- Email: [email protected]
Lactococcus lactis displayed neuraminidase confers cross protective immunity against influenza A viruses in mice
Virology 476 (2015) 189–195
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/yviro
Lactococcus lactis displayed neuraminidase confers cross protective immunity against influenza A viruses in mice Han Lei a,b,n, Xiaojue Peng a, Daxian Zhao a, Jiexiu Ouyang a, Huifeng Jiao a, Handing Shu a, Xinqi Ge a a b
Department of Biotechnology, College of Life Science, Nanchang University, Jiangxi 330031, China Department of Biomedical Engineering, State University of New York, Binghamton, 13902, USA
art ic l e i nf o
a b s t r a c t
Article history: Received 9 October 2014 Returned to author for revisions 6 November 2014 Accepted 8 December 2014
Influenza A viruses pose a serious threat to public health. Current influenza A vaccines predominantly focus on hemagglutinin (HA) and show strain-specific protection. Neuraminidase (NA) is much less studied in the context of humoral immunity against influenza A viruses. The purpose of this study is to evaluate the cross protective immunity of NA presented on Lactococcus lactis (L.lactis) surface against homologous and heterologous influenza A viruses in the mouse model. L.lactis/pNZ8110-pgsA-NA was constructed in which pgsA was used as an anchor protein. Mice vaccinated orally with L.lactis/pNZ8110pgsA-NA could elicit significant NA-specific serum IgG and mucosa IgA antibodies, as well as neuraminidase inhibition (NI) titers. Importantly, L.lactis/pNZ8110-pgsA-NA provided 80% protection against H5N1, 60% protection against H3N2 and H1N1, respectively. These findings suggest that recombinant L.lactis/pNZ110-pgsA-NA in the absence of adjuvant via oral administration can be served as an effective vaccine candidate against diverse strains of influenza A viruses. & 2014 Elsevier Inc. All rights reserved.
Keywords: L.lactis/pNZ8110-pgsA-NA Neuraminidase (NA) Cross protective immunity
Introduction Influenza A viruses, including H5N1, H3N2 and H1N1 subtypes, pose a potential pandemic threat to public health (Subbarao and Joseph, 2007). According to World Health Organization (WHO)'s statistics, as of January 2014, there have been a total of 650 confirmed human cases of H5N1 virus, with 386 deaths (59% mortality rate) in 15 countries since 2003. (Available online: http://www.who.int/influenza/ human_animal_interface/EN_GIP_20131008CumulativeNumberH5N1 cases.pdf). In the event that an H5N1 strain gains the ability to spread efficiently from human to human, the lack of subtype-specific immunity would make the human population highly vulnerable. In addition, currently licensed seasonal influenza vaccines are designed to protect humans from the prevailing strains of human influenza A lineages H1N1 and H3N2 and of influenza B virus. These vaccines' principal target is the most abundant viral surface antigen, hemagglutinin (HA), which anti-HA antibodies are often neutralizing, and are used routinely to assess vaccine immunogenicity (Wohlbold and Krammer, 2014). Neuraminidase (NA) is the second most abundant influenza surface glycoprotein and contributes to virus replication in several ways, most
n Corresponding author at: Department of Biotechnology, College of Life Science, Nanchang University, Nanchang, Jiangxi, 330031, China. Tel.: þ86 791 83969531. E-mail address: [email protected] (H. Lei).
http://dx.doi.org/10.1016/j.virol.2014.12.017 0042-6822/& 2014 Elsevier Inc. All rights reserved.
notably by removing sialic acids from the host and viral glycoproteins, releasing newly formed virus particles from infected cells (Lakdawala et al., 2011; Matrosovich et al., 2004; Palese et al., 1974). Although NA antibodies do not prevent attachment and entry of influenza virus into cells, they sharply limit virus spread (Kilbourne et al., 1968) and thereby contribute to immunity against influenza virus (Clements et al., 1986). NA-specific immunity has been reported to reduce the severity of clinical illness and viral shedding among infected persons (Marcelin et al., 2011; Murphy et al., 1972). Further, a mouse monoclonal antibody (MAb) specific for H5N1 viral NA has therapeutic benefit against H5N1 infection in mice and ferrets (Shoji et al., 2011). In addition, the NAs of currently circulating H5N1 viruses and human H1N1 viruses are classified in the same NA subtype and low levels of anti-NA cross-reactive antibodies to H5N1 viruses have been detected in human sera of unexposed humans (Lu et al., 2014). However, there have been no attempts to investigate cross-protective immunity of the NA as a novel universal vaccine against influenza H5N1, H3N2 and H1N1 viruses. It has been demonstrated that Lactococcus lactis (L.lactis) is an ideal vaccine delivery vector and has been engineered to express many viral antigens (Pontes et al., 2011; Wells and Mercenier, 2008). Our previous studies have shown that L.lactis, expressing hemaglutinin (HA) from A/chicken/Henan/12/2004(H5N1) and then coated by enteric capsule, is a safe and effective vaccine against homologous H5N1 virus infection in mice (Lei et al., 2010). Similarly, we also described that HA1 from A/chicken/Henan/12/
190
H. Lei et al. / Virology 476 (2015) 189–195
2004(H5N1) virus was displayed on the surface of L.lactis in which pgsA was used as an anchor protein, and showed it to be protective against homologous H5N1 virus by oral co-administration with CTB in mice (Lei et al., 2011). Recently, it also showed that intranasal immunization of L.lactis-HA combined with mucosal adjuvant LTB could provide complete protection against homologous H5N1 in chickens (Lei et al., 2014). However, these vaccines focus on raising humoral responses against HA, it remains largely unknown regarding the immunogenicity of NA presented on L.lactis surface in the absence of mucosal adjuvant via oral administration in the mouse model. We hypothesized that NA presented on L.lactis surface could provide cross protective immunity against homologous and heterologous influenza A viruses. To address this hypothesis, NA gene derived from A/Vietnam/1203/2004 (H5N1) (VN/1203/04) was designed to express on the surface of L.lactis, in which pgsA was used as an anchor protein (Lei et al., 2011). The immunogenicity of L.lactis/pNZ110-pgsA-NA was then evaluated via oral administration without the use of adjuvant in the mouse model. This study reported here suggests that L.lactis/pNZ110-pgsA-NA can induce significant humoral and mucosal antibodies to protect mice against homologous H5N1, heterologous H3N2 or H1N1 virus challenge. Further, these findings support that NA presented on L.lactis surface can be considered an alternative approach to develop a universal vaccine against influenza A viruses.
