrical resistance (TEER) after different treatment in IPEC-J2 cells. TEER were measured with a Millicell-ERS. Pre-treatment with L. casei ATCC 393 or cromolyn partially offset the decrease in TEER. (B) Effects of L. casei ATCC 393 and mast cell stabilizer on FITC-Dextran flux across IPEC-J2 challenged 18

Journal Pre-proof

by ETEC K88. All data were presented as mean ± S.E.M. of three separate experiments. *P < 0.05, **P < 0.01, ***P < 0.001. fluorescein isothiocyanate–dextran, FITC-Dextran.

3.5. Effect of L. casei ATCC 393 on mast cell activation and intestinal barrier dysfunction in mice

of

The experimental scheme was shown in Fig. 5A. The body weight of experimental mice

ro

from each group first gradually increase, and then decrease. The body weight of mice from

-p

the ETEC K88 group was the lowest in all the experimental groups (Fig. 5B). Oral

re

administration with L. casei ATCC 393 obviously alleviated the increase of MCPs and

lP

CPA3 mRNA levels caused by ETEC K88 (Fig. 5C). Intragastric pretreatment with L. casei ATCC 393 or cromolyn sodium by intraperitoneal injection significantly attenuated ETEC

na

K88-induced decrease of Occludin and Claudin-1 protein expression levels (Fig. 5D).

Jo ur

Moreover, L. casei ATCC 393 significantly inhibited the increase of histamine, IFN-γ, TNF-α, IL-6 and IL-1β levels, and β-hexosaminidase, tryptase and MPO activities caused by ETEC K88 (Fig. 6). Moreover, low crypt depth, short intestinal villus and disordered arrangement of intestinal villus in ETEC K88 infective group were observed than those in the control group. However, the intestinal villus arranged neatly in the pretreatment with L. casei ATCC 393 or cromolyn sodium alleviated the above adverse effects caused by ETEC K88 (Fig. 7A, B). L. casei ATCC 393 reduced the total intestinal mucosal mast cells in ileum (Fig. 7C). Moreover, treatment with L. casei ATCC 393 inhibited the increase of c-fos expression level in ileum caused by ETEC K88 (Fig. 7D).

19

na

lP

re

-p

ro

of

Journal Pre-proof

Jo ur

Fig. 5. L. casei ATCC 393 and mast cell stabilizer and attenuates ETEC K88-induced intestinal barrier dysfunction in mice. (A) The scheme of experiment in vivo. (B) The change of weight during the whole experiment period. (C) The mRNA levels of mast cell proteases (MCP-1, MCP-2, MCP-4, MCP-5, MCP-6, MCP-7) and carboxypeptidase A3. (CPA3) analyzed by Real-Time PCR. (D) The expression levels of tight junction proteins (Occludin and Claudin-1) and toll-like receptors (TLR2 and TLR4) in ileum from different experimental mice. All data were presented as mean ± S.E.M. *P < 0.5, **P < 0.01, ***P < 0.001.

20

Jo ur

na

lP

re

-p

ro

of

Journal Pre-proof

Fig. 6. Lactobacillus casei ATCC 393 inhibits ETEC K88-induced the activation of intestinal mucosal mast cells and release of MCs mediators in mice. Mice in L. casei ATCC 393 groups were intragastrically administrated with L. casei ATCC 393 (5×108 CFU/mL)

21

Journal Pre-proof

every day. The control, cromolyn sodium and ETEC K88 treatment groups were given an equal volume of MRS medium. Then other groups except for control were intragastrically administrated with ETEC K88 culture medium (1×108 CFU/mL) every two days. Control group were given equal volume of LB broth. Cromolyn sodium stabilizer group was given cromolyn sodium (10 mg/kg B.W.) by intraperitoneal injection, other groups were given an

of

equal volume of saline vehicle. The activity of β-hexosaminidase, tryptase and MPO, and

ro

The levels of histamine IL-6, IL-1β, TNF-α and IFN-γ in serum were determined by

-p

corresponding ELISA Kits. All data were presented as mean ± S.E.M. *P < 0.05, **P < 0.01.

re

tumor necrosis factor-α, TNF-α; interferon -γ, IFN-γ; interleukin -6, IL-6;

Jo ur

na

lP

interleukin-1β, IL-1β; myeloperoxidase, MPO.

