- Email: [email protected]
C rats does not require higher thermogenic capacity of brown adipose tissue
Physiology & Behavior 104 (2011) 893–899
Contents lists available at ScienceDirect
Physiology & Behavior j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / p h b
Leanness of Lou/C rats does not require higher thermogenic capacity of brown adipose tissue Maud Belouze a, Brigitte Sibille b, Benjamin Rey a, Damien Roussel a, Caroline Romestaing a, Loïc Teulier a, Delphine Baetz a, Harry Koubi a, Stéphane Servais a, Claude Duchamp a,⁎ a b
Laboratoire de Physiologie, Université de Lyon, CNRS, 43 Bvd 11 Novembre 1918, F-69622 Villeurbanne Cedex, France INSERM U907, Université de Nice-Sophia Antipolis, Faculté de Médecine, 28 avenue de Valombrose, 06107 Nice, France
a r t i c l e
i n f o
Article history: Received 12 July 2010 Received in revised form 20 May 2011 Accepted 24 May 2011 Keywords: Free running-wheel Lou/C rats Obesity Cold exposure Brown adipose tissue Thermogenesis UCP1
a b s t r a c t Lou/C rats, an inbred strain of Wistar origin, remain lean throughout life and therefore represent a remarkable model of obesity resistance. To date, the exact mechanisms responsible for the leanness of Lou/C rats remain unknown. The aim of the present study was to investigate whether the leanness of Lou/C rats relies on increased thermogenic capacities in brown adipose tissue (BAT). Results showed that although daily energy expenditure was higher in Lou/C than in Wistar rats, BAT thermogenic capacity was not enhanced in Lou/C rats kept at thermoneutrality as demonstrated by reduced thermogenic response to norepinephrine in vivo, similar oxidative activity of BAT isolated mitochondria in vitro, similar levels of UCP1 mRNA and lower abundance of UCP1 protein in interscapular BAT depots. Relative abundance of β3-adrenergic receptor mRNA was lower in Lou/C BAT while that of GLUT4, FABP or CPT1 was not altered. Activity-related energy expenditure was however considerably increased at thermoneutrality as Lou/C rats demonstrated an impressively high spontaneous running activity in voluntary running wheels. Prolonged cold-exposure (4 °C) depressed the spontaneous running activity of Lou/C rats while BAT thermogenic capacity was increased as reflected by rises in BAT mass, oxidative activity and UCP1 expression. It is concluded that the leanness of Lou/C rats cannot be ascribed to higher thermogenic capacity of brown fat but rather to, at least in part, increased locomotor activity. BAT is not deficient in this rat strain as it can be stimulated by cold exposure when locomotor activity is reduced suggesting some substitution between these thermogenic processes. © 2011 Elsevier Inc. All rights reserved.
1. Introduction The prevalence of obesity in humans continues to rise in industrialized countries, mainly in children, and constitutes a pressing problem of public health. Although multifactorial, the development of obesity results from an imbalance between caloric intake and energy expenditure that leads to body fat accumulation. Excessive body fat is associated with increased risk of chronic metabolic diseases such as atherosclerosis and diabetes [1,2]. Most of the genetic studies have focused on genes and polymorphisms associated with the obese phenotype. Considerably less attention has been paid to understand why certain people remain thin and do not develop obesity under the same environmental pressure (sedentary life, fat and energy rich foods). Many genetic manipulations and cross-breeding have created animal models of obesity providing an insight into the molecular mechanisms that affect energy balance and contribute to fat accretion. ⁎ Corresponding author at: LEHNA, UMR CNRS 5023, Université Lyon 1, Bâtiment Dubois, 43 bd 11 Novembre 1918, F-69622 Villeurbanne Cedex, France. Tel.: + 33 472 44 81 38; fax: + 33 472 43 11 72. E-mail address: [email protected] (C. Duchamp). 0031-9384/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.physbeh.2011.05.029
In contrast, few animal models are available to understand the molecular basis of leanness and resistance to obesity. A valuable model of obesity resistance is the Lou/C rat [3], an inbred strain of Wistar origin that does not develop obesity with high fat diet [4] and age [5] contrary to Wistar rats. Accordingly, Lou/C rats exhibit reduced body weight at all ages as compared to Wistar rats and percentage of fat is relatively stable throughout life [6]. Although the exact mechanisms responsible for the leanness of Lou/C rats remain unknown. It may imply i) a reduced energy intake, and/or ii) an enhanced energy expenditure. To date, it has been shown that Lou/C rats presented no reduction in food intake compared with Wistar or Fischer F344 rats [4,7–9], but exhibited higher daily energy expenditure [8,9]. Such increased energy expenditure may contribute to burn out food energy and thus reduce its storage in white adipose tissue. In rodents, brown adipose tissue (BAT) contributes to a significant part of energy expenditure on account of its large oxidative capacities [10]. It has thus been proposed that a defect in BAT activity may be involved in the development of obesity [11]. Indeed, BATassociated facultative thermogenesis is altered in obese rodents in connection with a reduction of uncoupling protein 1 (UCP1) expression [11]. Conversely, it may be postulated that the leanness
894
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
of Lou/C rats may rely on hyperactive BAT dissipating as heat excessive food energy intake. Accordingly, Abdoulaye and co-workers showed that the respiratory rate and proton conductance of mitochondria extracted from Lou/C BAT were higher than in Fischer 344 rats [7]. However, it cannot be excluded that such effect might also result from a very low thermogenic activity of mitochondria from the obesity-prone Fischer 344 rats. The aim of the present study was to investigate the potential increased thermogenic capacity of BAT in Lou/C rats as compared with age-matched Wistar rats, the rat strain from which Lou/C rats derive. Understanding the determinants of the outstanding leanness of Lou/C rats may yield important and complementary findings to the study of obesity models. 2. Methods 2.1. Animals Our study was performed in accordance with the recommendation provided by the European Convention for the protection of Vertebrate Animals used for Experimental and Scientific purposes (Council of Europe n° 123, Strasbourg, 1985). Two inbred strains of rats were used: male Lou/C rats (n = 23; Harlan, France) and male Wistar rats (n = 23; Harlan, France). At the age of 12 weeks, animals were housed six per box under a 12 h light/dark cycle, and allowed to acclimatise to their new conditions for 1 week before the study. Then, rats were housed individually and maintained in a temperature-controlled room (25 ± 1 °C) for three weeks before the beginning of experiments. After this period, the rats were split into different experimental groups described in “Procedure” section. Food (A04 – Scientific Animal Food & Engineering, France) and water were available ad libitum. Rat body mass was measured weekly until 22 weeks of age. Food consumption was estimated twice a week during all the experiments as the difference between the amount of food given and that removed from the cage. Spilling was taken into account as much as possible. Results were expressed per kg of body mass or per kg of fat free mass determined after post-mortem dissection of carcasses. 2.2. Procedure 2.2.1. Spontaneous locomotor activity Wistar and Lou/C rats (n = 6) were placed for three weeks at 25 °C in cages set up with a free-access exercise wheel (Bionox, Ancy, France) attached to one side of the cage. Food intake and body weight were determined once a week while spontaneous activity was monitored continuously. 2.2.2. Brown adipose tissue capacity Recruitment of thermogenic capacity in BAT was investigated classically in vivo by the calorigenic response to a test injection of norepinephrine (NE, Sigma) [12]. Wistar and Lou/C rats (n = 5 per group), 20–22 weeks old, were placed at thermoneutrality and their basal energy expenditure was monitored by indirect calorimetry. We used an open-circuit respirometer and gas analysing system as previously described [13]. Rats were positioned in a thermostatic chamber ventilated by a constant atmospheric airflow (4 L/min). Variable heat loss by conduction on the ground was minimized by a polypropylene bed. Ambient temperature (Ta) were controlled and measured with copper-constantan thermocouples inside the thermostatic chamber. Air flow rates were measured using a Platon volumeter, and converted to standard values (STPD). The fractional concentrations of oxygen were measured using a Servomex 1100 paramagnetic gas analyzer (Taylor Instrument Analytics ltd, Sussex, UK). Carbon dioxide concentrations were measured using a Servomex 1400 infrared gas analyzer. Analysers were calibrated daily and the