Results Expression of NA protein on L.lactis Recombinant pNZ8110-pgsA-NA plasmid expressing NA gene of A/ Vietnam/1203/2004 (H5N1) was constructed (Fig. 1A). Further, expression of NA protein on L.lactis NZ9000 was detected by western blotting using anti-NA monoclonal antibody (Fig. 1B). As we expected, there is no band shown in the L.lactis/pNZ8110-pgsA control cells, while a specific band was observed at expected size for pgsA-NA fusion protein (approximately 100 kDa) (Fig. 1B, Lane 2) in the L.lactis/pNZ8110-pgsANA cells. To determine whether NA protein was expressed on the surface of L.lacti, L.lactis/pNZ8110-pgsA-NA was incubated with mouse anti-NA monoclonal antibody for binding, and followed by FITC conjugated goat anti-mouse IgG and then detected by immunofluorescence assay and flow cytometry (FACS) analysis. L.lactis/ pNZ8110-pgsA-NA showed a higher specific and positive signal than L.lactis/pNZ8110-pgsA control (Fig. 1C and D). These results demonstrate NA protein is located on the surface of L.lactis. Immune responses elicited d by oral administration of L.lactis/ pNZ8110-pgsA-NA At day 17 and day 37 after the first immunization, sera samples were obtained from all mice to screen for antibody responses as a marker of immunogenicity. There was no significant serum IgG detected in the saline, L.lactis/pNZ8110-pgsA and L.lactis/pNZ8110pgsA-NA groups at day 17 after the first immunization. However, mice administered orally with L.lactis/pNZ8110-pgsA-NA could elicit a higher significant NA-specific IgG titer than saline or L.lactis/pNZ8110-pgsA group at day 37 after the first immunization, (Fig. 2A). To assess whether L.lactis/pNZ8110-pgsA-NA could induce the mucosal immune responses, intestinal and upper respiratory washes were collected at day 17 and day 37 after the first immunization. As shown in Fig. 2C and D, there was no significant IgA produced in all groups at day 17. Whereas, L.lactis/pNZ8110pgsA-NA induced significantly detectable levels of NA-specific
mucosal IgA compared to saline or L.lactis/pNZ8110-pgsA group at day 37 in the intestinal and upper respiratory washes. These data indicate that mice vaccinated orally with L.lactis/ pNZ8110-pgsA-NA after prime-boost immunization can result in significant serum IgG and mucosal IgA levels which may contribute to protection against virus infection. Neuraminidase inhibition (NI) titers induced by L.lactis/pNZ8110pgsA-NA The sera isolated from the vaccinated mice were detected by NI assay. As shown in Fig. 2B, there were no significant NI titers of all groups detected at day 17. However, the NI titers in the L.lactis/ pNZ8110-pgsA-NA group could be significantly detected compared to saline or L.lactis/pNZ8110-pgsA group at day 37. These data are consistent with ELIA assay, mice vaccinated orally with L.lactis/ pNZ8110-pgsA-NA after the boost immunization could produce a higher NA-specific IgG antibody and also elicit significant NI titers which may prevent virus infection. Cross protective immunity against virus challenge At two weeks after the last immunization, all mice were challenged by intranasal inoculation with 20 ml of 104 TCID50 of A/Vietnam/1203/2004(H5N1), A/Hong Kong/1/1968 (H3N2) or A/California/04/2009(H1N1) virus. The control groups that received saline or L.lactis/pNZ8110-pgsA experienced substantial weight loss beginning at day 2 post challenge, a high level of lung virus titer and death by 6 to 8 days post infection. In contrast, mice immunized orally with L.lactis/pNZ8110-pgsA survived 80% against H5N1 challenge, 60% against H3N2 and H1N1 virus challenge, respectively. Further, these survived mice showed slight loss of body weight and a lower virus titer in the lung (Fig. 3). Taken together, these results provide evidence that L.lactis/pNZ8110pgsA-NA is a safe and effective immunogen to induce cross protective immunity against homologous H5N1 and heterologous H3N2 and H1N1 in mice.
Discussion Most of the current approaches to vaccine design focus on measuring the antibody response to influenza A HA, the predominant homotrimeric glycoprotein located on the surface of the virus (Wohlbold and Krammer, 2014). In the scope of influenza virus research, relatively little attention is given to the NA, and while the use of NA as a vaccine antigen is studied by only a small pocket of investigators, recent evidence has reignited interest in the potential use of NA in vaccine design as well as the ability of NA-directed antibodies to confer protection against a range of influenza virus subtypes (Marcelin et al., 2012). Indeed, the possibility of NA-based protection has been recognized by the international vaccine community, and the proposal to somehow standardize the amount of NA in vaccine formulations has been entertained at past WHO conferences on influenza virus vaccine development (Bright et al., 2009; Eichelberger et al., 2008). More recently, one group identified a universally conserved NA peptide sequence (222–230: I–L–R–T–Q– E–S–E/S–C) that is 100% conserved in all influenza A virus subtypes as well as in the NAs of influenza B strains, and conferred cross protection against diverse strains of influenza viruses (Doyle et al., 2013). Thus, NA offers the potential for the development for a new novel universal influenza vaccine. Understandably, the induction of mucosal immunity via mucosal administration (oral or intranasal) is necessary to ensure protection against multiple subtypes of influenza A virus. Secretion of IgA is a representative antibody of mucosal immune response, and confers
H. Lei et al. / Virology 476 (2015) 189–195
191
1 pNis Promoter
pgsA
GS linker
FITC
2
NA ~ 100 kDa
FITC
Fig. 1. Expression of NA displayed on L.lactis surface. (A) Schematic diagram of L.lactis/pNZ8110-pgsA-NA. A GS linker inserted between pgsA and NA to stabilize the NA protein expression. (B) Western blot analysis. Lane 1: L.lactis/pNZ8110-pgsA; Lane 2: L.lactis/pNZ8110-pgsA-NA. (C) Immunofluorescence microscopy assay of NA protein. L.lactis/pNZ8110-pgsA (left) and L.lactis/pNZ8110-pgsA-NA (right) (magnification: 1000 ). (D) Flow cytometric analysis of NA display on L.lactis surface. L.lactis/pNZ8110pgsA (left) and L.lactis/pNZ8110-pgsA-NA (right; positive rate: 60.3%).
efficient protection against acquired mucosal infection (Wells and Mercenier, 2008). Furthermore, antigen presented on L.lactis surface is more immunogenic, and easier to recognize by immune system (Lei et al., 2011; Wells and Mercenier, 2008). We have shown previously that L.lactis is an ideal mucosal vehicle for influenza vaccine inducing significant humoral IgG and mucosal IgA antibodies against homologous H5N1 virus infection in the mouse or chicken model (Lei et al., 2010, 2011, 2014). However, little is known regarding the immunogenicity of NA presented on L.lactis surface, since NA is another major glycoprotein on the surface of the virus and has historically served as the target for antiviral drug therapy and is much less studied in the context of humoral immunity against divergent influenza A viruses (Wohlbold and Krammer, 2014). Based on this knowledge, we identified NA presented on L.lactis surface by immunofluorescence assay and flow cytometric analysis (Fig. 1C and D) in which pgsA was used as an anchor protein displaying HA1 protein of H5N1 virus, as described previously (Lei et al., 2011) and investigated its immunogenicity after optimizing the schedule and dosage for oral administration compared with our previous studies (Lei et al., 2011). It is generally accepted that anti-NA antibodies are thought to be non-neutralizing, but the well-established role for NA antibodies is to
provide a reduction in virus replication (Chen et al., 2012). In this study, anti-NA antibodies induced by L.lactis/pNZ8110-pgsA-NA were determined by ELISA and NI assay, respectively. It was shown that L.lactis/pNZ8110-pgsA-NA could elicit significant serum IgG and mucosal IgA antibodies responses, as well as NI titers which may contribute to reducing virus replication. Interestingly, we determined virus titer in the lung of mice vaccinated orally with L.lactis/pNZ8110pgsA-NA after virus challenge, and discovered that antibodies to NA did positively correlate with virus shedding in lung. Consistent with a recent report showing that antibodies against NA playing crucial roles during viral replication (Doyle et al., 2013), our study demonstrated that the cross-reactivity of L.lactis/pNZ8110-pgsA-NA induced NA antisera to divergent influenza A viruses limited virus spread, thus supporting this idea. The development of a universal influenza A vaccine is one of the major goals in global pandemic preparedness plans. The current strategy for designing a universal influenza vaccine aims to skew the humoral immune response (Wohlbold and Krammer, 2014). In this case, NA antibodies also contribute to cross-protective immunity against influenza A viruses. In our studies, L.lactis/pNZ8110pgsA-NA conferred 80% protection against homologous H5N1, and 60% protection against H3N2 and H1N1, respectively. Although
192
H. Lei et al. / Virology 476 (2015) 189–195
Fig. 2. Immune responses in mice. Sera, intestine and upper respiratory washes were collected from mice vaccinated orally with saline, L.lactis/pNZ8110-pgsA or L.lactis/ pNZ8110-pgsA-NA at day 17 and day 37 after the first immunization. (A) NA-specific IgG antibody responses in the sera (n¼ 16 mice/group). (B) NA-specific IgA antibody responses in the intestine washes (n¼ 3 mice /group). (C) NA-specific IgA antibody responses in the upper respiratory washes (n ¼3 mice/group). (D) NI titers (n¼ 16 mice/ group). The value less than 24 is considered no significance. Data are represented as mean7 SD. Asterisk indicates significant difference, as compared to saline and L.lactis/ pNZ8110-pgsA controls (po 0.05).
