Lambert–Eaton myasthenic syndrome as an autoimmune calcium-channelopathy

Neuroscience Research 36 (2000) 183 – 191 www.elsevier.com/locate/neures

Update article

Lambert–Eaton myasthenic syndrome as an autoimmune calcium-channelopathy Masaharu Takamori a,*, Takahiro Maruta a, Kiyonobu Komai b a b

Neurological Center, Kanazawa-Nishi Hospital, 77, Ko, Kita-machi, Kanazawa 920 -0055, Japan Department of Neurology, Kanazawa Uni6ersity School of Medicine, Kanazawa 920 -8640, Japan Received 4 November 1999; accepted 17 December 1999

Abstract Lambert–Eaton myasthenic syndrome (LEMS), often associated with small cell lung carcinoma (SCLC), is a disease of neuromuscular transmission in which antibodies directed against voltage-gated calcium channel (VGCC) in the motor nerve terminal play a crucial role in causing a deficient quantal release of acetylcholine. We focused attention on the P/Q-type VGCC, against which a majority of LEMS patients carry the specific antibody. Since the P/Q-type VGCC expresses in SCLC, the motor nerve terminal and SCLC may share a common VGCC antigen. In search for antigenic sites at the molecular level, We employed peptides or recombinant protein corresponding to the S5 – S6 linker of each of four domains forming the a 1A subunit and tested their antigenicity. As the result, we specified the domain II, III and IV as immunodominant sites by the induction of an immune-mediated animal model of LEMS and the assay for antibodies in LEMS patients. Also, by use of peptides or recombinant protein corresponding to the synaptotagmin I, we found that in this VGCC-associated protein, the segment which exposes extracellularly during exocytosis can be antigenic for LEMS. © 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Neuromuscular transmission; Calcium channel; Synaptotagmin; Myasthenic syndrome; Paraneoplastic syndrome; Lung cancer; Autoimmunity

1. Introduction The Lambert–Eaton myasthenic syndrome (LEMS) is one of the paraneoplastic disorders which are not attributed to direct effect of the cancer or its metastasis (Posner, 1995). This syndrome, often associated with small cell lung carcinoma (SCLC), is known to be a disorder caused by a deficient quantal release of acetylcholine (ACh) from nerve terminals in the neuromuscular synapse (Elmqvist and Lambert, 1968). Based on the electrophysiological data found in LEMS that there is no prevention of the nerve impulse from reaching the nerve terminal and the number of available ACh quanta is within the normal range (Lang et al., 1987),

* Corresponding author. Tel: + 88-76-2331811; fax: + 88-762218603.

the reduced ACh quanta have been ascribed to a reduction in the number of functional cell surface protein, i.e. voltage-gated calcium channel (VGCC). This has opened an avenue to understanding the pathophysiology of LEMS that autoantibodies raised against the protein expressed in cancer direct to the homologous target in the nervous system (Vincent et al., 1989). A crucial role of an antibody in causing LEMS has been suggested by the passive transfer of LEMS to mice with the injection of human LEMS IgG (Lang et al., 1983), and the deposit of IgG at the nerve terminal active zone particles, believed to be the VGCCs, in this mouse passive transferred model of LEMS (Fukuoka et al., 1987). The process by which the antibodies lead to VGCC loss depends on cross-linking of adjacent active zone particles and consequent modulation of channel density; complement does not appear to be involved (Nagel et al., 1988).

0168-0102/00/$ - see front matter © 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 0 1 0 2 ( 9 9 ) 0 0 1 3 5 - 2

184

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

2. Role of cancer in the etiology of Lambert – Eaton myasthenic syndrome About 50–60% of LEMS patients have an underlying cancer; SCLC is most often associated with LEMS (O’Neill et al., 1988; Lennon and Lambert, 1989; Leys et al., 1991; Gutmann et al., 1992; Takamori, 1999). Our nationwide survey in Japan showed that cancers were not initially detected in 88% of patients studied; the interval between the onset of LEMS symptoms and radiological detection of the tumor was up to 2 years (Takamori, 1997). The first evidence to suggest a role of SCLC to associate with LEMS is that VGCCs express in SCLC cells as demonstrated by the SCLC cells being capable of generating calcium spikes (McCann et al., 1981). The LEMS IgG exerts a significant inhibitory action on depolarization-induced calcium flux into SCLC lines (Roberts et al., 1985), and this inhibition of flux broadly correlated with the electromyographic index of disease severity (Lang et al., 1989). These findings support the view that VGCCs provoke the immune response. SCLC and motor nerve terminals may share a common VGCC antigen, so that anti-VGCC antibodies that recognize the SCLC may react with a homologous target in the motor nerve terminal, resulting in a presynaptic defect of neuromuscular transmission (Vincent et al., 1989). The immune stimulus genes by which the tumor is implicated in triggering antibody response remains unknown as well as those in non-cnacer LEMS group.