rates of O2 consumption and CO2 production as well as the caloric equivalent for O2 determined from the respiratory quotient were calculated as described previously [13]. The thermogenic response to norepinephrine was measured after a single intraperitoneal injection of norepinephrine (0.3 mg/kg) as compared with saline. Energy expenditure (W/kg) was monitored before (resting) and after the injection. Resting energy expenditure represents the lower level measured for at least 10–15 min periods between bursts of activity easily detected by peaks of O2 uptake and CO2 production on records. The thermogenic response to NE was calculated as the net increase in metabolic rate (maximal energy expenditure measured after injection minus basal energy expenditure). Brown fat thermogenic activation was then estimated by the functional activity of isolated mitochondria and the abundance of UCP1. Batches of Wistar or Lou/C rats (n = 6 per group) were reared at either thermoneutrality 25 °C or 4 °C for three week. Such coldacclimation protocol is known to induce metabolic activation of BAT in rodents [10]. Animals were killed by decapitation. Interscapular BAT (iBAT) and visceral fat pad (retroperitoneal and epididymal white adipose tissue) were rapidly excised and weighed. The viscera, including the liver, lungs, heart, and the gastrointestinal tract were removed. The remainder of the body, henceforth called the carcass, was digested in hot 30% KOH. The lipid content of this mixture was assumed to be representative of peripheral fat [14]. Taking account for visceral and peripheral fat, we obtained body composition of Wistar and Lou/C rats. A small portion of iBAT was immediately frozen in liquid nitrogen and stored at − 80 °C for reverse transcription polymerase chain reaction (RT-PCR) while the remaining was used for isolation of mitochondria by differential centrifugation as described previously [15]. Mitochondrial protein content was determined by the bicinchoninic acid (BCA) method (Pierce, Rockford, IL). Mitochondrial oxygen consumption was determined by polarography (Rank Brothers Ltd) at 37 °C in a medium containing 125 mM KCl, 1 mM EGTA, 2 mM KH2PO4, 20 mM Tris–HCl with 0.3% free fatty-acid BSA (pH 7.2). The control state of respiration (state 2) was initiated by the addition of 5 mM succinate, in the presence of 2 μM rotenone. To demonstrate the contribution of UCP1 to mitochondrial respiration, 1 mM of guanosine diphosphate (GDP), a known inhibitor of UCP1, was added to the mitochondrial suspension. Remainder of mitochondria was stored at −80 °C for western blot analysis. The relative abundance of target mRNA was determined by semiquantitative RT-PCR using β-actin as standard. RT was performed in a thermocycler Thermo Hybaid (Ashforf, UK) using 1 μg of total RNA extracted with Tri Reagent (Euromedex, France) Amplified fragments were separated on gels and their relative band intensities (ratio of each target to β-actin) were determined by scanning densitometry with a Kodak Digital Science 1D 2.0 software (Kodak Scientific Imaging System). Primers (sens and antisens) were GTG AAG GTC AGA ATG CAA GC and AGG GCC CCC TTC ATG AGG TC for UCP1 (gi6981691), GAGGCAACCTGCTGGTAATCAC and GAG TGA CAC TCT TGC GCC TCA G for β3 adrenergic receptor (gi6978462), CAG ATC GGC TCT GAA GGT GC and CTG AGT AGG CGC CAA TGA G for GLUT4 (glucose transporter 4, gi464195), CTG GAA GCT AGT GGA CAG and GAC TTG ACC TTC CTG TCA TC for FABP (fatty-acid binding protein, gi204079), TAT GTG AGG ATG CTG CTT CC and CTC GGA GAG CTA AGC TTG TC for CPT1 (carnitine palmitoyl transferase 1, NM_031559). The relative abundance of UCP1 was determined at the protein level. The remaining frozen iBAT mitochondria were used in western blot analysis. Briefly, 20 μg of iBAT mitochondria proteins were separated by SDS-PAGE (12.8% acrylamide) and transferred to polyvinyldene fluoride membranes (Immobilon-P, Millipore). Immunological detection was performed using a rabbit antiserum against UCP1 (α-diagnostics UCP11-A, USA). The detection was realized with a horseradish peroxidase-coupled anti-rabbit (Bio-Rad 170–6516) secondary antibody and an enhanced chemiluminescence (ECL)
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
895
detection kit (Amersham, UK). Autoradiographs were analysed by scanning densitometry with a Kodak Digital Science 1D 2.0 software (Kodak Scientific Imaging System).
2.3. Statistical analysis Data for body and tissue masses, food intake, energy expenditure and respiration of isolated mitochondria were analysed using ANOVA. When appropriate, a post-hoc PLSD fisher was used to compare means between-group. GDP effect was analysed using ANOVA repeated measures. Data were expressed as mean values ± SEM and statistical significance was set at p b 0.05. 3. Results Body, retroperitoneal white adipose tissue (rWAT), iBAT masses and body composition of Wistar and Lou/C rats were determined at the end of the experiment at the age of 22 weeks (Table 1). At thermoneutrality, Wistar rats were heavier than Lou/C rats. Such a difference could be explained at least in part by a lower adiposity as reflected by the lower mass of retroperitoneal fat depots in Lou/C compared with Wistar rats. Further, from carcass dissection, it was found that lipids accounted for 23.6 ± 0.5% of body mass in Wistar rats as compared with 12.1 ± 0.2% in Lou/C rats. Relative iBAT mass was not different between strains when expressed per 100 g body mass. At thermoneutrality, food intake, expressed in kJ/day/kg of body weight, was not significantly different between Wistar and Lou/C rats (respectively 650 ± 35 and 704 ± 24 kJ/day/kg). Lipid content of carcasses allowed us to calculate food intake in relation with fat free mass (FFM). Per unit FFM, food intake was similar in Wistar and Lou/C rats (respectively 851 ± 46 and 800 ± 28 kJ/day/kg FFM). Since no difference in caloric intake was observed between strains, the leanness of Lou/C rats could be related with a higher energy expenditure and potentially a higher thermogenic capacity of BAT. This is classically tested by the calorigenic response to an injection of NE at thermoneutrality aimed at reproducing the neurotransmitter release from sympathetic nerves innervating brown adipocytes. As noticeable in Fig. 1A, Lou/C rats exhibited a higher energy expenditure before and after norepinephrine injection (p b 0.05). In both strains, metabolic rate was significantly increased in response to norepinephrine as compared with the response to saline that did not modify the energy expenditure except for the first minutes after injection. However, the NE-induced stimulation of energy expenditure was shorter in Lou/C than in Wistar rats. Further, the maximal effect of norepinephrine above basal and the integrated response over the measurement period (AUC) were smaller (− 32%, p b 0.05; Fig. 1B) in Lou/C than in Wistar rats. These results showed that the thermogenic effect of a NE injection was lower in Lou/C than in Wistar rats suggesting an unexpected lower BAT thermogenic capacity in this strain.
Table 1 Body, rWAT, iBAT masses (g/100 g of body mass) and percentages of fat free mass (FFM) of 22 week-old Wistar and Lou/C rats at thermoneutrality (25 °C) and after 3 week-cold exposure (4 °C). rWAT = retroperitoneal white adipose tissue; iBAT = interscapular brown adipose tissue. * p b 0.05, significant difference between strains; # p b 0.05, significant effect of cold acclimation.
Final body mass (g) rWAT (g/100 g BM) iBAT (g/100 g BM) FFM (%BM)
Thermoneutrality
Cold
Wistar (n = 6)
Lou/C (n = 6)
Wistar (n = 6)
Lou/C (n = 6)
418 ± 14 0.83 ± 0.09 0.12 ± 0.01 76,4
270 ± 15 * 0.29 ± 0.06 * 0.10 ± 0.01 87,9 *
334 ± 11 # 0.27 ± 0.07 # 0.28 ± 0.05 #
251 ± 6 * 0.08 ± 0.01 *# 0.31 ± 0.01 #
Fig. 1. Thermogenic response to norepinephrine (NE) in 22 weeks old Lou/C and Wistar rats. A: Energy expenditure (W/kg) was measured at thermoneutrality (25 °C) in Lou/C (white) and Wistar (black) rats, before (resting) and 70 min after NE injection (0.3 mg/kg). Each value represents the mean ± SEM integrated in each group (n = 5) over a 10 min period. B: Integrated response to NE injection over the measurement period (AUC). Results are expressed as mean ± SEM. * p b 0.05, significant difference between strains. # p b 0.05, significant effect of NE injection.