L.lactis/pNZ8110-pgsA-NA did not confer 100% protective efficacy against homologous and heterologous influenza A viruses, this study suggests ideal protection provided by L.lactis/pNZ8110-pgsANA requires the coordinated efforts of enhancing its immunogenicity either which includes some combination of the NA and HA antigen (Johansson and Cox, 2011), or combines with the use of the mucosal adjuvant. Collectively, our findings agree with that NA is an attractive antigen for developing a novel universal influenza vaccine. In conclusion, our findings strongly support oral administration of mice with L.lactis/pNZ8110-pgsA-NA in the absence of adjuvant can induce significant humoral and mucosal immune responses, as well as NI titers. Given the induction of cross-protective immunity in the vaccinated mice, L.lactis/pNZ8110-pgsA-NA would likely provide a significant barrier to the spread of influenza A virus and also be economically advantageous for influenza vaccine development. Thus, L.lactis/pNZ8110-pgsA-NA may be a promising candidate for a universal influenza vaccine.
Materials and methods Construction of L.lactis vector The NA gene (1459 bp) of A/Vietnam/1203/2004 (H5N1) was PCR-amplified from pCDNA3.1-HA (kindly provided by St. Jude Children's Research Hospital, Memphis, TN, USA) using the following primers: NA-F: CTAGCTAGCGGTACCGCCGCCACCATGAA (Nhe I); NA-R: CCGAATTCACAGGAAGTATTCAATC (EcoR I) and cloned into pNZ8110-pgsA (Lei et al., 2011), the resulting plasmid pNZ8110pgsA-NA was transformed into competent L.lactis NZ9000, the positive clone was named L.lactis/pNZ8110-pgsA-NA. Western blotting The expression level of NA protein was determined by Western blot analysis as described previously (Lei et al., 2011). Briefly, 108 cells of L.lactis/pNZ8110-pgsA-NA pellets were washed three times
H. Lei et al. / Virology 476 (2015) 189–195
193
Fig. 3. Protection efficacy against lethal challenge with different influenza A viruses in mice. The results are expressed in terms of percent body weight (A, B and C) (n ¼10 mice/group), lung virus titer (D, E and F) (n¼ 3 mice/group) at day 5 post-infection and percent survival (G, H and I) (n¼ 10 mice/group). Two weeks after the last immunization, mice were intranasally infected with 20 ml of 104 TCID50 of lethal dose of A/Vietnam/1203/2004(H5N1) (A, D and G), A/Hong Kong/1/1968 (H3N2) (B, E and H) or A/California/04/2009(H1N1) (C, F and I). Data of weight changes and lung virus titers are represented as mean 7 SD. Asterisk indicates significant difference, as compared to saline and L.lactis/pNZ8110-pgsA controls (p o 0.05).
with 500 ml of sterile saline, and then re-suspended with 50 ml of 6 loading buffer and boiled for 10 min. Treated samples were run on SDS-polyacrylamide gel electrophoresis and then transferred to nitrocellulose membrane (Bio-rad, Hercules, California, USA). After blocking with 5% skim milk at room temperature for 2 h, the membrane was incubated with a monoclonal mouse
anti-NA antibody (kindly provided by Beiresource, Manassas, VA, USA). After incubated overnight at 4 1C, and then followed by affinity-purified horseradish peroxidase (HRP)-conjugated antimouse IgG (Sigma-Aldrich Corporation, St. Louis, MO, USA). The membrane was reacted with the West Pico Chemiluminescent Substrate (Thermo Fisher Scientific Inc., Rockford, IL, USA) and
194
H. Lei et al. / Virology 476 (2015) 189–195
Fig. 3. (continued)
imaged using Molecular Imager ChemiDoc XRS System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). L.lactis/pNZ8110-pgs cells were used as a negative control. Immunofluorescence assay and flow cytometry analysis NA protein displayed on the surface of L.lactis was analyzed by immunofluorescence assay (Leica DM4000B, Germany) and flow cytometry (FACS) analysis (BD FacsCalibur, BD Bioscience, San Jose, CA, USA). Briefly, 108 cells of L.lactis/pNZ8110-pgsA-NA were washed three times with sterile saline containing 0.5% bovine serum albumin (BSA) and then incubated with monoclonal mouse anti-NA antibody at 4 1C for 1 h, followed by a FITC-conjugated goat anti-mouse IgG at 4 1C for 30 min and re-suspended with 500 ml of sterile saline. Finally, L.lactis/pNZ8110-pgsA-NA cells were used for immunofluorescence assay and FACS analysis, respectively. L.lactis/pNZ8110-pgsA cells were used as a negative control.
used as controls. Sera, intestinal and upper respiratory washes were obtained at day 17 and day 37 after the first immunization. At two weeks after the last immunization, all vaccinated mice were lightly anesthetized with CO2 and inoculated intranasally with 20 ml of 104 EID50 of A/Vietnam/1203/2004 (H5N1), A/Hong Kong/1/1968 (H3N2) or A/California/04/2009(H1N1). Mice were observed for illness, weight loss, and death for 14 days after virus infection. Lung virus titer was determined. Lungs from vaccinated mice were harvested at day 5 postinfection. Tissue samples were homogenized and processed as described previously (Boon et al., 2010). The titer of virus in each sample was calculated by the Reed and Muench method (Reed and Muench, 1938) and expressed as 50% tissue culture infective dose (TCID50). All animal experiments were carried out in accordance with the Guideline for Animal Experiment prescribed and approved by an Institutional Animal Care and Use Committee (IACUC) of Nanchang University. Virus challenge experiments must be strictly performed under the enhanced bio-safety level-3 laboratory (BSL-3).