3. Type of voltage-gated calcium channels as the target for Lambert–Eaton myasthenic syndrome autoantibodies Among isoforms of VGCCs classified as L, N, P/Q, R, and T according to the electrophysiological and pharmacological properties of their a 1 subunit (Dunlap et al., 1995), we focused attention on the P/Q-type. This is based on the high recongition by LEMS antibodies of this subtype of VGCC as demonstrated by that 52 of our 58 LEMS patients (90%) were positive for anti-P/Q-type VGCC antibodies when measured by use of co-conotoxin MVIIC-labeled extract of the cerebellum as antigen (Fig. 1); this is as high as those reported previously (Lennon et al., 1995; Takamori et al., 1995; Motomura et al., 1997). Our choice is also supported by the pharmacological finding that the calcium influx into mammalian motor nerve terminal elicited by nerve stimulation occurs through the P/Q-type VGCC (Protti et al., 1996), and by the immunohistochemical finding that the presynaptic terminal of the neuromuscular junction can be highly labeled with the antipeptide antibody specific for the a 1 subunit of P/Q-type VGCC (Ousley and Froehner, 1994). Also,

the P/Q-type VGCC has been found to express in SCLC (Meriney et al., 1996). Although several studies have detected antibodies to N-type and L-type (Lennon et al., 1995; Takamori et al., 1995; Motomura et al., 1997), this may reflect the possibility that there is an immunological cross-reactivity with homologous epitopes on different types of VGCC, or the likelihood that there is an underlying primary cancer which expresses multiple subtypes of VGCC (Meriney et al., 1996).

4. Antigenic sites in the molecular structure of P/Q-type voltage-gated calcium channel

4.1. Assay for antibodies to synthetic peptides and recombinant protein The a 1 subunit of the VGCC has a central role in calcium channel functions including voltage-gating, ion conduction and sensitivity to pharmacologic agents, and possesses four repeated domains (I–IV), each containing six a-helical transmembrane segments (S1–S6) (Mori et al., 1991; Varadi et al., 1995). The loop, known as SS1–SS2, between segments S5 and S6 in each domain is implicated in the formation of the ion conduction pore and exposed extracellularly (Mori et al., 1991; Varadi et al., 1995), suggesting that the S5–S6 linker regions have a potential accessibility to circulating antibodies. The SS2 segments on all four domains that contain glutamate residues are important determinants of ion selectivity in the calcium channel (Ellinor et al., 1995; Varadi et al., 1995). In view of this molecular anatomy, we synthesized peptides which correspond to the S5–S6 linker segment of each of the four domains forming the a 1 subunit of P/Q-type VGCC.

Fig. 1. Antibodies to the P/Q-type voltage-gated calcium channel, determined by use of v-conotoxin MVIIC-labeled cerebellar extract (Takamori, 1999). The horizontal line in each column represents the upper limit of normal range (mean+ 3 S.D. for 15 healthy controls). Filled circles in the LEMS column represent LEMS patients with SCLC. LEMS, Lambert – Eaton myasthenic syndrome; SCLC, small cell lung carcinoma; MG, myasthenia gravis.

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

185

Fig. 2. Antibodies to synthetic peptides of the P/Q-type voltage-gated calcium channel a 1 subunit in sera from 30 patients with LEMS and 35 non-LEMS patients (Takamori et al., 1997). The horizontal line in each column represents the upper limit of normal range (mean + 2.5 S.D. for 15 healthy controls). LEMS, Lambert–Eaton myasthenic syndrome; SCLC, small cell lung carcinoma, MG, myasthenia gravis.

They were labeled with iodine (125I) using Bolton– Hunter reagent and used as antigens to detect antibodies in 30 LEMS sera and 35 non-LEMS sera (10 SCLC without LEMS, 10 myasthenia gravis and 15 healthy controls) by means of the immunoprecipitation assay using anti-IgG antiserum (expressed as pmoles of 125Ipeptide precipitated per l of serum). Among the 30 LEMS sera, 6 samples (20%), five of whom had SCLC, were positive (2.5 S.D. above the mean value for 15 healthy controls) for antibodies to the domain II S5-S6 linker peptide; nine samples (30%), six of whom had SCLC, were positive for antibodies to the domain IV S5-S6 linker peptide (Takamori et al., 1997) (Fig. 2). Only two of 15 antipeptide-positive sera were positive for both antibodies; one of 10 patients with SCLC without LEMS had the anti-domain II antibody; none of 10 myasthenia gravis patients’ sera, studied as the disease control, was positive (Takamori et al., 1997) (Fig. 2). Titers of antibodies to the domain II peptide, as well as those for antibodies to the domain IV peptide, statistically correlated with those of anti-P/Qtype VGCC antibodies which were measured by using v-conotoxin MVIIC-labeled cerebellar extract (r =0.39,