22

Journal Pre-proof

Fig. 7. Modulatory effect of Lactobacillus casei ATCC 393 on the intestinal morphology and mast cells numbers. (A) The histology of jejunum and duodenum observed by H.E. staining. (B) Statistical results of villus height and crypt depth of each experimental group. (C) Total number of mast cells in ileum stained with toluidine blue (TB), showed statistically significant difference between control and other groups. (D) The images of

of

mast cells number in ileum using TB staining. (E) The images of c-fox expression levels in

ro

ileum detected by Immunofluorescence technique. All data were presented as mean ±

-p

S.E.M. *P < 0.05, **P < 0.01, ***P < 0.001.

re

4. Discussion

lP

Various bacteria symbiotically exist in intestine and closely related to the intestinal health [2]. Neonatal or early-weaned animals are usually sensitive to pathogenic bacteria,

na

even resulting in diarrhea. Therefore, antibiotics are widely used to counteract the

results

in

Jo ur

pathogenic bacteria in pig industry. However, the overuse and abuse of antibiotics usually gut

microbiota

dysbiosis

and

intestinal

barrier

dysfunction

[22].

Probiotics-mediated competitive exclusion of pathogens represents a promising strategy to prevent infection [23]. In our previous research, L. casei ATCC 393 exhibited competitively inhibitory effect on the adherence of ETEC K88 to IPEC-J2 cells. In order to alleviate the early weaning symptoms, probiotics are the one of ideal nutritional options [24]. It will promote the development and application of probiotics as a promising feed additives as the beneficial effect mechanism of probiotics is clarified. Prior supplementation with E. faecium in piglets can modulate the barrier function and transport

23

Journal Pre-proof

properties of intestinal tissues and the increase of cytokines expression caused by ETEC [6]. ALP reflects the intestinal epithelial permeability indirectly. The intestinal epithelial barrier integrity is usually evaluated by measuring TEER and permeability for FITC-dextran, [3H]-D-mannitol, and [14C]-Carboxyl inulin. Pretreatment with L. plantarum prevented the decrease of TEER in IPEC-J2 cells [25]. Pretreatment of IPEC-J2

of

with L. reuteri reduced the permeability of FITC-dextran and increase TEER, and

ro

counteracted the detrimental effect caused by ETEC [7]. In the study, we also observed that

-p

pretreatment with L. casei ATCC 393 reduced ALP activity and prevented the reduction in

re

TEER and reduced the permeability of FITC-dextran, which indicated that L. casei ATCC

lP

393 exerted protective effect against ETEC-induced intestinal epithelial integrity disruption. L. casei DN-114 001 maintains the paracellular permeability in T84 cells

na

infected by enteropathogenic Escherichia coli (EPEC) [26]. L. casei counteracts intestinal

Jo ur

epithelial barrier dysfunctions in Caco-2 cells [27]. As for the intestinal epithelium, the intercellular junctions form a selective mechanical barrier [28]. Translocation of enteric pathogen and endotoxin alters the intestinal barrier integrity by targeting intestinal epithelial TJs [3]. L. plantarum pretreatment alleviated the decrease of Claudin-1, Occludin and ZO-1 protein expression levels in ETEC-infected IPEC-J2 cells [25]. Those current results suggest that L. casei ATCC 393 maintain the intestinal mucosal barrier integrity could be related to prevent ETEC K88-caused TJs damage. Probiotics can release bioactive factors that trigger activation of various cell signaling pathways, and further contribute to strengthen tight junctions and intestinal barrier function [28]. L. plantarum may improve

24

Journal Pre-proof

epithelial barrier dysfunction induced by ETEC K88 via TLRs, nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) signaling pathways [25]. The protective effect of L. casei ATCC 393 against intestinal barrier dysfunction caused by ETEC K88 may be through modulation of intestinal epithelial permeability and TJ proteins. MCs can release cytokines, chemokines, and growth factors which may influence many

of

biological processes such as responses to bacteria [29]. The increase of histamine, tryptase

ro

and cytokines were observed in patients with irritable bowel syndrome (IBS) [30].