Animal experiments and sample collection Enzyme-linked immunosorbent assay (ELISA) Specific-pathogenic-free (SPF) six-week-old female BALB/c mice were used (SLC Company, Shanghai, China) in this study. The concentration of recombinant L.lactis/pNZ8110-pgsA-NA was adjusted to 1012 colony forming unit (CFU)/ml with sterile saline. Mice (16 mice/group) were immunized orally with 1012 CFU of L.lactis/pNZ8110-pgsA-NA at day 0, 1, 2, 3 and boosted at day 20, 21, 22, 23. In the meantime, L.lactis/pNZ8110-pgsA and saline were
Immune sera from the vaccinated mice were collected by bleeding from posterior orbital venous plexus at day 17 and day 37. NA-specific immunoglobulin G (IgG) and secretory immunoglobulin A (IgA) antibodies were detected by enzyme-linked immunosorbent assay (ELISA) using recombinant NA protein of A/Vietnam/1203/2004 (H5N1) as a coating antigen as described
H. Lei et al. / Virology 476 (2015) 189–195
previously (Lei et al., 2010). ELISA end point titers were expressed as the highest dilution that yielded an optical density greater than twice the mean plus one standard deviation of that of similarly diluted negative control samples. Neuraminidase inhibition (NI) assay A miniaturized format of the conventional NI assay was applied to detect the NA specific antibody titers (Sandbulte et al., 2009). Briefly, 50 μl of mice sera from each group was taken at 2-fold serial dilutions in a 96-well micro-titer plate. 50 μl of purified rNA (0.25 mg/ml) (kindly provided by Beiresource, Manassas, VA, USA) was added to each well and incubated at 37 1C for 2 h. The neuraminidase inhibition titer was represented as the highest dilution until there was no neuraminidase activity observed. Statistical analysis Data are presented as the means 7standard deviations (S.D.). All analysis for statistically significant differences was performed by the Student t test and one-way ANOVA. A p value less than 0.05 was considered to be significant. Acknowledgments This work was supported by grants from National Natural Science Foundation of China (No. 31360225) and Natural Science Foundation of Jiangxi Province (No. 20114BAB214014) to H. Lei. References Boon, A.C., deBeauchamp, J., Krauss, S., Rubrum, A., Webb, A.D., Webster, R.G., McElhaney, J., Webby, R.J., 2010. Cross-reactive neutralizing antibodies directed against pandemic H1N1 2009 virus are protective in a highly sensitive DBA/2 mouse influenza model. J Virol 84, 7662–7667. Bright, R.A., Neuzil, K.M., Pervikov, Y., Palkonyay, L., 2009. WHO meeting on the role of neuraminidase in inducing protective immunity against influenza infection, Vilamoura, Portugal, September 14, 2008. Vaccine 27, 6366–6369. Chen, Z., Kim, L., Subbarao, K., Jin, H., 2012. The 2009 pandemic H1N1 virus induces anti-neuraminidase (NA) antibodies that cross-react with the NA of H5N1 viruses in ferrets. Vaccine 30, 2516–2522. Clements, M.L., Betts, R.F., Tierney, E.L., Murphy, B.R., 1986. Serum and nasal wash antibodies associated with resistance to experimental challenge with influenza A wild-type virus. J. Clin. Microbiol. 24, 157–160. Doyle, T.M., Hashem, A.M., Li, C., Van Domselaar, G., Larocque, L., Wang, J., Smith, D., Cyr, T., Farnsworth, A., He, R., Hurt, A.C., Brown, E.G., Li, X., 2013. Universal antineuraminidase antibody inhibiting all influenza A subtypes. Antivir. Res. 100, 567–574. Eichelberger, M., Golding, H., Hess, M., Weir, J., Subbarao, K., Luke, C.J., Friede, M., Wood, D., 2008. FDA/NIH/WHO public workshop on immune correlates of protection against influenza A viruses in support of pandemic vaccine
195
development, Bethesda, Maryland, US, December 10–11, 2007. Vaccine 2008 (26), 4299–4303. Johansson, B.E., Cox, M.M., 2011. Influenza viral neuraminidase: the forgotten antigen. Expert Rev. Vaccines 10, 1683–1695. Kilbourne, E.D., Laver, W.G., Schulman, J.L., Webster, R.G., 1968. Antiviral activity of antiserum specific for an influenza virus neuraminidase. J. Virol. 2, 281–288. Lakdawala, S.S., Lamirande, E.W., Suguitan Jr, A.L., Wang, W., Santos, C.P., Vogel, L., Matsuoka, Y., Lindsley, W.G., Jin, H., Subbarao, K., 2011. Eurasian-origin gene segments contribute to the transmissibility, aerosol release, and morphology of the 2009 pandemic H1N1 influenza virus. PLoS Pathog. 7, e1002443. Lei, H., Peng, X., Shu, H., Zhao, D., 2014. Intranasal immunization with live recombinant Lactococcus lactis combined with heat-labile toxin B subunit protects chickens from highly pathogenic avian influenza H5N1 virus. J. Med. Virol. , http://dx.doi.org/10.1002/jmv.23983. Lei, H., Sheng, Z., Ding, Q., Chen, J., Wei, X., Lam, D.M., Xu, Y., 2011. Evaluation of oral immunization with recombinant avian influenza virus HA1 displayed on the Lactococcus lactis surface and combined with the mucosal adjuvant cholera toxin subunit B. Clin. Vaccine Immunol. 18, 1046–1051. Lei, H., Xu, Y., Chen, J., Wei, X., Lam, D.M., 2010. Immunoprotection against influenza H5N1 virus by oral administration of eneteric coated recombinant Lactococcus lactis mini-capsules. Virology 407, 319–324. Lu, X., Liu, F., Zeng, H., Sheu, T., Achenbach, J.E., Veguilla, V., Gubareva, L.V., Garten, R., Smith, C., Yang, H., Stevens, J., Xu, X., Katz, J.M., Tumpey, T.M., 2014. Evaluation of the antigenic relatedness and cross-protective immunity of the neuraminidase between human influenza A (H1N1) virus and highly pathogenic avian influenza A (H5N1) virus. Virology 454–455, 169–175. Marcelin, G., DuBois, R., Rubrum, A., Russell, C.J., McElhaney, J.E., Webby, R.J., 2011. A contributing role for anti-neuraminidase antibodies on immunity to pandemic H1N1 2009 influenza A virus. PLoS One 6, e26335. Marcelin, G., Sandbulte, M.R., Webby, R.J., 2012. Contribution of antibody production against neuraminidase to the protection afforded by influenza vaccines. Rev. Med. Virol. 22, 267–279. Matrosovich, M.N., Matrosovich, T.Y., Gray, T., Roberts, N.A., Klenk, H.D., 2004. Neuraminidase is important for the initiation of influenza virus infection in human airway epithelium. J. Virol. 78, 12665–12667. Murphy, B.R., Kasel, J.A., Chanock, R.M., 1972. Association of serum antineuraminidase antibody with resistance to influenza in man. N. Engl. J. Med. 286, 1329–1332. Palese, P., Tobita, K., Ueda, M., Compans, R.W., 1974. Characterization of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397–410. Pontes, D.S., de Azevedo, M.S., Chatel, J.M., Langella, P., Azevedo, V., Miyoshi, A., 2011. Lactococcus lactis as a live vector: heterologous protein production and DNA delivery systems. Protein Exp. Purif. 79, 165–175. Reed, L.J., Muench, H., 1938. A simple method of estimating fifty percent endpoints. The American Journal of Hygiene 27, 493–497. Sandbulte, M.R., Gao, J., Straight, T.M., Eichelberger, M.C., 2009. A miniaturized assay for influenza neuraminidase-inhibiting antibodies utilizing reverse genetics-derived antigens. Influenza Other Respir. Viruses 3, 233–240. Shoji, Y., Chichester, J.A., Palmer, G.A., Farrance, C.E., Stevens, R., Stewart, M., Goldschmidt, L., Deyde, V., Gubareva, L., Klimov, A., Mett, V., Yusibov, V., 2011. An influenza N1 neuraminidase-specific monoclonal antibody with broad neuraminidase inhibition activity against H5N1 HPAI viruses. Hum. Vaccines 7, 199–204. Subbarao, K., Joseph, T., 2007. Scientific barriers to developing vaccines against avian influenza viruses. Nat. Rev. Immunol. 7, 267–278. Wells, J.M., Mercenier, A., 2008. Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nat. Rev. Microbiol. 6, 349–362. Wohlbold, T.J., Krammer, F., 2014. In the shadow of hemagglutinin: a growing interest in influenza viral neuraminidase and its role as a vaccine antigen. Viruses 6, 2465–2494.