In order to confirm the unexpected lower thermogenic capacity of BAT in Lou/C rats, we investigated the respiratory activity of isolated BAT mitochondria. When respiring with succinate/rotenone, state 2 respiration of mitochondria tended to be lower in Lou/ C rats reared at thermoneutrality than in Wistar rats (respectively 184 ± 52 and 307 ± 78 nanoatom oxygen/min/mg protein). In both strains, GDP decreased mitochondrial respiration and GDP-sensitive mitochondrial O2 consumption was similar in BAT mitochondria from Lou/C rats (Fig. 2A) indicating no higher UCP1-dependent respiratory activity in this strain. These functional studies were confirmed by molecular investigations of the relative abundance of UCP1 both at the mRNA and protein levels. Although UCP1 mRNA relative abundance was not significantly different in Wistar and Lou/C rats (Fig. 2B), UCP1 protein content in brown adipose tissue mitochondria was markedly lower in Lou/C than in Wistar rats (− 70%, Fig. 2C). The relative abundance of β3adrenergic receptor mRNA, the main adrenergic receptor mediating the thermogenic activation of BAT, was lower in Lou/C than in Wistar BAT (−36%, Fig. 3). The relative abundance of GLUT4, FABP and mitochondrial CPT1 were not significantly different between strains suggesting no up-regulation of proteins involved in substrate (glucose, fatty acids) supply to oxidative processes in brown adipocytes from Lou/C rats (Fig. 3). The surprisingly low thermogenic capacity of BAT in lean Lou/C rats led us to question as to whether the tissue would be deficient in this rat strain. To test this hypothesis, we exposed Wistar and Lou/C rats to cold, a situation well known to stimulate BAT activity and capacity. After 3 weeks at 4 °C, both Wistar and Lou/C rats were lighter than thermoneutral controls (respectively − 20% and −7%, p b 0.05; Table 1) in relation with a dramatic reduction in retroperitoneal adipose tissue mass (~−70% in both Wistar and Lou/C rats, p b 0.05; Table 1). By contrast the mass of iBAT was markedly increased in both Wistar (+ 133%) and Lou/C rats (+210%, p b 0.05; Table 1). Moreover, cold exposition stimulated BAT thermogenic
896
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
Fig. 3. Relative abundance of β3-adrenergic receptor, glucose transporter 4 (GLUT4), fatty-acid binding protein (FABP) and carnitine palmitoyl transferase (CPT1) mRNA in BAT of Wistar (dark bars, n = 6) or Lou/C (white bars, n = 6) rats reared at thermoneutrality. Results are expressed as mean ± SEM. * p b 0.05, significant difference between strains.
When exposed at 4 °C, Lou/C rats immediately reduced their locomotor activity that fall at 1000 m/d the first day (− 66%, p ≤ 0.05; Fig. 4B). Thereafter, their locomotor activity gradually increased and then stabilized at a much lower level (4293 ± 391 m/day) than that observed at thermoneutrality. Although reduced, the Lou/C rat activity remained higher than that of coldexposed Wistar rats (302 ± 26, p b 0.05; Fig. 4B and C). While the spontaneous locomotor activity Lou/C rats was markedly reduced during the first days in the cold, that of Wistar rats tended to be increased (+ 35%, p = 0.059; Fig. 4C). 4. Discussion Fig. 2. A: GDP-sensitive oxygen consumption (JO2) of BAT isolated mitochondria obtained by subtraction between control state respiration (with 5 mM succinate/2 μM rotenone as substrate) and after addition of 1 mM GDP. Thermoneutral Lou/C rats (white bars, n = 6) are compared with thermoneutral Wistar rats (black bars, n = 6). Basal values of mitochondrial respiration were 184 ± 52 and 307 ± 78 nanoatom oxygen/min/mg protein in Lou/C and Wistar rats, respectively. B: GDP-sensitive oxygen consumption (JO2) of BAT isolated mitochondria in cold-exposed Lou/C rats (white bars) compared with cold-exposed Wistar rats (black bars). C: Relative abundance of UCP1 mRNA in BAT of Wistar and Lou/C rats. D: Relative abundance of UCP1 mRNA in BAT mitochondria of cold exposed Wistar and Lou/C rats. E: UCP1 content of BAT mitochondria in Wistar and Lou/C rats. F: UCP1 content of BAT mitochondria in cold exposed Wistar and Lou/C rats. Results are expressed as mean ± SEM. * p b 0.05, significant difference between strains; # p b 0.05, significant effect of cold acclimation.
capacity in both Wistar and Lou/C strains as demonstrated by an increase in GDP effect on mitochondrial respiration (respectively −34% vs. −41% and − 34% vs. −45%, p b 0.05; Fig. 2A vs. D) and in UCP1 mRNA content (respectively +240% vs. +260%, p b 0.05; Fig. 2B vs. E). As shown in Fig. 2F compared with Fig. 2C, UCP1 protein content in BAT was also increased in both strains, but to a higher extend in the BAT of Lou/C rats compared with that of Wistar rats (respectively +745% vs. + 190%, p b 0.05). Because no evidence of a marked increase in BAT thermogenic capacity could account for the leanness of Lou/C rat, we investigated as to whether locomotor activity could contribute to this phenotype. At thermoneutrality, when they had free access to a running wheel (Fig. 4A), the spontaneous activity of Lou/C rats was amazingly higher than in Wistar rats of similar age (12,500 ± 643 vs. 350 ± 391 m/day, p b 0.01). In keeping with the nocturnal behaviour of rats, most of the running activity occurred during the dark period (data not shown).
Present results indicate that lean Lou/C rats do not exhibit higher BAT thermogenic capacity as compared with age-matched Wistar rats. Lou/C BAT was not deficient since it was easily reactivated by cold exposure. Lou/C rats showed a much higher spontaneous activity at thermoneutrality than Wistar rats and the difference between strains was reduced in the cold. 4.1. No evidence for a lower food intake in Lou/C rats Our results showed that food intake per unit body mass of Lou/C and Wistar rats was not significantly different in the two strains. Even if we normalize for the mass of metabolically active tissues (per kg-0.75), Lou/C rats were not food restricted. From carcass dissection after total digestion into KOH, we were able to determine that fat-free mass (FFM) represents 77% of total body mass in Wistar rats, and 88% in Lou/C rats. Expressing energy intake in relation with fat-free mass did not modify the conclusion of the same energy intake in Lou/C and Wistar rats. In line with several studies showing a lower amount of food eaten in Lou/C compared with Wistar rats [3,13], the present study clearly indicates that such a difference disappears when body mass or body composition is taken into account [4,7,9]. 4.2. No evidence for an activation of BAT in Lou/C rats at thermoneutrality Lou/C rats were leaner than their Wistar counterparts despite a similar energy intake. The reduced adiposity of this peculiar strain of rats could be explained by a higher energy expenditure, suggesting
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
897
Fig. 4. Monitoring of daily spontaneous activity in Wistar (black circles) and Lou/C rats (white circles) which had free access to a running wheel. A: at thermoneutrality (TN). B: Kinetic daily spontaneous activity, in Wistar (dark grey triangles) and Lou/C rats (grey triangles) cold exposed. C: Average daily spontaneous activity of Wistar or Lou/C rats at either thermoneutrality (25 °C, TN) or at 4 °C for 3 weeks (cold). Data are expressed as mean ± SEM per day (A, B) and for 3 weeks (C) from 6 rats per group.* p b 0.05, significant difference between strains. # p b 0.05, significant effect of cold acclimation.