PB 0.05 for the anti domain II; r= 0.63, PB 0.0001 for the anti-domain IV) (Takamori et al., 1997). Although the domain III peptide was not shown to be antigenic for the detection of LEMS antibodies in our study (Takamori et al., 1997) (Fig. 2), the domain III contains the most important amino acid sequences determining the calcium-selectivity, calcium-permeability, and ligand-binding ability of VGCC (Ellinor et al., 1995; Varadi et al., 1995). The failure in antibody detection by the domain III peptide may be due to difficulty in inducing the peptide’s antigenic comformation which is recognized by autoantibodies raised against a native protein. Taking this possibility into consideration, we tested 35 LEMS sera (five sera were added to 30 sera studied for antipeptide antibodies) by the immunoblots using the recombinant protein derived from the DNA sequence encoding for the domain m S5-S6 linker region (Iwasa et al., 2000). As the result from the study on 35 LEMS sera, 17 sera (49% of test sera) were positive for anti-recombinant domain III antibody; seven of 17 positive patients had SCLC (Fig. 3). This positivity was seen more often in patients with high titers of antibodies to v-conotoxin MVIIC-sensi-

186

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

tive P/Q-type VGCC (for which 31 of 35 LEMS sera were positive (89%)) than in those with low titers (P B 0.05 by Mann– Whitney U-test) (Fig. 3).

4.2. Induction of animal model by immunization with calcium channel peptide Basing our selection on the domain III that plays a most improtant role in channel functions among four domains of the a 1 subunit of P/Q-type VGCC, the peptide synthesized corresponding to the amino acid sequence of the S5–S6 linker region in this domain was used as an antigen in conjugation with the carrier protein (Keyhole limpet hemocyanin, KLH) and complete adjuvant to immunize female Lewis rats. After repeated inoculation with this synthetic antigen, six of 10 rats showed moderate weakness (grade 1 in a 3graded scale for myasthenic weakness in experimental animals (Lennon et al., 1991)), and a reduction in ACh quantum content of end-plate potentials at sacrifice, each compared with the adjuvant control (Table 1) (Komai et al., 1999). This is similar to that seen in the end-plates from LEMS patients’ muscle (Cull-Candy et al., 1989). Antipeptide antibodies raised in test rats

reacted with v-conotoxin MVIIC-sensitive cerebellar extract (P/Q-type VGCC) (Table 2) (Komai et al., 1999). Antibody specificities are suggested by the fact that the domain m peptide inhibited the binding of these rats’ antibodies to the P/Q-type VGCC (Table 2) (Komai et al., 1999), while this binding was not markedly inhibited by irrelevant peptides (S5–S6 linker peptides of domain I and domain IV whose amino acid sequences are much less homologous compared with that of the domain III S5-S6 linker (Mori et al., 1991; Komai et al., 1999). The KLH-injected rats showed no abnormality in immunological and electrophysiological indices (Tables 1 and 2) (Komai et al., 1999). This suggests that the described findings in rats immunized with the peptide conjugated with KLH does not result from polyclonal antibody response to the immunogenic KLH protein. The same results as these were also obtained in rats immunized with the domain II S5–S6 linker peptide conjugated with KLH (Takamori et al., 1998). The domain IV S5–S6 linker, antigenic for the detection of LEMS antibodies (Fig. 2), was not available for the animal experiment because its N-terminus was not linkable with cysteine as is necessary for the conjugation with KLH (Takamori et al., 1998).