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/yviro
Lactococcus lactis displayed neuraminidase confers cross protective immunity against influenza A viruses in mice Han Lei a,b,n, Xiaojue Peng a, Daxian Zhao a, Jiexiu Ouyang a, Huifeng Jiao a, Handing Shu a, Xinqi Ge a a b
Department of Biotechnology, College of Life Science, Nanchang University, Jiangxi 330031, China Department of Biomedical Engineering, State University of New York, Binghamton, 13902, USA
art ic l e i nf o
a b s t r a c t
Article history: Received 9 October 2014 Returned to author for revisions 6 November 2014 Accepted 8 December 2014
Influenza A viruses pose a serious threat to public health. Current influenza A vaccines predominantly focus on hemagglutinin (HA) and show strain-specific protection. Neuraminidase (NA) is much less studied in the context of humoral immunity against influenza A viruses. The purpose of this study is to evaluate the cross protective immunity of NA presented on Lactococcus lactis (L.lactis) surface against homologous and heterologous influenza A viruses in the mouse model. L.lactis/pNZ8110-pgsA-NA was constructed in which pgsA was used as an anchor protein. Mice vaccinated orally with L.lactis/pNZ8110pgsA-NA could elicit significant NA-specific serum IgG and mucosa IgA antibodies, as well as neuraminidase inhibition (NI) titers. Importantly, L.lactis/pNZ8110-pgsA-NA provided 80% protection against H5N1, 60% protection against H3N2 and H1N1, respectively. These findings suggest that recombinant L.lactis/pNZ110-pgsA-NA in the absence of adjuvant via oral administration can be served as an effective vaccine candidate against diverse strains of influenza A viruses. & 2014 Elsevier Inc. All rights reserved.
Keywords: L.lactis/pNZ8110-pgsA-NA Neuraminidase (NA) Cross protective immunity
Introduction Influenza A viruses, including H5N1, H3N2 and H1N1 subtypes, pose a potential pandemic threat to public health (Subbarao and Joseph, 2007). According to World Health Organization (WHO)'s statistics, as of January 2014, there have been a total of 650 confirmed human cases of H5N1 virus, with 386 deaths (59% mortality rate) in 15 countries since 2003. (Available online: http://www.who.int/influenza/ human_animal_interface/EN_GIP_20131008CumulativeNumberH5N1 cases.pdf). In the event that an H5N1 strain gains the ability to spread efficiently from human to human, the lack of subtype-specific immunity would make the human population highly vulnerable. In addition, currently licensed seasonal influenza vaccines are designed to protect humans from the prevailing strains of human influenza A lineages H1N1 and H3N2 and of influenza B virus. These vaccines' principal target is the most abundant viral surface antigen, hemagglutinin (HA), which anti-HA antibodies are often neutralizing, and are used routinely to assess vaccine immunogenicity (Wohlbold and Krammer, 2014). Neuraminidase (NA) is the second most abundant influenza surface glycoprotein and contributes to virus replication in several ways, most
n Corresponding author at: Department of Biotechnology, College of Life Science, Nanchang University, Nanchang, Jiangxi, 330031, China. Tel.: þ86 791 83969531. E-mail address: [email protected] (H. Lei).
http://dx.doi.org/10.1016/j.virol.2014.12.017 0042-6822/& 2014 Elsevier Inc. All rights reserved.
notably by removing sialic acids from the host and viral glycoproteins, releasing newly formed virus particles from infected cells (Lakdawala et al., 2011; Matrosovich et al., 2004; Palese et al., 1974). Although NA antibodies do not prevent attachment and entry of influenza virus into cells, they sharply limit virus spread (Kilbourne et al., 1968) and thereby contribute to immunity against influenza virus (Clements et al., 1986). NA-specific immunity has been reported to reduce the severity of clinical illness and viral shedding among infected persons (Marcelin et al., 2011; Murphy et al., 1972). Further, a mouse monoclonal antibody (MAb) specific for H5N1 viral NA has therapeutic benefit against H5N1 infection in mice and ferrets (Shoji et al., 2011). In addition, the NAs of currently circulating H5N1 viruses and human H1N1 viruses are classified in the same NA subtype and low levels of anti-NA cross-reactive antibodies to H5N1 viruses have been detected in human sera of unexposed humans (Lu et al., 2014). However, there have been no attempts to investigate cross-protective immunity of the NA as a novel universal vaccine against influenza H5N1, H3N2 and H1N1 viruses. It has been demonstrated that Lactococcus lactis (L.lactis) is an ideal vaccine delivery vector and has been engineered to express many viral antigens (Pontes et al., 2011; Wells and Mercenier, 2008). Our previous studies have shown that L.lactis, expressing hemaglutinin (HA) from A/chicken/Henan/12/2004(H5N1) and then coated by enteric capsule, is a safe and effective vaccine against homologous H5N1 virus infection in mice (Lei et al., 2010). Similarly, we also described that HA1 from A/chicken/Henan/12/
190
H. Lei et al. / Virology 476 (2015) 189–195
2004(H5N1) virus was displayed on the surface of L.lactis in which pgsA was used as an anchor protein, and showed it to be protective against homologous H5N1 virus by oral co-administration with CTB in mice (Lei et al., 2011). Recently, it also showed that intranasal immunization of L.lactis-HA combined with mucosal adjuvant LTB could provide complete protection against homologous H5N1 in chickens (Lei et al., 2014). However, these vaccines focus on raising humoral responses against HA, it remains largely unknown regarding the immunogenicity of NA presented on L.lactis surface in the absence of mucosal adjuvant via oral administration in the mouse model. We hypothesized that NA presented on L.lactis surface could provide cross protective immunity against homologous and heterologous influenza A viruses. To address this hypothesis, NA gene derived from A/Vietnam/1203/2004 (H5N1) (VN/1203/04) was designed to express on the surface of L.lactis, in which pgsA was used as an anchor protein (Lei et al., 2011). The immunogenicity of L.lactis/pNZ110-pgsA-NA was then evaluated via oral administration without the use of adjuvant in the mouse model. This study reported here suggests that L.lactis/pNZ110-pgsA-NA can induce significant humoral and mucosal antibodies to protect mice against homologous H5N1, heterologous H3N2 or H1N1 virus challenge. Further, these findings support that NA presented on L.lactis surface can be considered an alternative approach to develop a universal vaccine against influenza A viruses.