that they better equilibrated their energy balance by comparison with Wistar rats thus reducing the amount of food energy available for storage. The increased storage efficiency observed in genetically obese animal, such as Zucker rats, was related in part to the inactivity of brown adipose tissue (BAT) [11,16]. In the present study, BAT thermogenic capacity was classically assessed by the in vivo thermogenic response to a test injection of NE, the main neuromediator activating BAT thermogenesis [12]. Lou/C rats responded to NE injection by a significant rise in oxygen consumption that is indicative of a capacity for thermogenesis through uncoupling respiration occurring in BAT [10,12]. However, the thermogenic effect was lower than in Wistar rats, suggesting a surprisingly lower BAT thermogenic capacity in this strain. Evidence for the absence of a higher BAT activity in Lou/C rats was also obtained from the similar relative mass of interscapular BAT depot and the lower relative UCP1 mRNA, mitochondrial content and UCP1 activity in BAT. Further other transcripts encoding proteins involved in glucose uptake (GLUT4), fatty acid transport to mitochondrial sites of oxidation (FABP, CPT1) were not differently expressed between strains. Therefore the possibility that despite a lower expression, UCP1 may be more thermogenically active in Lou/C rats is not consistent with the lack of i) increased respiration rates in vitro and ii) increased expression of proteins involved in substrate supply, both changes that are classically observed with UCP1 thermogenic activation [10]. These results differ from those previously obtained by Abdoulaye et al. [7] showing that the respiratory rate and thus proton conductance was higher in BAT
mitochondria from Lou/C than Fischer 344 rats. Such a discrepancy between studies may be related to differences in experimental design as Lou/C rats where compared to obesity-prone Fischer 344 rats in the study of Abdoulaye et al. [7], while we choose to compare them with the Wistar strain from which they derive. The observation that BAT had no higher thermogenic capacity in Lou/C than in Wistar rats contrasts with the increased tyrosine hydroxylase activity and increased noradrenaline content reported in this tissue in Lou/C rats that were interpreted as indexes of increased sympathetic activity in iBAT of Lou/C rats [8]. However, since data were expressed per unit weight of tissue in that study [8], the differences between strains may partly depend on the smaller mass of interscapular BAT in the Lou/C strain. Nevertheless, because β3-expression level (mRNA) is known to be dramatically downregulated (at least transiently) during continuous adrenergic stimulation [10], a slightly higher sympathetic tone in Lou/C rats might contribute, at least in part, to the low expression of BAT β3-receptors in this strain. This would result in a functional desensitization of BAT consistent with the small response to exogenous noradrenaline. It is unclear at this point why such putative increased sympathetic activity does not lead to increased BAT thermogenic capacity in Lou/C rats kept at thermoneutrality as BAT thermogenic activation follows changes in sympathetic activity. It could be postulated that the slightly higher sympathetic activity in Lou/C rats at thermoneutrality might not be sufficient to increase BAT thermogenic capacity as the tissue responsiveness is limited. However we cannot exclude that a slight increase in iBAT basal activity can
898
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
contribute at least in part to the phenotype of the Lou/C strain. A measurement of the quantitative contribution of BAT to in vivo resting metabolic rate is missing to clarify this point. Because the present study focused only on interscapular BAT that represents a major depot in rats (N30%), it cannot be excluded that other BAT depots might behave differently. However, the low amount of other depots, such as the perirenal fat depot for instance, did not allow us to perform similar biochemical and molecular analysis. Lou/C rats therefore represent an original model in which leanness is not associated with a clear increase in BAT thermogenic capacity. This unexpected observation led us to question as to whether the tissue would be deficient in this rat strain. Cold exposure, a classical stimulus of BAT thermogenesis [10,17,18], led to a clear stimulation of BAT in both strains as shown by an increase in iBAT mass (3 fold, when expressed in g per 100 g body mass), mitochondrial GDP-sensitive respiration, UCP1 mRNA and protein. These results demonstrate that BAT is not deficient in Lou/C rats and can be recruited when necessary for instance for thermoregulatory purposes. It follows that the leanness exhibited by Lou/C exposed to thermoneutral conditions does not require an increased BAT thermogenic capacity although a direct assessment of the thermogenic contribution of BAT to the higher metabolic rate of Lou/C rats would strengthen this conclusion. 4.3. Increased spontaneous locomotor activity in lean Lou/C rats The spontaneous activity of Lou/C rats was amazingly higher by comparison with Wistar rats, when rats had free access to a running wheel, in agreement with previous studies [19]. Locomotor activity is well known to increase energy expenditure [20] and activityassociated thermogenesis was found to amount to 11% of the resting metabolism in lean rats [20] during daylight, when spontaneous activity is low, and to 18% when measurements were performed over a 24 h cycle [21]. Thus, the lower adiposity observed in Lou/C rats could be partly accounted for by a higher locomotor activity leading to a higher energy expenditure. The energy expenditure stimulated by spontaneous activity would therefore be sufficient to dissipate excess energy intake and avoid BAT thermogenic stimulation. In the cold by contrast, spontaneous activity was reduced in Lou/C rats and BAT thermogenesis had to be recruited for regulatory thermogenesis in order to keep body temperature constant. Exercise at low temperature partially substitutes for thermoregulatory costs but is thermally unfavourable as it also increases convective heat loss [22] especially for small-size rats like Lou/C rats. The low adiposity of Lou/C rats is likely to reduce their thermal isolation and increase the cooling effect of running in the cold. The reason why Lou/C rats continue to exhibit a high level of spontaneous activity in the cold despite the negative cooling effect is unclear and deserves further experimentation. For instance, it should be investigated as to whether this could be related somehow to some addictive effect of running that would further increase the potential interest of this strain. 4.4. Other sources of energy dissipation in lean Lou/C rats Although increased locomotor activity may contribute to the higher daily expenditure of Lou/C rats, particularly during the active phase, it remains that the energy expenditure of Lou/C rats was also higher than that of Wistar rats in resting animals. Accordingly, Lou/C rats exhibited a higher energy expenditure than Wistar rats during the quiescent phase [9]. It follows that the high metabolic activity of Lou/C rats cannot be entirely explained by an increased physical activity. Additional thermogenic mechanisms that do not implicate BAT should be involved. Among these, the potential contribution of white adipose tissue characterised in Lou/C rats by an upregulation of peroxysome proliferator-activated receptor (PPAR)γ and PPARγ coactivator (PGC) 1α and an unexpected expression of UCP1 by comparison with the Wistar strain [23] should be evaluated. Transdifferentiation of white