Fig. 3. Antibodies to the recombinant domain III S5–S6 linker protein (a l subunit of P/Q-type voltage-gated calcium channel, VGCC) in sera from 35 patients with Lambert–Eaton myasthenic syndrome (LEMS). To produce the recombinant protein of the domain III (S5 – S6 linker) of the P/Q-type VGCC a 1 subunit in Escherichia Coli, the open reading frame cDNA sequence encoding the domain III S5 – S6 linker of the P/Q type VGCC a 1 subunit (rabbit brain) was amplified by PCR using sense, 5%CGGATCCAAGGGCAAGTTTTTTTCACTGCACC3%, and antisense, 5%CGCGGCCGCCTCCATGCGGTAGCCGGGGTC3%, and then oligonucleotide primers were ligated with a pGEX-4T-3 vector (designed to include glutathione-s-transferase, GST). The recombinant plasmid was transformed into E. Coli (BL21) and propagated in Lurica broth in the presence of ampicillin for the selection of the cells transformed with the pGEX-4T-3/domain m S5 – S6 linker expression plasmid. Left: In the immunoblots of the recombinant GST-domain III S5–S6 linker protein, the serum from a LEMS patient positive for anti-P/Q-type VGCC (v-conotoxin-sensitive cerebellar extract) antibody gave staining of a 41 kDa band as indicated by an arrow (lane 5) at the same migration position as those probed with the polyclonal antibody to the domain III S5 – S6 linker peptide (lane 6) and with the monoclonal antibody to gluathione-s-transferase (GST) that was expressed in the bacteria in the form of conjugation with the domain III S5 – S6 linker (lane 7). Bands below the 41 kDa in lanes 5, 6 and 7 may represent proteolytic fragments of 41 kDa proteins. Sera from a LEMS patient negative for anti-P/Q-type VGCC antibody (lane 4), a patient with small cell lung carcinoma without LEMS (lane 3), and a patient with myasthenia gravis (lane 2) did not react with the 41 kDa protein (lane 1: control serum). Right: The comparison of anti-P/Q-type VGCC antibody titers in 35 LEMS patients between anti-recombinant domain III S5–S6 linker positive (17 patients) and negative (18 patients) groups. The positive group is significantly higher in titer than the negative group (PB 0.05 by Mann – Whitney U-test).

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

187

Table 1 Microelectrode study and clinical assessment in immunized ratsa (Komai et al., 1999) MEPP

Resting membrane potential (mV)

Quantum content of EPP at 1 Hz (Quanta)

Grading of myasthenic weaknessb

75 9 5.2

153 9 36.1

0

Rats immunized with domain III S5 -S6 linker peptide conjugated with KLH Rat number 1 0.75 90.098 3.290.83 76 9 6.0 2 0.72 90.066 2.9 90.29 74 9 6.4 3 3.0 90.50 75 9 2.6 0.75 90.065 4 0.73 90.078 3.190.82 75 92.9 5 0.72 90.125 3.090.21 75 94.7 6 0.72 90.077 2.990.85 75 93.9 7 3.19 1.30 76 9 5.8 0.69 90.091 8 0.71 90.025 3.090.46 75 92.5 9 0.69 9 0.077 2.99 0.78 74 9 3.8 10 0.71 9 0.026 3.99 0.30 75 9 5.4

109 9 38.5c 116 926.0 98 9 31.6c 154 9 27.0 84 9 29.2c 97 9 48.8c 76 9 42.9c 83 9 30.9c 127 9 45.8 124 9 35.5

1 0 1 0 1 1 1 1 0 0

Rats immunized with KLH Rat number 1 0.74 9 0.081 2 0.74 9 0.081 3 0.70 9 0.044 4 0.72 90.038 5 0.71 9 0.028

153 9 53.3 147 9 37.1 150 9 36.7 144 9 25.2 157 9 34.4

0 0 0 0 0

Control

Amplitude (mV)

Frequency (per s)

0.72 90.100

3.19 0.50

2.9 9 1.05 3.39 0.70 3.19 0.67 2.99 0.69 2.99 0.50

74 9 3.7 76 9 5.2 75 9 2.6 76 9 4.1 74 9 2.8

a Values in microelectrode study are the means+ standard deviations. Control values are obtained from 10 rats (100 end-plates, 10 in each rat).Values in immunized rats are obtained from 10 end-plates in each rat. b 3-graded scale of clinical signs for myasthenic weakness. c Significantly different from control as estimated by one-way analysis of variance and Duncan’s test for multiple comparisons. MEPP, miniature end-plate potential; EPP, end-plate potential; KLH, keyhole limpet hemocyanine.