Results Expression of NA protein on L.lactis Recombinant pNZ8110-pgsA-NA plasmid expressing NA gene of A/ Vietnam/1203/2004 (H5N1) was constructed (Fig. 1A). Further, expression of NA protein on L.lactis NZ9000 was detected by western blotting using anti-NA monoclonal antibody (Fig. 1B). As we expected, there is no band shown in the L.lactis/pNZ8110-pgsA control cells, while a specific band was observed at expected size for pgsA-NA fusion protein (approximately 100 kDa) (Fig. 1B, Lane 2) in the L.lactis/pNZ8110-pgsANA cells. To determine whether NA protein was expressed on the surface of L.lacti, L.lactis/pNZ8110-pgsA-NA was incubated with mouse anti-NA monoclonal antibody for binding, and followed by FITC conjugated goat anti-mouse IgG and then detected by immunofluorescence assay and flow cytometry (FACS) analysis. L.lactis/ pNZ8110-pgsA-NA showed a higher specific and positive signal than L.lactis/pNZ8110-pgsA control (Fig. 1C and D). These results demonstrate NA protein is located on the surface of L.lactis. Immune responses elicited d by oral administration of L.lactis/ pNZ8110-pgsA-NA At day 17 and day 37 after the first immunization, sera samples were obtained from all mice to screen for antibody responses as a marker of immunogenicity. There was no significant serum IgG detected in the saline, L.lactis/pNZ8110-pgsA and L.lactis/pNZ8110pgsA-NA groups at day 17 after the first immunization. However, mice administered orally with L.lactis/pNZ8110-pgsA-NA could elicit a higher significant NA-specific IgG titer than saline or L.lactis/pNZ8110-pgsA group at day 37 after the first immunization, (Fig. 2A). To assess whether L.lactis/pNZ8110-pgsA-NA could induce the mucosal immune responses, intestinal and upper respiratory washes were collected at day 17 and day 37 after the first immunization. As shown in Fig. 2C and D, there was no significant IgA produced in all groups at day 17. Whereas, L.lactis/pNZ8110pgsA-NA induced significantly detectable levels of NA-specific
mucosal IgA compared to saline or L.lactis/pNZ8110-pgsA group at day 37 in the intestinal and upper respiratory washes. These data indicate that mice vaccinated orally with L.lactis/ pNZ8110-pgsA-NA after prime-boost immunization can result in significant serum IgG and mucosal IgA levels which may contribute to protection against virus infection. Neuraminidase inhibition (NI) titers induced by L.lactis/pNZ8110pgsA-NA The sera isolated from the vaccinated mice were detected by NI assay. As shown in Fig. 2B, there were no significant NI titers of all groups detected at day 17. However, the NI titers in the L.lactis/ pNZ8110-pgsA-NA group could be significantly detected compared to saline or L.lactis/pNZ8110-pgsA group at day 37. These data are consistent with ELIA assay, mice vaccinated orally with L.lactis/ pNZ8110-pgsA-NA after the boost immunization could produce a higher NA-specific IgG antibody and also elicit significant NI titers which may prevent virus infection. Cross protective immunity against virus challenge At two weeks after the last immunization, all mice were challenged by intranasal inoculation with 20 ml of 104 TCID50 of A/Vietnam/1203/2004(H5N1), A/Hong Kong/1/1968 (H3N2) or A/California/04/2009(H1N1) virus. The control groups that received saline or L.lactis/pNZ8110-pgsA experienced substantial weight loss beginning at day 2 post challenge, a high level of lung virus titer and death by 6 to 8 days post infection. In contrast, mice immunized orally with L.lactis/pNZ8110-pgsA survived 80% against H5N1 challenge, 60% against H3N2 and H1N1 virus challenge, respectively. Further, these survived mice showed slight loss of body weight and a lower virus titer in the lung (Fig. 3). Taken together, these results provide evidence that L.lactis/pNZ8110pgsA-NA is a safe and effective immunogen to induce cross protective immunity against homologous H5N1 and heterologous H3N2 and H1N1 in mice.
Discussion Most of the current approaches to vaccine design focus on measuring the antibody response to influenza A HA, the predominant homotrimeric glycoprotein located on the surface of the virus (Wohlbold and Krammer, 2014). In the scope of influenza virus research, relatively little attention is given to the NA, and while the use of NA as a vaccine antigen is studied by only a small pocket of investigators, recent evidence has reignited interest in the potential use of NA in vaccine design as well as the ability of NA-directed antibodies to confer protection against a range of influenza virus subtypes (Marcelin et al., 2012). Indeed, the possibility of NA-based protection has been recognized by the international vaccine community, and the proposal to somehow standardize the amount of NA in vaccine formulations has been entertained at past WHO conferences on influenza virus vaccine development (Bright et al., 2009; Eichelberger et al., 2008). More recently, one group identified a universally conserved NA peptide sequence (222–230: I–L–R–T–Q– E–S–E/S–C) that is 100% conserved in all influenza A virus subtypes as well as in the NAs of influenza B strains, and conferred cross protection against diverse strains of influenza viruses (Doyle et al., 2013). Thus, NA offers the potential for the development for a new novel universal influenza vaccine. Understandably, the induction of mucosal immunity via mucosal administration (oral or intranasal) is necessary to ensure protection against multiple subtypes of influenza A virus. Secretion of IgA is a representative antibody of mucosal immune response, and confers
H. Lei et al. / Virology 476 (2015) 189–195
191
1 pNis Promoter
pgsA
GS linker
FITC
2
NA ~ 100 kDa
FITC
Fig. 1. Expression of NA displayed on L.lactis surface. (A) Schematic diagram of L.lactis/pNZ8110-pgsA-NA. A GS linker inserted between pgsA and NA to stabilize the NA protein expression. (B) Western blot analysis. Lane 1: L.lactis/pNZ8110-pgsA; Lane 2: L.lactis/pNZ8110-pgsA-NA. (C) Immunofluorescence microscopy assay of NA protein. L.lactis/pNZ8110-pgsA (left) and L.lactis/pNZ8110-pgsA-NA (right) (magnification: 1000 ). (D) Flow cytometric analysis of NA display on L.lactis surface. L.lactis/pNZ8110pgsA (left) and L.lactis/pNZ8110-pgsA-NA (right; positive rate: 60.3%).
efficient protection against acquired mucosal infection (Wells and Mercenier, 2008). Furthermore, antigen presented on L.lactis surface is more immunogenic, and easier to recognize by immune system (Lei et al., 2011; Wells and Mercenier, 2008). We have shown previously that L.lactis is an ideal mucosal vehicle for influenza vaccine inducing significant humoral IgG and mucosal IgA antibodies against homologous H5N1 virus infection in the mouse or chicken model (Lei et al., 2010, 2011, 2014). However, little is known regarding the immunogenicity of NA presented on L.lactis surface, since NA is another major glycoprotein on the surface of the virus and has historically served as the target for antiviral drug therapy and is much less studied in the context of humoral immunity against divergent influenza A viruses (Wohlbold and Krammer, 2014). Based on this knowledge, we identified NA presented on L.lactis surface by immunofluorescence assay and flow cytometric analysis (Fig. 1C and D) in which pgsA was used as an anchor protein displaying HA1 protein of H5N1 virus, as described previously (Lei et al., 2011) and investigated its immunogenicity after optimizing the schedule and dosage for oral administration compared with our previous studies (Lei et al., 2011). It is generally accepted that anti-NA antibodies are thought to be non-neutralizing, but the well-established role for NA antibodies is to
provide a reduction in virus replication (Chen et al., 2012). In this study, anti-NA antibodies induced by L.lactis/pNZ8110-pgsA-NA were determined by ELISA and NI assay, respectively. It was shown that L.lactis/pNZ8110-pgsA-NA could elicit significant serum IgG and mucosal IgA antibodies responses, as well as NI titers which may contribute to reducing virus replication. Interestingly, we determined virus titer in the lung of mice vaccinated orally with L.lactis/pNZ8110pgsA-NA after virus challenge, and discovered that antibodies to NA did positively correlate with virus shedding in lung. Consistent with a recent report showing that antibodies against NA playing crucial roles during viral replication (Doyle et al., 2013), our study demonstrated that the cross-reactivity of L.lactis/pNZ8110-pgsA-NA induced NA antisera to divergent influenza A viruses limited virus spread, thus supporting this idea. The development of a universal influenza A vaccine is one of the major goals in global pandemic preparedness plans. The current strategy for designing a universal influenza vaccine aims to skew the humoral immune response (Wohlbold and Krammer, 2014). In this case, NA antibodies also contribute to cross-protective immunity against influenza A viruses. In our studies, L.lactis/pNZ8110pgsA-NA conferred 80% protection against homologous H5N1, and 60% protection against H3N2 and H1N1, respectively. Although
192
H. Lei et al. / Virology 476 (2015) 189–195
Fig. 2. Immune responses in mice. Sera, intestine and upper respiratory washes were collected from mice vaccinated orally with saline, L.lactis/pNZ8110-pgsA or L.lactis/ pNZ8110-pgsA-NA at day 17 and day 37 after the first immunization. (A) NA-specific IgG antibody responses in the sera (n¼ 16 mice/group). (B) NA-specific IgA antibody responses in the intestine washes (n¼ 3 mice /group). (C) NA-specific IgA antibody responses in the upper respiratory washes (n ¼3 mice/group). (D) NI titers (n¼ 16 mice/ group). The value less than 24 is considered no significance. Data are represented as mean7 SD. Asterisk indicates significant difference, as compared to saline and L.lactis/ pNZ8110-pgsA controls (po 0.05).