-p

Intestinal mast cell activation mediates early-weaning-induced intestinal mucosal barrier

re

dysfunction in pigs, which can be relieved by MCs blockade [18]. MCs stabilizer

lP

counteracted the increase of ion secretion and trans epithelial transport of macromolecules [17]. Oral disodium cromoglycate effectively alleviates the release of MCs mediators and

na

increase of intestinal permeability induced by stress [31]. The reduce of TJ proteins

Jo ur

expression correlates with MCs activation [32]. Histamine, chymase and prostaglandin D2 released by MCs upon activation can modulate the secretion of chloride and water secretion, and intestinal epithelial permeability [33, 34]. Mast cells play an important role in the effect stress on intestinal permeability. MCs may be mediated the beneficial effects of probiotics. We found that pretreatment with L. casei ATCC 393 reversed the activation of PMMCs caused by ETEC K88. Treatment with L. rhamnosus JB-1 significantly inhibited MCs degranulation and release of MCs mediators [20]. MCs mediators play an important role in inflammatory responses [35]. MCs activation contributes to intestinal barrier dysfunction [36]. It is a promising measure for IBD therapy by stabilizing the MCs or blocking specific

25

Journal Pre-proof

MC mediators [37]. In addition, intestinal mucosal MCs blockaded by L. casei ATCC 393 effectively alleviated pathogenic bacteria ETEC K88-induced intestinal epithelial permeability damage. The protecting effect of probiotics on intestinal barrier function was mediated through mast cell derived 15d-PGJ2 [38]. Intestinal microbiota plays a crucial factor in maintaining intestinal barrier function [39].

of

Probiotic Lactobacillus plantarum ZLP001 enhances intestinal epithelial defense functions

ro

[40]. L. plantarum WCSF1 contributed to the relocation of Occludin and ZO-1 [41].

-p

Lactobacilli strains reverse enteropathogenic E. coli O26:H11-induced intestinal epithelial

re

cell damage through regulating TJ proteins redistribution [42]. Our data demonstrated a

lP

significant increase in microbial diversity in the L. casei ATCC 393 and ETEC K88 co-administration group. Several roles of MCs depend on their ability to secrete mediators

na

after being activated by a variety of stimuli [43]. The functions of intestinal mast cells

Jo ur

include regulating permeability, secretion, innate and adaptive immunity, etc [44]. The role of MCs mediators in intestinal epithelial secretion and permeability seems to be affected by not only histamine and serotonin but also several types of receptors and cytokines related to MCs. Similar to the above study in vitro, pretreatment with L. casei ATCC 393 significantly reduced the number of MCs, inhibited the activation of MCs and release of inflammatory factors, and increased TJs proteins expression levels. Lactobacilli can inhibit MCs activation via a variety of mechanisms such as bacterial genes [45]. Moreover, MCs have lines of receptors including TLRs. Each of TLRs recognizes microbial products [46]. In the study, L. casei ATCC 393 or cromolyn sodium improved the expression levels of

26

Journal Pre-proof

TLR2 and TLR4, which suggested that L. casei ATCC 393 may regulate mast cell activation induced by ETEC K88 via those receptors, and further regulate the intestinal barrier function. These results support that control of intestinal mucosal MCs activation may be explored to a potential target to alleviate intestinal epithelial barrier dysfunction and inflammation caused by pathogen infection.

of

Conclusions

ro

L. casei ATCC 393 did not exhibit toxic effect on IPEC-J2 and mice, and alleviated

-p

intestinal barrier dysfunction caused by ETEC K88 via TLRs-signaling-mediated MCs

re

pathway. The study is beneficial to reveal and understand the interaction of probiotics with

lP

intestinal epithelial cells and immunological effector cells such as MCs. L. casei ATCC 393 may be explored to modulate intestinal barrier dysfunction as a potential and promising

na

microecological food or feed additives. Moreover, L. casei ATCC 393 as MCs stabilizers

dysfunction.