into brown adipocytes might indeed result in a BAT-like phenotype in WAT contributing to the increase in whole-body EE. The potential implication of the liver should also be further investigated [24] as this metabolically active tissue can also contribute to facultative diet induced thermogenesis [25]. Finally, some degree of ‘metabolic uncoupling’ resulting from a shift from carbohydrate to fat oxidation in various tissues, [24] could also significantly contribute to enhanced whole-body energy expenditure in Lou/C rats independently of any changes in UCP1 expression. In conclusion, the present study brings new elements contributing to understand the reduced adiposity observed in obesity-resistant Lou/C rats. Present data show that brown adipose tissue, the tissue responsible for reducing metabolic efficiency in rodents, does not exhibit a higher thermogenic capacity in Lou/C rats kept at thermoneutrality as compared wih Wistar rats but could be recruited by cold exposure. Further studies are required to characterize the site and mechanisms of the enhanced energy expenditure of Lou/C rats. Acknowledgements MB and LT were in receipt of a fellowship from the French Ministère de l'Enseignement Supérieur et de la Recherche. This study was supported by grants from the Agence Nationale pour la Recherche. References [1] Felber JP, Golay A. Pathways from obesity to diabetes. Int J Obes Relat Metab Disord 2002;26(Suppl 2):S39–45. [2] Thompson D, Edelsberg J, Colditz GA, Bird AP, Oster G. Lifetime health and economic consequences of obesity. Arch Intern Med 1999;159:2177–83. [3] Couturier K, Servais S, Koubi H, Sempore B, Sornay-Mayet MH, Cottet-Emard JM, Lavoie JM, Favier R. Metabolic characteristics and body composition in a model of anti-obese rats (Lou/C). Obes Res 2002;10:188–95. [4] Helies JM, Diane A, Langlois A, Larue-Achagiotis C, Fromentin G, Tome D, Mormede P, Marissal-Arvy N. Comparison of fat storage between Fischer 344 and obesityresistant Lou/C rats fed different diets. Obes Res 2005;13:3–10. [5] Newby FD, DiGirolamo M, Cotsonis GA, Kutner MH. Model of spontaneous obesity in aging male Wistar rats. Am J Physiol Regul Integr Comp Physiol 1990;259: R1117–25. [6] Veyrat-Durebex C, Alliot J. Changes in pattern of macronutrient intake during aging in male and female rats. Physiol Behav 1997;62:1273–8. [7] Abdoulaye D, Wetzler S, Goubern M, Helies JM, Fromentin G, Tome D, LarueAchagiotis C. Comparison of energy balance in two inbred strains of rats: Fischer F344 prone to obesity and Lou rats resistant to obesity. Physiol Behav 2006;87:245–50. [8] Perrin D, Soulage C, Pequignot JM, Geloen A. Resistance to obesity in Lou/C rats prevents ageing-associated metabolic alterations. Diabetologia 2003;46:1489–96. [9] Soulage C, Soares AF, Lagarde M, Geloen A. Lou/C obesity-resistant rat exhibits hyperactivity, hypermetabolism, alterations in white adipose tissue cellularity, and lipid tissue profiles. Endocrinology 2008;149:615–25. [10] Cannon B, Nedergaard J. Brown adipose tissue: function and physiological significance. Physiol Rev 2004;84:277–359. [11] Rothwell NJ, Stock MJ. Energy balance, thermogenesis and brown adipose tissue activity in tube-fed rats. J Nutr 1984;114:1965–70. [12] Jansky L. Non-shivering thermogenesis and its thermoregulatory significance. Biol Rev Camb Philos Soc 1973;48:85–132. [13] Garait B, Couturier K, Servais S, Letexier D, Perrin D, Batandier C, Rouanet JL, Sibille B, Rey B, Leverve X, Favier R. Fat intake reverses the beneficial effects of low caloric intake on skeletal muscle mitochondrial H2O2 production. Free Radic Bio Med 2005;39:1249–61. [14] Favier RJ, Koubi HE. Metabolic and structural adaptations to exercise in chronic intermittent fasted rats. Am J Physiol 1988;254:R877–84. [15] Oufara S, Barre H, Rouanet JL, Minaire Y. Great adaptability of brown adipose tissue mitochondria to extreme ambient temperatures in control and cold-acclimated gerbils as compared with mice. Comp Biochem Physiol B 1988;90:209–14. [16] Himms-Hagen J. Obesity may be due to a malfunctioning of brown fat. Can Med Assoc J 1979;121:1361–4. [17] Jacobsson A, Muhleisen M, Cannon B, Nedergaard J. The uncoupling protein thermogenin during acclimation: indications for pretranslational control. Am J Physiol 1994;267:R999–R1007. [18] Matthias A, Ohlson KB, Fredriksson JM, Jacobsson A, Nedergaard J, Cannon B. Thermogenic responses in brown fat cells are fully UCP1-dependent. UCP2 or UCP3 do not substitute for UCP1 in adrenergically or fatty scid-induced thermogenesis. J Biol Chem 2000;275:25073–81. [19] Servais S, Couturier K, Koubi H, Rouanet JL, Desplanches D, Sornay-Mayet MH, Sempore B, Lavoie JM, Favier R. Effect of voluntary exercise on H2O2 release by subsarcolemmal and intermyofibrillar mitochondria. Free Rad Biol Med 2003;35: 24–32.
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899 [20] Girardier L, Clark MG, Seydoux J. Thermogenesis associated with spontaneous activity: an important component of thermoregulatory needs in rats. J Physiol 1995;488(Pt 3):779–87. [21] Brown D, Livesey G, Dauncey MJ. Influence of mild cold on the components of 24 hour thermogenesis in rats. J Physiol 1991;441:137–54. [22] Makinen T, Rintamaki H, Hohtola E, Hissa R. Energy cost and thermoregulation of unrestrained rats during exercise in the cold. Comp Biochem Physiol A Physiol 1996;114:57–63. [23] Veyrat-Durebex C, Montet X, Vinciguerra M, Gjinovci A, Meda P, Foti M, RohnerJeanrenaud F. The Lou/C rat: a model of spontaneous food restriction associated
899
with improved insulin sensitivity and decreased lipid storage in adipose tissue. Am J Physiol Endocrinol Metab 2009;296:E1120–32. [24] Taleux N, Guigas B, Dubouchaud H, Moreno M, Weitzel JM, Goglia F, Favier R, Leverve XM. High expression of thyroid hormone receptors and mitochondrial glycerol-3-phosphate dehydrogenase in the liver is linked to enhanced fatty acid oxidation in Lou/C, a rat strain resistant to obesity. Journal Biol Chem 2009;284: 4308–16. [25] Ma SW, Nadeau BE, Foster DO. Evidence for liver as the major site of the dietinduced thermogenesis of rats fed a “cafeteria” diet. Can J Physiol Pharmacol 1987: 1802–4 Lacraz.
Contents lists available at ScienceDirect
Physiology & Behavior j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / p h b
Leanness of Lou/C rats does not require higher thermogenic capacity of brown adipose tissue Maud Belouze a, Brigitte Sibille b, Benjamin Rey a, Damien Roussel a, Caroline Romestaing a, Loïc Teulier a, Delphine Baetz a, Harry Koubi a, Stéphane Servais a, Claude Duchamp a,⁎ a b
Laboratoire de Physiologie, Université de Lyon, CNRS, 43 Bvd 11 Novembre 1918, F-69622 Villeurbanne Cedex, France INSERM U907, Université de Nice-Sophia Antipolis, Faculté de Médecine, 28 avenue de Valombrose, 06107 Nice, France
a r t i c l e
i n f o
Article history: Received 12 July 2010 Received in revised form 20 May 2011 Accepted 24 May 2011 Keywords: Free running-wheel Lou/C rats Obesity Cold exposure Brown adipose tissue Thermogenesis UCP1
a b s t r a c t Lou/C rats, an inbred strain of Wistar origin, remain lean throughout life and therefore represent a remarkable model of obesity resistance. To date, the exact mechanisms responsible for the leanness of Lou/C rats remain unknown. The aim of the present study was to investigate whether the leanness of Lou/C rats relies on increased thermogenic capacities in brown adipose tissue (BAT). Results showed that although daily energy expenditure was higher in Lou/C than in Wistar rats, BAT thermogenic capacity was not enhanced in Lou/C rats kept at thermoneutrality as demonstrated by reduced thermogenic response to norepinephrine in vivo, similar oxidative activity of BAT isolated mitochondria in vitro, similar levels of UCP1 mRNA and lower abundance of UCP1 protein in interscapular BAT depots. Relative abundance of β3-adrenergic receptor mRNA was lower in Lou/C BAT while that of GLUT4, FABP or CPT1 was not altered. Activity-related energy expenditure was however considerably increased at thermoneutrality as Lou/C rats demonstrated an impressively high spontaneous running activity in voluntary running wheels. Prolonged cold-exposure (4 °C) depressed the spontaneous running activity of Lou/C rats while BAT thermogenic capacity was increased as reflected by rises in BAT mass, oxidative activity and UCP1 expression. It is concluded that the leanness of Lou/C rats cannot be ascribed to higher thermogenic capacity of brown fat but rather to, at least in part, increased locomotor activity. BAT is not deficient in this rat strain as it can be stimulated by cold exposure when locomotor activity is reduced suggesting some substitution between these thermogenic processes. © 2011 Elsevier Inc. All rights reserved.