L.lactis/pNZ8110-pgsA-NA did not confer 100% protective efficacy against homologous and heterologous influenza A viruses, this study suggests ideal protection provided by L.lactis/pNZ8110-pgsANA requires the coordinated efforts of enhancing its immunogenicity either which includes some combination of the NA and HA antigen (Johansson and Cox, 2011), or combines with the use of the mucosal adjuvant. Collectively, our findings agree with that NA is an attractive antigen for developing a novel universal influenza vaccine. In conclusion, our findings strongly support oral administration of mice with L.lactis/pNZ8110-pgsA-NA in the absence of adjuvant can induce significant humoral and mucosal immune responses, as well as NI titers. Given the induction of cross-protective immunity in the vaccinated mice, L.lactis/pNZ8110-pgsA-NA would likely provide a significant barrier to the spread of influenza A virus and also be economically advantageous for influenza vaccine development. Thus, L.lactis/pNZ8110-pgsA-NA may be a promising candidate for a universal influenza vaccine.
Materials and methods Construction of L.lactis vector The NA gene (1459 bp) of A/Vietnam/1203/2004 (H5N1) was PCR-amplified from pCDNA3.1-HA (kindly provided by St. Jude Children's Research Hospital, Memphis, TN, USA) using the following primers: NA-F: CTAGCTAGCGGTACCGCCGCCACCATGAA (Nhe I); NA-R: CCGAATTCACAGGAAGTATTCAATC (EcoR I) and cloned into pNZ8110-pgsA (Lei et al., 2011), the resulting plasmid pNZ8110pgsA-NA was transformed into competent L.lactis NZ9000, the positive clone was named L.lactis/pNZ8110-pgsA-NA. Western blotting The expression level of NA protein was determined by Western blot analysis as described previously (Lei et al., 2011). Briefly, 108 cells of L.lactis/pNZ8110-pgsA-NA pellets were washed three times
H. Lei et al. / Virology 476 (2015) 189–195
193
Fig. 3. Protection efficacy against lethal challenge with different influenza A viruses in mice. The results are expressed in terms of percent body weight (A, B and C) (n ¼10 mice/group), lung virus titer (D, E and F) (n¼ 3 mice/group) at day 5 post-infection and percent survival (G, H and I) (n¼ 10 mice/group). Two weeks after the last immunization, mice were intranasally infected with 20 ml of 104 TCID50 of lethal dose of A/Vietnam/1203/2004(H5N1) (A, D and G), A/Hong Kong/1/1968 (H3N2) (B, E and H) or A/California/04/2009(H1N1) (C, F and I). Data of weight changes and lung virus titers are represented as mean 7 SD. Asterisk indicates significant difference, as compared to saline and L.lactis/pNZ8110-pgsA controls (p o 0.05).
with 500 ml of sterile saline, and then re-suspended with 50 ml of 6 loading buffer and boiled for 10 min. Treated samples were run on SDS-polyacrylamide gel electrophoresis and then transferred to nitrocellulose membrane (Bio-rad, Hercules, California, USA). After blocking with 5% skim milk at room temperature for 2 h, the membrane was incubated with a monoclonal mouse
anti-NA antibody (kindly provided by Beiresource, Manassas, VA, USA). After incubated overnight at 4 1C, and then followed by affinity-purified horseradish peroxidase (HRP)-conjugated antimouse IgG (Sigma-Aldrich Corporation, St. Louis, MO, USA). The membrane was reacted with the West Pico Chemiluminescent Substrate (Thermo Fisher Scientific Inc., Rockford, IL, USA) and
194
H. Lei et al. / Virology 476 (2015) 189–195
Fig. 3. (continued)
imaged using Molecular Imager ChemiDoc XRS System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). L.lactis/pNZ8110-pgs cells were used as a negative control. Immunofluorescence assay and flow cytometry analysis NA protein displayed on the surface of L.lactis was analyzed by immunofluorescence assay (Leica DM4000B, Germany) and flow cytometry (FACS) analysis (BD FacsCalibur, BD Bioscience, San Jose, CA, USA). Briefly, 108 cells of L.lactis/pNZ8110-pgsA-NA were washed three times with sterile saline containing 0.5% bovine serum albumin (BSA) and then incubated with monoclonal mouse anti-NA antibody at 4 1C for 1 h, followed by a FITC-conjugated goat anti-mouse IgG at 4 1C for 30 min and re-suspended with 500 ml of sterile saline. Finally, L.lactis/pNZ8110-pgsA-NA cells were used for immunofluorescence assay and FACS analysis, respectively. L.lactis/pNZ8110-pgsA cells were used as a negative control.
used as controls. Sera, intestinal and upper respiratory washes were obtained at day 17 and day 37 after the first immunization. At two weeks after the last immunization, all vaccinated mice were lightly anesthetized with CO2 and inoculated intranasally with 20 ml of 104 EID50 of A/Vietnam/1203/2004 (H5N1), A/Hong Kong/1/1968 (H3N2) or A/California/04/2009(H1N1). Mice were observed for illness, weight loss, and death for 14 days after virus infection. Lung virus titer was determined. Lungs from vaccinated mice were harvested at day 5 postinfection. Tissue samples were homogenized and processed as described previously (Boon et al., 2010). The titer of virus in each sample was calculated by the Reed and Muench method (Reed and Muench, 1938) and expressed as 50% tissue culture infective dose (TCID50). All animal experiments were carried out in accordance with the Guideline for Animal Experiment prescribed and approved by an Institutional Animal Care and Use Committee (IACUC) of Nanchang University. Virus challenge experiments must be strictly performed under the enhanced bio-safety level-3 laboratory (BSL-3).