5. Synaptotagmin as an immunogen for Lambert–Eaton myasthenic syndrome

5.1. Induction of animal model by immunization with peptides Besides the VGCC, we searched for an immunogen relevant to LEMS within the scope of functionally VGCC-associated proteins. At the synapse, a rapid release of transmitter following the presynaptic membrane depolarization and calcium entry is proceeded from the highly organized stimulation-secretion coupling which depends on 32 proteins from both synaptic vesicles and other presynaptic components (Su¨dhof, 1995). Of these proteins, we focused attention on a vesicle membrane protein, synaptotagmin, on the basis of the facts that synaptotagmin acts as an exocytotic calcium receptor (Kelly, 1995), and is partly exposed at the surface of the nerve terminal during exocytosis (Matteoli et al., 1992). An additional reason for our choice of synaptotagmin is that this protein expresses in SCLC in association with VGCC (David et al., 1993). In view of these, we synthesized the peptides corresponding to the extracellularly exposed N-terminus of synaptotagmin I that consists of 53 residues for human sequence

and 52 residues for rat sequence (Perin et al., 1991). Repeated injection with these peptides plus adjuvant to Lewis rats caused a LEMS feature characterized by reduced ACh quantum content of end-plate potentials in company with highly elevated antipeptide antibodies in three of 10 rats immunized with human sequence peptide, and in four of 10 rats immunized with rat sequence peptide (Fig. 4) (Takamori et al., 1994). In the immunoblots of recombinant protein derived from the DNA sequence encoding for the rat synaptotagmin I (Takamori et al., 1994), sera from the peptide-immunized rats gave staining results showing a 53 kDa band and its dimer (106 kDa band) at the same migration position as that probed with the monoclonal anti-synaptotagmin I antibody (called 1D12) (Takahashi et al., 1991) (Fig. 4). The 43 kDa band was visualized in the immunoblot with monoclonal 1D12 antibody, but not with sera from peptide-immunized rats (Fig. 4). This is explained by the binding with the fragment which was brought about by intracellular proteolysis because our monoclonal 1D12 antibody mainly recongizes the cytoplasmic segment of synaptotagmin (Takahashi et al., 1991), and synaptotagmin contains a hypersensitive proteolytic cleavage site between intracellular residues 111 and 112 (Chapman and Jahn, 1994).

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

188

response to various synaptic proteins that are expressed in cancer and share an antigenicity with cancer.

5.2. Detection of antibodies to recombinant protein in patients The same immunoblotting study as that on peptide-immunized rats’ sera using recombinant synaptotagmin I expressed in bacterial protein was done to search for anti-synaptotagmin antibody in LEMS patients’ sera (Takamori et al., 1995), resulting in that 12 of 47 LEMS sera were positive for anti-synaptotagmin (Table 3). We found that the 43 kDa polypeptide, which was recognized by a monoclonal lD12 antibody, was not identified with any of 47 LEMS sera which were positive or negative at migration positions of 53 kDa and 106 kDa on immunoblots (Takamori et al., 1995). This is similar to the result from the experiment in rats immunized with the peptide synthesized corresponding to the sequence that exposes extracellularly during exocytosis, and suggests that the immune response to synaptotagmin in a subgroup of LEMS patients may be directed to the site(s) being included in the extracellular N terminal domain. Four of 12 anti-synaptotagmin-positive sera were negative for anti-P/Q-type VGCC antibody (Table 3), suggesting that synaptotagmin can be a primary pathogenic antigen in a proportion of LEMS patients. LEMS sera are likely to be heterogenous in the spectrum of containing antibodies; this heterogeneity may reflect the immune

6. Calcium channel as a pathogen common to myasthenic syndrome and cerebellar ataxia Anti-VGCC antibodies are sometimes seen in sera from patients with paraneoplastic cerebellar degeneratgion (without LEMS feature) without antibodies raised against the central nervous system proteins that share an antigenicity with cancer cells (Mason et al., 1997), suggesting that anti-VGCC antibodies may have an influence to cerebellar degeneration. This possibility is supported by the finding that the P/Q-type VGCC expresses richly in the cerebellum (Mori et al., 1991), and also by the recent discovery that the gene of the P/Q-type VGCC a 1 subunit ( a 1A subunit) is encloded in the chromosome 19p13 in human (Ophoff et al., 1996); the VGCC dysfunction secondary to mutations (Ophoff et al., 1996), or to expanded CAG repeat (Zhuchenko et al., 1997) in the a 1A subunit-encoded gene results in cerebellar ataxia (CACNA1A) (Tournier-Lasserve, 1999). An interdisciplinary approach in elucidating genetic and immunological mechanisms will form a united front against cancer and incurable neurological disorders.