1. Introduction The prevalence of obesity in humans continues to rise in industrialized countries, mainly in children, and constitutes a pressing problem of public health. Although multifactorial, the development of obesity results from an imbalance between caloric intake and energy expenditure that leads to body fat accumulation. Excessive body fat is associated with increased risk of chronic metabolic diseases such as atherosclerosis and diabetes [1,2]. Most of the genetic studies have focused on genes and polymorphisms associated with the obese phenotype. Considerably less attention has been paid to understand why certain people remain thin and do not develop obesity under the same environmental pressure (sedentary life, fat and energy rich foods). Many genetic manipulations and cross-breeding have created animal models of obesity providing an insight into the molecular mechanisms that affect energy balance and contribute to fat accretion. ⁎ Corresponding author at: LEHNA, UMR CNRS 5023, Université Lyon 1, Bâtiment Dubois, 43 bd 11 Novembre 1918, F-69622 Villeurbanne Cedex, France. Tel.: + 33 472 44 81 38; fax: + 33 472 43 11 72. E-mail address: [email protected] (C. Duchamp). 0031-9384/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.physbeh.2011.05.029
In contrast, few animal models are available to understand the molecular basis of leanness and resistance to obesity. A valuable model of obesity resistance is the Lou/C rat [3], an inbred strain of Wistar origin that does not develop obesity with high fat diet [4] and age [5] contrary to Wistar rats. Accordingly, Lou/C rats exhibit reduced body weight at all ages as compared to Wistar rats and percentage of fat is relatively stable throughout life [6]. Although the exact mechanisms responsible for the leanness of Lou/C rats remain unknown. It may imply i) a reduced energy intake, and/or ii) an enhanced energy expenditure. To date, it has been shown that Lou/C rats presented no reduction in food intake compared with Wistar or Fischer F344 rats [4,7–9], but exhibited higher daily energy expenditure [8,9]. Such increased energy expenditure may contribute to burn out food energy and thus reduce its storage in white adipose tissue. In rodents, brown adipose tissue (BAT) contributes to a significant part of energy expenditure on account of its large oxidative capacities [10]. It has thus been proposed that a defect in BAT activity may be involved in the development of obesity [11]. Indeed, BATassociated facultative thermogenesis is altered in obese rodents in connection with a reduction of uncoupling protein 1 (UCP1) expression [11]. Conversely, it may be postulated that the leanness
894
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
of Lou/C rats may rely on hyperactive BAT dissipating as heat excessive food energy intake. Accordingly, Abdoulaye and co-workers showed that the respiratory rate and proton conductance of mitochondria extracted from Lou/C BAT were higher than in Fischer 344 rats [7]. However, it cannot be excluded that such effect might also result from a very low thermogenic activity of mitochondria from the obesity-prone Fischer 344 rats. The aim of the present study was to investigate the potential increased thermogenic capacity of BAT in Lou/C rats as compared with age-matched Wistar rats, the rat strain from which Lou/C rats derive. Understanding the determinants of the outstanding leanness of Lou/C rats may yield important and complementary findings to the study of obesity models. 2. Methods 2.1. Animals Our study was performed in accordance with the recommendation provided by the European Convention for the protection of Vertebrate Animals used for Experimental and Scientific purposes (Council of Europe n° 123, Strasbourg, 1985). Two inbred strains of rats were used: male Lou/C rats (n = 23; Harlan, France) and male Wistar rats (n = 23; Harlan, France). At the age of 12 weeks, animals were housed six per box under a 12 h light/dark cycle, and allowed to acclimatise to their new conditions for 1 week before the study. Then, rats were housed individually and maintained in a temperature-controlled room (25 ± 1 °C) for three weeks before the beginning of experiments. After this period, the rats were split into different experimental groups described in “Procedure” section. Food (A04 – Scientific Animal Food & Engineering, France) and water were available ad libitum. Rat body mass was measured weekly until 22 weeks of age. Food consumption was estimated twice a week during all the experiments as the difference between the amount of food given and that removed from the cage. Spilling was taken into account as much as possible. Results were expressed per kg of body mass or per kg of fat free mass determined after post-mortem dissection of carcasses. 2.2. Procedure 2.2.1. Spontaneous locomotor activity Wistar and Lou/C rats (n = 6) were placed for three weeks at 25 °C in cages set up with a free-access exercise wheel (Bionox, Ancy, France) attached to one side of the cage. Food intake and body weight were determined once a week while spontaneous activity was monitored continuously. 2.2.2. Brown adipose tissue capacity Recruitment of thermogenic capacity in BAT was investigated classically in vivo by the calorigenic response to a test injection of norepinephrine (NE, Sigma) [12]. Wistar and Lou/C rats (n = 5 per group), 20–22 weeks old, were placed at thermoneutrality and their basal energy expenditure was monitored by indirect calorimetry. We used an open-circuit respirometer and gas analysing system as previously described [13]. Rats were positioned in a thermostatic chamber ventilated by a constant atmospheric airflow (4 L/min). Variable heat loss by conduction on the ground was minimized by a polypropylene bed. Ambient temperature (Ta) were controlled and measured with copper-constantan thermocouples inside the thermostatic chamber. Air flow rates were measured using a Platon volumeter, and converted to standard values (STPD). The fractional concentrations of oxygen were measured using a Servomex 1100 paramagnetic gas analyzer (Taylor Instrument Analytics ltd, Sussex, UK). Carbon dioxide concentrations were measured using a Servomex 1400 infrared gas analyzer. Analysers were calibrated daily and the
rates of O2 consumption and CO2 production as well as the caloric equivalent for O2 determined from the respiratory quotient were calculated as described previously [13]. The thermogenic response to norepinephrine was measured after a single intraperitoneal injection of norepinephrine (0.3 mg/kg) as compared with saline. Energy expenditure (W/kg) was monitored before (resting) and after the injection. Resting energy expenditure represents the lower level measured for at least 10–15 min periods between bursts of activity easily detected by peaks of O2 uptake and CO2 production on records. The thermogenic response to NE was calculated as the net increase in metabolic rate (maximal energy expenditure measured after injection minus basal energy expenditure). Brown fat thermogenic activation was then estimated by the functional activity of isolated mitochondria and the abundance of UCP1. Batches of Wistar or Lou/C rats (n = 6 per group) were reared at either thermoneutrality 25 °C or 4 °C for three week. Such coldacclimation protocol is known to induce metabolic activation of BAT in rodents [10]. Animals were killed by decapitation. Interscapular BAT (iBAT) and visceral fat pad (retroperitoneal and epididymal white adipose tissue) were rapidly excised and weighed. The viscera, including the liver, lungs, heart, and the gastrointestinal tract were removed. The remainder of the body, henceforth called the carcass, was digested in hot 30% KOH. The lipid content of this mixture was assumed to be representative of peripheral fat [14]. Taking account for visceral and peripheral fat, we obtained body composition of Wistar and Lou/C rats. A small portion of iBAT was immediately frozen in liquid nitrogen and stored at − 80 °C for reverse transcription polymerase chain reaction (RT-PCR) while the remaining was used for isolation of mitochondria by differential centrifugation as described previously [15]. Mitochondrial protein content was determined by the bicinchoninic acid (BCA) method (Pierce, Rockford, IL). Mitochondrial oxygen consumption was determined by polarography (Rank Brothers Ltd) at 37 °C in a medium containing 125 mM KCl, 1 mM EGTA, 2 mM KH2PO4, 20 mM Tris–HCl with 0.3% free fatty-acid BSA (pH 7.2). The control state of respiration (state 2) was initiated by the addition of 5 mM succinate, in the presence of 2 μM rotenone. To demonstrate the contribution of UCP1 to mitochondrial respiration, 1 mM of guanosine diphosphate (GDP), a known inhibitor of UCP1, was added to the mitochondrial suspension. Remainder of mitochondria was stored at −80 °C for western blot analysis. The relative abundance of target mRNA was determined by semiquantitative RT-PCR using β-actin as standard. RT was performed in a thermocycler Thermo Hybaid (Ashforf, UK) using 1 μg of total RNA extracted with Tri Reagent (Euromedex, France) Amplified fragments were separated on gels and their relative band intensities (ratio of each target to β-actin) were determined by scanning densitometry with a Kodak Digital Science 1D 2.0 software (Kodak Scientific Imaging System). Primers (sens and antisens) were GTG AAG GTC AGA ATG CAA GC and AGG GCC CCC TTC ATG AGG TC for UCP1 (gi6981691), GAGGCAACCTGCTGGTAATCAC and GAG TGA CAC TCT TGC GCC TCA G for β3 adrenergic receptor (gi6978462), CAG ATC GGC TCT GAA GGT GC and CTG AGT AGG CGC CAA TGA G for GLUT4 (glucose transporter 4, gi464195), CTG GAA GCT AGT GGA CAG and GAC TTG ACC TTC CTG TCA TC for FABP (fatty-acid binding protein, gi204079), TAT GTG AGG ATG CTG CTT CC and CTC GGA GAG CTA AGC TTG TC for CPT1 (carnitine palmitoyl transferase 1, NM_031559). The relative abundance of UCP1 was determined at the protein level. The remaining frozen iBAT mitochondria were used in western blot analysis. Briefly, 20 μg of iBAT mitochondria proteins were separated by SDS-PAGE (12.8% acrylamide) and transferred to polyvinyldene fluoride membranes (Immobilon-P, Millipore). Immunological detection was performed using a rabbit antiserum against UCP1 (α-diagnostics UCP11-A, USA). The detection was realized with a horseradish peroxidase-coupled anti-rabbit (Bio-Rad 170–6516) secondary antibody and an enhanced chemiluminescence (ECL)
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
895
detection kit (Amersham, UK). Autoradiographs were analysed by scanning densitometry with a Kodak Digital Science 1D 2.0 software (Kodak Scientific Imaging System).