Jo ur

could be recognized as a safe and promising therapeutic option for intestinal barrier

Author contributions

CX designed the topics, experiments, and charts, and wrote the manuscript. SY, YG, LQ, and LM assisted with the supplemental experiments and data analysis. XD and BZ provided the experimental support. Conflict of interest statement The authors declare that there are no conflicts of interest. Funding

27

Journal Pre-proof

This study was funded by the National Natural Science Foundation of China (No.31672435) and the Key Research and Development Program of Shaanxi Province (No.2018NY-102). References [1] H.Y. Liu, S. Roos, H. Jonsson, D. Ahi, J. Dicksved, J.E. Lindberg, and et al, Effects of

of

Lactobacillus johnsoniii and Lactobacillus reuteri on gut barrier functon and heat shock

ro

proteins in intestnal porcine epithelial cells, Physiol Reports. 3 (2015) e12355.

-p

[2] J.D. Dubreuil, Enterotoxigenic Escherichia coli and probiotics in swine: what the bleep

re

do we know? Bioscience of Microbiota, Food Health. 36 (2017) 75-90.

lP

[3] J.D. Dubreuil, Enterotoxigenic Escherichia coli targeting intestinal epithelial tight

129-134.

na

junctions: an effective way to alter the barrier integrity, Microb Pathog. 113 (2017)

Jo ur

[4] D. Ulluwishewa, R.C. Anderson, W.C. McNabb, P.J. Moughan, J.M. Wells, N.C. Roy, Regulation of tight junction permeability by intestinal bacteria and dietary components, J Nutr. 141 (2011) 769-776.

[5] R. Ducatelle, V. Eeckhaut, F. Haesebrouck, F. Van Immerseel, A review on prebiotics and probiotics for the control of dysbiosis: present status and future perspectives, Animal. 9 (2015) 43-48. [6] U. Lodemann, S. Amasheh, J. Radloff, M. Kern, A. Bethe, L.H. Wieler, and et al， Effects of Ex Vivo infection with ETEC on jejunal barrier properties and cytokine expression in probiotic-supplemented pigs, Dig Dis Sci. 62 (2017) 922-933.

28

Journal Pre-proof

[7] S. Karimi, H. Jonsson, T. Lundh, S. Roos, Lactobacillus reuteri strains protect epithelial barrier integrity of IPEC-J2 monolayers from the detrimental effect of enterotoxigenic Escherichia coli, Physiol Rep. 6 (2018) e13514. [8] L.Y. Wan, Z.J. Chen, N.P. Shah, H. EI-Nezami, Modulation of intestinal epithelial defense responses by probiotic bacteria, Crit Rev Food Sci Nutr. 56 (2016) 2628-2641.

milk

administration

on

gastrointestinal

survival

of

ro

probiotic-fermented

of

[9] M. Sidira, A. Galanis, P. Ypsilantis, A. Karapetsas, Z. Progaki, C. Simopoulos, Effect of

-p

Lactobacillus casei ATCC 393 and modulation of intestinal microbial flora, J Mol

re

Microbiol Biotechnol. 19 (2010) 224–230.

lP

[10] M. Sidira, A. Karapetsas, A. Galanis, M. Kanellaki, Y. Kourkoutas, Effective survival of immobilized Lactobacillus casei during ripening and heat treatment of probiotic

Jo ur

(2014) 948–955.

na

dry-fermented sausages and investigation of the microbial dynamics, Meat Sci. 96

[11] A. Tiptiri-Kourpeti, K. Spyridopoulou, V. Santarmaki, G. Aindelis, E. Tompoulidou, E. Lamprianidou, and et al, Lactobacillus casei exerts anti-proliferative effects accompanied by apoptotic cell death and up-regulation of TRAIL in colon carcinoma cells, PloS One. 11 (2016) e0147960. [12] G. Saxami, P. Ypsilantis, M. Sidira. C. Simopoulos, Y. Kourkoutas, A. Galanis, Distinct adhesion of probiotic strain Lactobacillus casei ATCC 393 to rat intestinal mucosa, Anaerobe. 18 (2012) 417-420. [13] B.L. Mclamb, A.J. Gibson, E.L. Overman, C. Stahi, A.J. Moeser, Early weaning stress