Table 2 Antibody assays in immunized rats (Komai et al., 1999) Anti-peptide antibodies (pmol/l)

Anti-P/Q type VGCC antibodies Immunoprecipitation assay (pmol/l)

Control

B3.4a

B10.7a

Rats immunized with domain III S5 -s6 linker peptide conjugated with KLH Rat number 1 762.7c 22.5c c 540.7 2 10.3 3 730.2c 18.9c 4 735.9c 17.7c 5 7s6.4c 19.8c 6 635.5c 14.8c 7 681.2c 36.lc 8 675.3c 19.8c 9 612.3c 18.8c 10 656.8c 11.8c Rats immunized with KLH Rat number 1 2.9 2 2.6 3 2.8 4 2.6 5 3.4 a

6.4 2.5 1.9 6.1 5.3

Inhibition rate (%) 0b

39.5d 16.5d 19.4d 21.1d 42.5d 23.6d 49.9d 21.3d 22.0d 20.6d

– – – – –

Three S.D. below the mean value for ten control rats. Result form ten peptide-immunized rats’ serum samples that were treated with phosphase buffer without peptide. c Significantly different from control as estimated by values above the mean+3 S.D. d Positive inhibition compared with phosphate buffer-treated sera. VGCC, voltage-gated calcium channel; –, not tested. Rat numbers correspond to those of Table 1. b

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

189

Fig. 4. Immunological and physiological findings in rats immunized with synaptotagmin I peptide (N-terminus 1 – 53 residues for human sequence and N-terminus 1 – 52 residues for rat sequence) (Takamori, 1999). Left: Immunoblots of recombinant synaptotagmin I (odd-numbered lanes) and control bacterial protein (even-numbered lanes) are shown, representing the specific reactivity with sera from synaptotagmin-immunized rats (lanes 3 and 5) at the same migration position (53 and 106 kDa bands) as that of monoclonal anti-synaptotagmin antibody (lD12) (lane 1). Lanes 7 and 8 are those probed with sera from a control rat. Note the text for the explanation of 43 kDa band seen in lane 1, but not in the other lanes. Right: The microelectrode study shows the induction of an animal model of LEMS as evidenced by reduced mean quantum content of the end-plate potentials (EPPs) (marked by asterisks). Values in the microelectrode study are means 9 S.D. Control values were obtained from 10 rats (100 end-plates, 10 in each rat). Values in immunized-rats were obtained from 10 end-plates in each rat. Significant differences from control (marked by asterisks) were estimated by one-way analysis of variance and Duncan’s test for multiple comparisons. The right extreme shows the antipeptide antibodies in control (mean 9S.D. from 10 rats) and in peptide-immunezed rats. Antibody titers in the immunized rats are all above the control upper limit of the 95% confidence interval.

Table 3 Antibodies to synaptotagmin and P/Q-type voltage-gated calcium channela (Takamori, 1999) Anti-synaptotagmin antibodies

Anti-P/Q type VGCCantibodies

Number

(+) (+) (−) (−)

(−) (+) (+) (−)

4 8 35 0

(−)

(−)

5

(−)

(−)

5

(−)

(−)

5

LEMS

SCLC MG Healthy control

a LEMS, Lambert–Eaton myasthenic syndrome; SCLC, small cell lung carcinoma; MG, myasthenia gravis: VGCC, voltage-gated calcium channel.