2.3. Statistical analysis Data for body and tissue masses, food intake, energy expenditure and respiration of isolated mitochondria were analysed using ANOVA. When appropriate, a post-hoc PLSD fisher was used to compare means between-group. GDP effect was analysed using ANOVA repeated measures. Data were expressed as mean values ± SEM and statistical significance was set at p b 0.05. 3. Results Body, retroperitoneal white adipose tissue (rWAT), iBAT masses and body composition of Wistar and Lou/C rats were determined at the end of the experiment at the age of 22 weeks (Table 1). At thermoneutrality, Wistar rats were heavier than Lou/C rats. Such a difference could be explained at least in part by a lower adiposity as reflected by the lower mass of retroperitoneal fat depots in Lou/C compared with Wistar rats. Further, from carcass dissection, it was found that lipids accounted for 23.6 ± 0.5% of body mass in Wistar rats as compared with 12.1 ± 0.2% in Lou/C rats. Relative iBAT mass was not different between strains when expressed per 100 g body mass. At thermoneutrality, food intake, expressed in kJ/day/kg of body weight, was not significantly different between Wistar and Lou/C rats (respectively 650 ± 35 and 704 ± 24 kJ/day/kg). Lipid content of carcasses allowed us to calculate food intake in relation with fat free mass (FFM). Per unit FFM, food intake was similar in Wistar and Lou/C rats (respectively 851 ± 46 and 800 ± 28 kJ/day/kg FFM). Since no difference in caloric intake was observed between strains, the leanness of Lou/C rats could be related with a higher energy expenditure and potentially a higher thermogenic capacity of BAT. This is classically tested by the calorigenic response to an injection of NE at thermoneutrality aimed at reproducing the neurotransmitter release from sympathetic nerves innervating brown adipocytes. As noticeable in Fig. 1A, Lou/C rats exhibited a higher energy expenditure before and after norepinephrine injection (p b 0.05). In both strains, metabolic rate was significantly increased in response to norepinephrine as compared with the response to saline that did not modify the energy expenditure except for the first minutes after injection. However, the NE-induced stimulation of energy expenditure was shorter in Lou/C than in Wistar rats. Further, the maximal effect of norepinephrine above basal and the integrated response over the measurement period (AUC) were smaller (− 32%, p b 0.05; Fig. 1B) in Lou/C than in Wistar rats. These results showed that the thermogenic effect of a NE injection was lower in Lou/C than in Wistar rats suggesting an unexpected lower BAT thermogenic capacity in this strain.
Table 1 Body, rWAT, iBAT masses (g/100 g of body mass) and percentages of fat free mass (FFM) of 22 week-old Wistar and Lou/C rats at thermoneutrality (25 °C) and after 3 week-cold exposure (4 °C). rWAT = retroperitoneal white adipose tissue; iBAT = interscapular brown adipose tissue. * p b 0.05, significant difference between strains; # p b 0.05, significant effect of cold acclimation.
Final body mass (g) rWAT (g/100 g BM) iBAT (g/100 g BM) FFM (%BM)
Thermoneutrality
Cold
Wistar (n = 6)
Lou/C (n = 6)
Wistar (n = 6)
Lou/C (n = 6)
418 ± 14 0.83 ± 0.09 0.12 ± 0.01 76,4
270 ± 15 * 0.29 ± 0.06 * 0.10 ± 0.01 87,9 *
334 ± 11 # 0.27 ± 0.07 # 0.28 ± 0.05 #
251 ± 6 * 0.08 ± 0.01 *# 0.31 ± 0.01 #
Fig. 1. Thermogenic response to norepinephrine (NE) in 22 weeks old Lou/C and Wistar rats. A: Energy expenditure (W/kg) was measured at thermoneutrality (25 °C) in Lou/C (white) and Wistar (black) rats, before (resting) and 70 min after NE injection (0.3 mg/kg). Each value represents the mean ± SEM integrated in each group (n = 5) over a 10 min period. B: Integrated response to NE injection over the measurement period (AUC). Results are expressed as mean ± SEM. * p b 0.05, significant difference between strains. # p b 0.05, significant effect of NE injection.
In order to confirm the unexpected lower thermogenic capacity of BAT in Lou/C rats, we investigated the respiratory activity of isolated BAT mitochondria. When respiring with succinate/rotenone, state 2 respiration of mitochondria tended to be lower in Lou/ C rats reared at thermoneutrality than in Wistar rats (respectively 184 ± 52 and 307 ± 78 nanoatom oxygen/min/mg protein). In both strains, GDP decreased mitochondrial respiration and GDP-sensitive mitochondrial O2 consumption was similar in BAT mitochondria from Lou/C rats (Fig. 2A) indicating no higher UCP1-dependent respiratory activity in this strain. These functional studies were confirmed by molecular investigations of the relative abundance of UCP1 both at the mRNA and protein levels. Although UCP1 mRNA relative abundance was not significantly different in Wistar and Lou/C rats (Fig. 2B), UCP1 protein content in brown adipose tissue mitochondria was markedly lower in Lou/C than in Wistar rats (− 70%, Fig. 2C). The relative abundance of β3adrenergic receptor mRNA, the main adrenergic receptor mediating the thermogenic activation of BAT, was lower in Lou/C than in Wistar BAT (−36%, Fig. 3). The relative abundance of GLUT4, FABP and mitochondrial CPT1 were not significantly different between strains suggesting no up-regulation of proteins involved in substrate (glucose, fatty acids) supply to oxidative processes in brown adipocytes from Lou/C rats (Fig. 3). The surprisingly low thermogenic capacity of BAT in lean Lou/C rats led us to question as to whether the tissue would be deficient in this rat strain. To test this hypothesis, we exposed Wistar and Lou/C rats to cold, a situation well known to stimulate BAT activity and capacity. After 3 weeks at 4 °C, both Wistar and Lou/C rats were lighter than thermoneutral controls (respectively − 20% and −7%, p b 0.05; Table 1) in relation with a dramatic reduction in retroperitoneal adipose tissue mass (~−70% in both Wistar and Lou/C rats, p b 0.05; Table 1). By contrast the mass of iBAT was markedly increased in both Wistar (+ 133%) and Lou/C rats (+210%, p b 0.05; Table 1). Moreover, cold exposition stimulated BAT thermogenic
896
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
Fig. 3. Relative abundance of β3-adrenergic receptor, glucose transporter 4 (GLUT4), fatty-acid binding protein (FABP) and carnitine palmitoyl transferase (CPT1) mRNA in BAT of Wistar (dark bars, n = 6) or Lou/C (white bars, n = 6) rats reared at thermoneutrality. Results are expressed as mean ± SEM. * p b 0.05, significant difference between strains.