Animal experiments and sample collection Enzyme-linked immunosorbent assay (ELISA) Specific-pathogenic-free (SPF) six-week-old female BALB/c mice were used (SLC Company, Shanghai, China) in this study. The concentration of recombinant L.lactis/pNZ8110-pgsA-NA was adjusted to 1012 colony forming unit (CFU)/ml with sterile saline. Mice (16 mice/group) were immunized orally with 1012 CFU of L.lactis/pNZ8110-pgsA-NA at day 0, 1, 2, 3 and boosted at day 20, 21, 22, 23. In the meantime, L.lactis/pNZ8110-pgsA and saline were
Immune sera from the vaccinated mice were collected by bleeding from posterior orbital venous plexus at day 17 and day 37. NA-specific immunoglobulin G (IgG) and secretory immunoglobulin A (IgA) antibodies were detected by enzyme-linked immunosorbent assay (ELISA) using recombinant NA protein of A/Vietnam/1203/2004 (H5N1) as a coating antigen as described
H. Lei et al. / Virology 476 (2015) 189–195
previously (Lei et al., 2010). ELISA end point titers were expressed as the highest dilution that yielded an optical density greater than twice the mean plus one standard deviation of that of similarly diluted negative control samples. Neuraminidase inhibition (NI) assay A miniaturized format of the conventional NI assay was applied to detect the NA specific antibody titers (Sandbulte et al., 2009). Briefly, 50 μl of mice sera from each group was taken at 2-fold serial dilutions in a 96-well micro-titer plate. 50 μl of purified rNA (0.25 mg/ml) (kindly provided by Beiresource, Manassas, VA, USA) was added to each well and incubated at 37 1C for 2 h. The neuraminidase inhibition titer was represented as the highest dilution until there was no neuraminidase activity observed. Statistical analysis Data are presented as the means 7standard deviations (S.D.). All analysis for statistically significant differences was performed by the Student t test and one-way ANOVA. A p value less than 0.05 was considered to be significant. Acknowledgments This work was supported by grants from National Natural Science Foundation of China (No. 31360225) and Natural Science Foundation of Jiangxi Province (No. 20114BAB214014) to H. Lei. References Boon, A.C., deBeauchamp, J., Krauss, S., Rubrum, A., Webb, A.D., Webster, R.G., McElhaney, J., Webby, R.J., 2010. Cross-reactive neutralizing antibodies directed against pandemic H1N1 2009 virus are protective in a highly sensitive DBA/2 mouse influenza model. J Virol 84, 7662–7667. Bright, R.A., Neuzil, K.M., Pervikov, Y., Palkonyay, L., 2009. WHO meeting on the role of neuraminidase in inducing protective immunity against influenza infection, Vilamoura, Portugal, September 14, 2008. Vaccine 27, 6366–6369. Chen, Z., Kim, L., Subbarao, K., Jin, H., 2012. The 2009 pandemic H1N1 virus induces anti-neuraminidase (NA) antibodies that cross-react with the NA of H5N1 viruses in ferrets. Vaccine 30, 2516–2522. Clements, M.L., Betts, R.F., Tierney, E.L., Murphy, B.R., 1986. Serum and nasal wash antibodies associated with resistance to experimental challenge with influenza A wild-type virus. J. Clin. Microbiol. 24, 157–160. Doyle, T.M., Hashem, A.M., Li, C., Van Domselaar, G., Larocque, L., Wang, J., Smith, D., Cyr, T., Farnsworth, A., He, R., Hurt, A.C., Brown, E.G., Li, X., 2013. Universal antineuraminidase antibody inhibiting all influenza A subtypes. Antivir. Res. 100, 567–574. Eichelberger, M., Golding, H., Hess, M., Weir, J., Subbarao, K., Luke, C.J., Friede, M., Wood, D., 2008. FDA/NIH/WHO public workshop on immune correlates of protection against influenza A viruses in support of pandemic vaccine
195
development, Bethesda, Maryland, US, December 10–11, 2007. Vaccine 2008 (26), 4299–4303. Johansson, B.E., Cox, M.M., 2011. Influenza viral neuraminidase: the forgotten antigen. Expert Rev. Vaccines 10, 1683–1695. Kilbourne, E.D., Laver, W.G., Schulman, J.L., Webster, R.G., 1968. Antiviral activity of antiserum specific for an influenza virus neuraminidase. J. Virol. 2, 281–288. Lakdawala, S.S., Lamirande, E.W., Suguitan Jr, A.L., Wang, W., Santos, C.P., Vogel, L., Matsuoka, Y., Lindsley, W.G., Jin, H., Subbarao, K., 2011. Eurasian-origin gene segments contribute to the transmissibility, aerosol release, and morphology of the 2009 pandemic H1N1 influenza virus. PLoS Pathog. 7, e1002443. Lei, H., Peng, X., Shu, H., Zhao, D., 2014. Intranasal immunization with live recombinant Lactococcus lactis combined with heat-labile toxin B subunit protects chickens from highly pathogenic avian influenza H5N1 virus. J. Med. Virol. , http://dx.doi.org/10.1002/jmv.23983. Lei, H., Sheng, Z., Ding, Q., Chen, J., Wei, X., Lam, D.M., Xu, Y., 2011. Evaluation of oral immunization with recombinant avian influenza virus HA1 displayed on the Lactococcus lactis surface and combined with the mucosal adjuvant cholera toxin subunit B. Clin. Vaccine Immunol. 18, 1046–1051. Lei, H., Xu, Y., Chen, J., Wei, X., Lam, D.M., 2010. Immunoprotection against influenza H5N1 virus by oral administration of eneteric coated recombinant Lactococcus lactis mini-capsules. Virology 407, 319–324. Lu, X., Liu, F., Zeng, H., Sheu, T., Achenbach, J.E., Veguilla, V., Gubareva, L.V., Garten, R., Smith, C., Yang, H., Stevens, J., Xu, X., Katz, J.M., Tumpey, T.M., 2014. Evaluation of the antigenic relatedness and cross-protective immunity of the neuraminidase between human influenza A (H1N1) virus and highly pathogenic avian influenza A (H5N1) virus. Virology 454–455, 169–175. Marcelin, G., DuBois, R., Rubrum, A., Russell, C.J., McElhaney, J.E., Webby, R.J., 2011. A contributing role for anti-neuraminidase antibodies on immunity to pandemic H1N1 2009 influenza A virus. PLoS One 6, e26335. Marcelin, G., Sandbulte, M.R., Webby, R.J., 2012. Contribution of antibody production against neuraminidase to the protection afforded by influenza vaccines. Rev. Med. Virol. 22, 267–279. Matrosovich, M.N., Matrosovich, T.Y., Gray, T., Roberts, N.A., Klenk, H.D., 2004. Neuraminidase is important for the initiation of influenza virus infection in human airway epithelium. J. Virol. 78, 12665–12667. Murphy, B.R., Kasel, J.A., Chanock, R.M., 1972. Association of serum antineuraminidase antibody with resistance to influenza in man. N. Engl. J. Med. 286, 1329–1332. Palese, P., Tobita, K., Ueda, M., Compans, R.W., 1974. Characterization of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397–410. Pontes, D.S., de Azevedo, M.S., Chatel, J.M., Langella, P., Azevedo, V., Miyoshi, A., 2011. Lactococcus lactis as a live vector: heterologous protein production and DNA delivery systems. Protein Exp. Purif. 79, 165–175. Reed, L.J., Muench, H., 1938. A simple method of estimating fifty percent endpoints. The American Journal of Hygiene 27, 493–497. Sandbulte, M.R., Gao, J., Straight, T.M., Eichelberger, M.C., 2009. A miniaturized assay for influenza neuraminidase-inhibiting antibodies utilizing reverse genetics-derived antigens. Influenza Other Respir. Viruses 3, 233–240. Shoji, Y., Chichester, J.A., Palmer, G.A., Farrance, C.E., Stevens, R., Stewart, M., Goldschmidt, L., Deyde, V., Gubareva, L., Klimov, A., Mett, V., Yusibov, V., 2011. An influenza N1 neuraminidase-specific monoclonal antibody with broad neuraminidase inhibition activity against H5N1 HPAI viruses. Hum. Vaccines 7, 199–204. Subbarao, K., Joseph, T., 2007. Scientific barriers to developing vaccines against avian influenza viruses. Nat. Rev. Immunol. 7, 267–278. Wells, J.M., Mercenier, A., 2008. Mucosal delivery of therapeutic and prophylactic molecules using lactic acid bacteria. Nat. Rev. Microbiol. 6, 349–362. Wohlbold, T.J., Krammer, F., 2014. In the shadow of hemagglutinin: a growing interest in influenza viral neuraminidase and its role as a vaccine antigen. Viruses 6, 2465–2494.