190

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191

References Chapman, E.R., Jahn, R., 1994. Calcium-dependent interaction of cytoplasmic region of synaptotagmin with membanes. J. Biol. Chem. 269, 5735 – 5741. Cull-Candy, S.G., Miledi, R., Trautmann, A., Uchitel, O.D., 1989. On the release of transmitter at normal, myasthenia gravis andmyasthenic syndrome affected human end-plate. J. Physiol. (Lond) 299, 621 – 638. David, P., El Far, O., Martin-Mouto, N., Poupon, M.F., Takahashi, M., Seagar, M.J., 1993. Expression of synaptotagmin and syntaxin associated with N-type calcium channels in small cell lung cancer. FEBS Lett. 326, 135–139. Dunlap, K., Luebke, J.J., Turner, T.J., 1995. Exocytotic Ca2 + channels in mammalian central neurons. Trends Neurosci. 18, 89 – 98. Ellinor, P.T., Yang, J., Sather, W.A., Zhang, J.F., Tsien, R.W., 1995. Ca2 + channel selectivity at a single locus for high-affinity Ca2 + interactions. Neuron 15, 1121–1132. Elmqvist, D., Lambert, E.H., 1968. Detailed analysis of neuromuscular transmission in a patient with the myasthenic syndrome sometimes associated with bronchogenic carcinoma. Mayo Clin. Proc. 43, 689 – 713. Fukuoka, T., Engel, A.G., Lang, B., Newsom-Davis, J., Vincent, A., 1987. Lambert – Eaton myasthenic syndrome: II. Immunoelectron microscopy localization of IgG at the mouse motor end-plate. Ann. Neurol. 22, 200–211. Gutmann, L., Phillips, L.H., Gutmann, L., 1992. Trends in the association of Lambert–Eaton syndrome with carcinoma. Neurology 42, 848 – 850. Iwasa, K., Takamori, M., Komai, K., Mori, Y, 2000. Recombinant calcium channel is recognized by Lambert–Eaton masthenic syndrome antibodies. Neurology (in press). Kelly, R.B., 1995. Synaptotagmin is just a calcium sensor. Curr. Biol. 5, 257 – 259. Komai, K., Iwasa, K., Takamori, M., 1999. Calcium channel peptide can cause an autoimmune-mediated model of Lambert– Eaton myasthenic syndrome in rats. J. Neurol. Sci. 166, 126–130. Lang, B., Newsom-Davis, J., Prior, C., Wray, D., 1983. Antibodies to motor nerve terminals: an electrophysiological study of a human myasthenic syndrome transferred to mouse. J. Physiol. (Lond) 344, 335 – 345. Lang, B., Newsom-Davis, J., Peers, C., Prior, C., Wray, D., 1987. The effect of myasthenic syndrome antibody on presynaptic calcium channels in the mouse. J. Physiol. (Lond) 390, 257– 270. Lang, B., Vmcent, A., Murray, N.M.F., Newsom-Davis, J., 1989. Lambert – Eaton myasthenic syndrome: immunoglobulin G inhibition of Ca2 + flux in tumor cells correlates with disease severity. Ann. Neurol. 25, 265–271. Lennon, V.A., Lambert, E.H., 1989. Autoantibodies bind solubilized calcium channel omega-conotoxin complexes from small cell lung carcinoma: a diagnostic aid for Lambert–Eaton myasthenic syndrome. Mayo Clin. Proc. 64, 1498–1504. Lennon, V.A., Lambert, E.H., Leiby, K.R., Okarma, T.B., Talib, S., 1991. Recombinant human acetylcholine receptor a-subunit induces chronic experimental autoimmune myasthenia gravis. J. Immunol. 146, 2245 –2248. Lennon, V.A., Kryzer, T.J., Griesmann, G.E., O’Suilleabhain, P.E., Windebank, A.J., Woppmann, A., et al., 1995. Calcium-channel antibodies in the Lambert–Eaton syndrome and other paraneoplastic syndromes. N. Engl. J. Med. 332, 1467–1474. Leys, K., Lang, B., Johnston, I., Newsom-Davis, J., 1991. Calcium channel autoantibodies in the Lambert–Eaton myasthenic syndrome. Ann. Neurol. 29, 307–314. Mason, W.P., Graus, F., Lang, B., Honnorat, J., Delattre, J.-Y., Valderoriola, F., et al., 1997. Samll-cell lung cancer, paraneoplastic cerebellar degeneration and the Lambert–Eaton myasthenic syndrome. Brain 120, 1279–1300.