29

Journal Pre-proof

in pigs impairs innate mucosal immune responses to enterotoxigenic E. coli chanllenge and exacerbates intestinal injury and clinical disease, PloS One. 8 (2013) e59838. [14] S.N. Abraham, A.L. St John, Mast cell-orchestrated immunity to pathogens, Nat Rev Immunol. 10 (2010) 440-452. [15] S.C. Bischoff, Role of mast cells in allergic and non-allergic immune responses:

of

comparison of human and murine data, Nat Rev Immunol. 7 (2007) 93-104.

ro

[16] I.H. Lee, H.S. Kim, S.H. Seo, Porcine mast cells infected with H1N1 influenza virus

-p

release histamine and inflammatory cytokines and chemokines, Arch Virol. 162 (2017)

re

1067-1071.

lP

[17] J. Santos, P.C. Yang, J.D. Soderholm, M. Benjamin, M.H. Perdue, Role of mast cells in

630-636.

na

chronic stress induced colonic epithelial barrier dysfunction in the rat, Gut. 48 (2001)

Jo ur

[18] A.J. Moeser, K.A. Ryan, P.K. Nighot, A.T. Blikslager, Gastrointestinal dysfunction induced by early weaning is attenuated by delayed weaning and mast cell blockade in pigs, Am J Physiol Gastrointest Liver Physiol. 292 (2007) 173-181. [19] M.C. Lewis, D.V. Patel, J. Fowler, S. Duncker, A.W. Zuercher, A. Mercenier, and et al, Dietary supplementation with Bifidobacterium lactis NCC2818 from weaning reduces local immunoglobulin production in lymphoid-associated tissues but increases systemic antibodies in healthy neonates, Br J Nutr. 110 (2013) 1243-1252. [20] P. Forsythe, B.X. Wang, I. Khambati, W.A. Kunze, Systemic effects of ingested Lactobacillus rhamnosus: inhibition of mast cell membrane potassium(IKCa) current

30

Journal Pre-proof

and degranulation, Plos One. 7 (2012) e41234. [21] C.Y. Chen, G.W. Nace, P.L. Irwin. A 6×6 drop method for simultaneous colony counting and MPN enumeration of Campylobacter jejuni, Listeria monocytogenes, and Escherichia coli. J Microbiol. Meth. 55(2003) 475-479. [22] R. Gresse, F. Chaucheyras-Durand, M.A. Fleury, T. Van de Wiele, E. Forano, S.

of

Blanquet-Diot, Gut microbiota dysbiosis in postweaning piglets: understanding the

ro

keys to health, Trends Microbiol. 25 (2017) 851-873.

re

Biotechnol. 13 (2002) 97-112.

-p

[23] G. Reid, R. Friendship, Alternatives to antibotic use: probiotics for the gut, Anim

lP

[24] J.P. Lalles, P. Bosi, H. Smidt, C.R. Stokes, Nutritional management of gut health in pigs around weaning, Proc Nutr Soc. 66 (2007) 260-268.

na

[25] Y. Wu, C. Zhu, Z. Chen, Z. Chen, W. Zhang, X. Ma, and et al, Protective effects of

Jo ur

lactobacillus plantarum on epithelial barrier disruption caused by enterotoxigenic escherichia coli in intestinal porcine epithelial cells, Vet Immunol Immunop. 172 (2016) 55-63.

[26] N. Parassol, M. Freitas, K. Thoreux, G. Dalmasso, R. Bourdet-Sicard, P. Rampal, Lactobacillus casei DN-114 001 inhibits the increase in paracellular permeability of enteropathogenic Escherichia coli-infected T84 cells, Res Microbiol. 156 (2005) 256-262. [27] C.S. Eun, Y.S. Kim, D.S. Han, J.H. Choi, A.R. Lee, Y.K. Park, Lactobacillus casei prevents impaired barrier function in intestinal epithelial cells, Apmis. 119 (2011)

31

Journal Pre-proof

49-56. [28] T. Suzuki, Regulation of intestinal epithelial permeability by tight junctions, Cell Mol Life Sci. 70 (2013) 631-659. [29] R.K. Rao, G. Samak, Protection and restitution of gut barrier by probiotics: nutritional and clinical implications, Curr Nutr Food Sci. 9 (2013) 99-107.

of

[30] K. Mukai, M. Tsai, H. Saito, S.J. Galli, Mast cells as sources of cytokines, chemokines,

ro

and growth factors, Immunol Rev. 282 (2018) 121-150.