Matteoli, M., Takei, K., Perin, M.S., Sudhof, T.C., DeCamilli, P., 1992. Exo-endocytotic recycling of synaptic vesicles in developing processes of cultured hippocampal neurons. J. Cell Biol. 117, 859 – 861. McCann, F.A., Pettengill, O.S., Cole, J.J., Russell, J.A.G., Sorenson, G.D., 1981. Calcium spike electrogenesis and other electrical activity in continuously cultured small cell carcinoma of the lung. Science 212, 1155 – 1157. Meriney, S.D., Hulsizer, S.C., Lennon, V.A., Grinnell, A.D., 1996. Lambert – Eaton myasthenic syndrome immunoglobulins react with multiple types of calcium channels in small-cell lung carcinoma. Ann. Neurol. 40, 739 – 749. Mori, Y., Friefdreich, T., Kim, M.-S., Mikami, A., Nakai, J., Ruth, P., et al., 1991. Primary structure and functional expression from complementary DNA of a brain calcium channel. Nature 350, 398 – 402. Motomura, M., Lang, B., Johnston, I., Palace, J., Vincent, A., Newsom-Davis, J., 1997. Incidence of serum anti-P/Q-type and anti-N-type calcium channel autoantibodies in the Lambert– Eaton myasthenic syndrome. J. Neurol. Sci. 147, 35 – 42. Nagel, A., Engel, A.G., Lang, B., Newsom-Davis, J., Fukuoka, T., 1988. Lambert – Eaton myasthenic syndrome IgG depletes presynaptic membrane active zone particles by antigenic modulation. Ann. Neurol. 24, 552 – 558. O’Neill, J.H., Murray, N.M.F., Newsom-Davis, J., 1988. The Lambert – Eaton myasthenic syndrome. A review of 50 cases. Brain 111, 577 – 596. Ophoff, R.A., Terwindt, G.M., Vergouwe, M.N., van Eijk, R., Oefner, P.J., Hoffman, S.M.G., et al., 1996. Familial hemiplegic migraine and episodic ataxia type-2 are caused by mutations in the Ca2 + channel gene CACNL1A4. Cell 87, 543 – 552. Ousley, A.H., Froehner, S.C., 1994. An anti-peptide antibody specific for the class A calcium channel a 1 subunit labels mammalian neuromuscular junction. Proc. Natl. Acad. Sci. USA 91, 12263– 12267. Perin, M.S., Johnston, P.A., O8 zelk, T., Jahn, R., Fraucke, U., Su¨dhof, T.C., 1991. Structural and functional conservation of synaptotagmin (p56) in Dorsophila and human. J. Biol. Chem. 266, 615 – 622. Posner, J.B., 1995. Paraneoplastic syndrome. In: Posner, J.B. (Ed.), Neurological Complication of Cancer. FA Davis Company, Philadelphia, pp. 245 – 278. Protti, D.A., Reisin, R., Mackinley, T.A., Uchitel, O.D., 1996. Calcium channel blockers and transmitter release at the normal human neuromuscular junction. Neurology 46, 1391 – 1396. Roberts, A., Perera, S., Lang, B., Vincent, A., Newsom-Davis, J., 1985. Paraneoplastic myasthenic syndrome IgG inhibits 45Ca2 + flux in a small cell lung carcinoma line. Nature 317, 737–739. Su¨dhof, T.C., 1995. The synaptic vesicle cycle: a cascade of protein– protein interactions. Nature 375, 645 – 653. Takahashi, M., Arimatsu, Y., Fujita, S., Fujimoto, Y., Kondo, S., Hama, T., et al., 1991. Protein kinase C and Ca2 + /calmodulin-dependent protein kinase II phosphorylate a novel 58 kDa protein in synaptic vesicles. Brain Res. 551, 279 – 292. Takamori, M., Hamada, T., Komai, K., Takahashi, M., Yoshida, A., 1994. Synaptotagmin can cause an immune-mediated model of Lambert – Eaton myasthenic syndrome in rats. Ann. Neurol. 35, 74 – 80. Takamori, M., Takahashi, M., Yasukawa, Y., Iwasa, K., Nemoto, Y., Suenaga, A., et al., 1995. Antibodies to recombinant synaptotagmin and calcium channel subtypes in Lambert – Eaton myasthenic syndrome. J. Neurol. Sci. 133, 95 – 101. Takamori, M., Iwasa, K., Komai, K., 1997. Antibodies to synthetic peptides of the a 1A subunit of the voltage-gated calcium channel in Lambert – Eaton myasthenic syndrome. Neurology 48, 1261– 1265.

M. Takamori et al. / Neuroscience Research 36 (2000) 183–191 Takamori, M. (Chief of the project group on paraneoplastic neurological syndromes, Neuroimmunological Disease Research Committee, Ministry of Health and Welfare of Japan), 1997. A nationwide survey on paraneoplastic syndromes. Clin Neurol 37, 93– 98. Takamori, M., Iwasa, K., Komai, K., 1998. Antigenic sites of the voltage-gated calcium channel in Lambert–Eaton myashenic syndrome. Ann. N.Y. Acad. Sci. 841, 625–635. Takamori, M., 1999. An autoimmune channelopathy associated with cancer: Lambert – Eaton myasthenic syndrome. Int. Med. 38, 86 – 96. Tournier-Lasserve, E., 1999. CACNA1A mutations: hemiplegic migraine, episodic ataxia type 2, and the others (Editorial). Neurology 53, 3 – 4.

.

191

Varadi, G., Mori, Y., Mikala, G., Schwartz, A., 1995. Molecular determinants of Ca2 + channel function and drug action. Trends Pharmacol. Sci. 16, 43 – 49. Vincent, A., Lang, B., Newsom-Davis, J., 1989. Autoimmunity to the voltage-gated calcium channel underlies the Lamert – Eaton myasthenic syndrome, a paraneoplastic disorder. Trends Neurosci. 12, 496 – 502. Zhuchenko, O., Bailey, J., Bonnen, P., Ashizawa, T., Stockton, D.W., Amos, C., et al., 1997. Autosomal dominant cerebellar ataxia (SCA6) associated with small polyglutamine expansions in the a 1A voltage-dependent calcium channel. Nat. Genet. 15, 62 – 69.