-p

[31] M.W. Wouters, M. Vicario, J. Santos, The role of mast cells in functional GI disorders.

re

Gut, 65 (2016) 155-168.

lP

[32] T. Vanuytsel, W.S. Van, H. Vanheel, C. Vanormelingen, S. Verschueren, E. Houben, and et al, Psychological stress and corticotropin-releasing hormone increase intestinal

Jo ur

1293-1299.

na

permeability in humans by a mast cell-dependent mechanism, Gut. 63 (2014)

[33] C. Martinez, M. Vicario, L. Ramos, B. Lobo, J.L. Mosquera, C. Alonso, and et al, Thejejunum of diarrhea-predominant irritable bowel syndrome shows molecular alterations in the tight junction signaling pathway that are associated with mucosal pathobiology and clinical manifestations, Am J Gastroenterol. 107 (2012) 736-746. [34] C. Alonso, M. Vicario, M. Pigrau, B. Lobo, J. Santos, Intestinal barrier function and the brain-gut axis, Adv Exp Med Biol. 817 (2014) 73-113. [35] K.R. Groschwitz, R. Ahrens, H. Osterfeld, M.F. Gurish, X. Han, M. Abrink, and et al, Mast cells regulate homeostatic intestinal epithelial migration and barrier function by a

32

Journal Pre-proof

chymase/Mcpt4-dependent mechanism, Proc Natl Acad Sci USA. 106 (2009) 22381-22386. [36] J. Pastwinska, J. Aqier, J. Dastych, E. Brzezinska-Blaszczyk, Mast cells as the strength of the inflammatory process, Pol J Pathol. 68 (2017) 187-196. [37] S.A. Snoek, S. Dhawan, S.H. Van Bree, C. Cailotto, S.A. van Diest, J.M. Duarte, and

of

et al, Mast cells trigger epithelial barrier dysfunction, bacterial translocation and

ro

postoperative ileus in a mouse model, Neurogastroenterol Motil. 24 (2012) 172-191.

-p

[38] B.Y. De Winter, R.M. van den Wijngaard, W.J. de Jonge, Intestinal mast cells in gut

re

inflammation and motility disturbances, Biochim Biophys Acta. 1822 (2012) 66-73.

lP

[39] A. Carlsson, Role of mast cells and probiotics in the regulation of intestinal barrier function, Language Assessment Quarterly. 10 (2013) 274-291.

na

[40] K. Hippala, H. Jouhten, A. Ronkainen, A. Hartikainen, V. Kainulainen, J. Jalanka, and

Jo ur

et al, The potential of gut commensals in reinforcing intestinal barrier function and alleviating inflammation, Nutrients. 10 (2018) e988. [41] J. Wang, H. Ji, S. Wang, H. Liu, W. Zhang, D. Zhang, and et al, Probiotic Lactobacillus plantarum promotes intestinal barrier function by strengthening the epithelium and modulating gut microbiota, Front Microbiol. 9 (2018) 1953. [42] S. Ahrne, M.L. Hagslatt, Effect of lactobacilli on paracellular permeability in the gut, Nutrients. 3 (2011)104-117. [43] R. Jariwala, H. Mandal, T. Bagchi, Indigenous lactobacilli strains of food and human sources reverse enteropathogenic E. coli O26:H11-induced damage in intestinal

33

Journal Pre-proof

epithelial cell lines: effect on redistribution of tight junction proteins, Microbiology. 163 (2017) 1263-1272. [44] S.C. Bischoff, Physiological and pathophysiological functions of intestinal mast cells, Semin. Immunopathol. 31 (2009) 185–205. [45] L. Cassard, A.I. Lalanne, P. Garault, A. Cotillard, C. Chervaux, M. Wels and et al,

of

Individual strains of Lactobacillus paracasei differentially inhibit human basophil and

ro

mouse mast cell activation, Immun Inflamm Dis. 4 (2016) 289-299.

Jo ur

na

lP

re

Crit Rev Immunol. 31 (2011) 475-529.

-p

[46] A.M. Gilfillan, M.A. Beaven, Regulation of mast cell responses in health and disease,

34