When exposed at 4 °C, Lou/C rats immediately reduced their locomotor activity that fall at 1000 m/d the first day (− 66%, p ≤ 0.05; Fig. 4B). Thereafter, their locomotor activity gradually increased and then stabilized at a much lower level (4293 ± 391 m/day) than that observed at thermoneutrality. Although reduced, the Lou/C rat activity remained higher than that of coldexposed Wistar rats (302 ± 26, p b 0.05; Fig. 4B and C). While the spontaneous locomotor activity Lou/C rats was markedly reduced during the first days in the cold, that of Wistar rats tended to be increased (+ 35%, p = 0.059; Fig. 4C). 4. Discussion Fig. 2. A: GDP-sensitive oxygen consumption (JO2) of BAT isolated mitochondria obtained by subtraction between control state respiration (with 5 mM succinate/2 μM rotenone as substrate) and after addition of 1 mM GDP. Thermoneutral Lou/C rats (white bars, n = 6) are compared with thermoneutral Wistar rats (black bars, n = 6). Basal values of mitochondrial respiration were 184 ± 52 and 307 ± 78 nanoatom oxygen/min/mg protein in Lou/C and Wistar rats, respectively. B: GDP-sensitive oxygen consumption (JO2) of BAT isolated mitochondria in cold-exposed Lou/C rats (white bars) compared with cold-exposed Wistar rats (black bars). C: Relative abundance of UCP1 mRNA in BAT of Wistar and Lou/C rats. D: Relative abundance of UCP1 mRNA in BAT mitochondria of cold exposed Wistar and Lou/C rats. E: UCP1 content of BAT mitochondria in Wistar and Lou/C rats. F: UCP1 content of BAT mitochondria in cold exposed Wistar and Lou/C rats. Results are expressed as mean ± SEM. * p b 0.05, significant difference between strains; # p b 0.05, significant effect of cold acclimation.
capacity in both Wistar and Lou/C strains as demonstrated by an increase in GDP effect on mitochondrial respiration (respectively −34% vs. −41% and − 34% vs. −45%, p b 0.05; Fig. 2A vs. D) and in UCP1 mRNA content (respectively +240% vs. +260%, p b 0.05; Fig. 2B vs. E). As shown in Fig. 2F compared with Fig. 2C, UCP1 protein content in BAT was also increased in both strains, but to a higher extend in the BAT of Lou/C rats compared with that of Wistar rats (respectively +745% vs. + 190%, p b 0.05). Because no evidence of a marked increase in BAT thermogenic capacity could account for the leanness of Lou/C rat, we investigated as to whether locomotor activity could contribute to this phenotype. At thermoneutrality, when they had free access to a running wheel (Fig. 4A), the spontaneous activity of Lou/C rats was amazingly higher than in Wistar rats of similar age (12,500 ± 643 vs. 350 ± 391 m/day, p b 0.01). In keeping with the nocturnal behaviour of rats, most of the running activity occurred during the dark period (data not shown).
Present results indicate that lean Lou/C rats do not exhibit higher BAT thermogenic capacity as compared with age-matched Wistar rats. Lou/C BAT was not deficient since it was easily reactivated by cold exposure. Lou/C rats showed a much higher spontaneous activity at thermoneutrality than Wistar rats and the difference between strains was reduced in the cold. 4.1. No evidence for a lower food intake in Lou/C rats Our results showed that food intake per unit body mass of Lou/C and Wistar rats was not significantly different in the two strains. Even if we normalize for the mass of metabolically active tissues (per kg-0.75), Lou/C rats were not food restricted. From carcass dissection after total digestion into KOH, we were able to determine that fat-free mass (FFM) represents 77% of total body mass in Wistar rats, and 88% in Lou/C rats. Expressing energy intake in relation with fat-free mass did not modify the conclusion of the same energy intake in Lou/C and Wistar rats. In line with several studies showing a lower amount of food eaten in Lou/C compared with Wistar rats [3,13], the present study clearly indicates that such a difference disappears when body mass or body composition is taken into account [4,7,9]. 4.2. No evidence for an activation of BAT in Lou/C rats at thermoneutrality Lou/C rats were leaner than their Wistar counterparts despite a similar energy intake. The reduced adiposity of this peculiar strain of rats could be explained by a higher energy expenditure, suggesting
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
897
Fig. 4. Monitoring of daily spontaneous activity in Wistar (black circles) and Lou/C rats (white circles) which had free access to a running wheel. A: at thermoneutrality (TN). B: Kinetic daily spontaneous activity, in Wistar (dark grey triangles) and Lou/C rats (grey triangles) cold exposed. C: Average daily spontaneous activity of Wistar or Lou/C rats at either thermoneutrality (25 °C, TN) or at 4 °C for 3 weeks (cold). Data are expressed as mean ± SEM per day (A, B) and for 3 weeks (C) from 6 rats per group.* p b 0.05, significant difference between strains. # p b 0.05, significant effect of cold acclimation.
that they better equilibrated their energy balance by comparison with Wistar rats thus reducing the amount of food energy available for storage. The increased storage efficiency observed in genetically obese animal, such as Zucker rats, was related in part to the inactivity of brown adipose tissue (BAT) [11,16]. In the present study, BAT thermogenic capacity was classically assessed by the in vivo thermogenic response to a test injection of NE, the main neuromediator activating BAT thermogenesis [12]. Lou/C rats responded to NE injection by a significant rise in oxygen consumption that is indicative of a capacity for thermogenesis through uncoupling respiration occurring in BAT [10,12]. However, the thermogenic effect was lower than in Wistar rats, suggesting a surprisingly lower BAT thermogenic capacity in this strain. Evidence for the absence of a higher BAT activity in Lou/C rats was also obtained from the similar relative mass of interscapular BAT depot and the lower relative UCP1 mRNA, mitochondrial content and UCP1 activity in BAT. Further other transcripts encoding proteins involved in glucose uptake (GLUT4), fatty acid transport to mitochondrial sites of oxidation (FABP, CPT1) were not differently expressed between strains. Therefore the possibility that despite a lower expression, UCP1 may be more thermogenically active in Lou/C rats is not consistent with the lack of i) increased respiration rates in vitro and ii) increased expression of proteins involved in substrate supply, both changes that are classically observed with UCP1 thermogenic activation [10]. These results differ from those previously obtained by Abdoulaye et al. [7] showing that the respiratory rate and thus proton conductance was higher in BAT
mitochondria from Lou/C than Fischer 344 rats. Such a discrepancy between studies may be related to differences in experimental design as Lou/C rats where compared to obesity-prone Fischer 344 rats in the study of Abdoulaye et al. [7], while we choose to compare them with the Wistar strain from which they derive. The observation that BAT had no higher thermogenic capacity in Lou/C than in Wistar rats contrasts with the increased tyrosine hydroxylase activity and increased noradrenaline content reported in this tissue in Lou/C rats that were interpreted as indexes of increased sympathetic activity in iBAT of Lou/C rats [8]. However, since data were expressed per unit weight of tissue in that study [8], the differences between strains may partly depend on the smaller mass of interscapular BAT in the Lou/C strain. Nevertheless, because β3-expression level (mRNA) is known to be dramatically downregulated (at least transiently) during continuous adrenergic stimulation [10], a slightly higher sympathetic tone in Lou/C rats might contribute, at least in part, to the low expression of BAT β3-receptors in this strain. This would result in a functional desensitization of BAT consistent with the small response to exogenous noradrenaline. It is unclear at this point why such putative increased sympathetic activity does not lead to increased BAT thermogenic capacity in Lou/C rats kept at thermoneutrality as BAT thermogenic activation follows changes in sympathetic activity. It could be postulated that the slightly higher sympathetic activity in Lou/C rats at thermoneutrality might not be sufficient to increase BAT thermogenic capacity as the tissue responsiveness is limited. However we cannot exclude that a slight increase in iBAT basal activity can
898
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899
contribute at least in part to the phenotype of the Lou/C strain. A measurement of the quantitative contribution of BAT to in vivo resting metabolic rate is missing to clarify this point. Because the present study focused only on interscapular BAT that represents a major depot in rats (N30%), it cannot be excluded that other BAT depots might behave differently. However, the low amount of other depots, such as the perirenal fat depot for instance, did not allow us to perform similar biochemical and molecular analysis. Lou/C rats therefore represent an original model in which leanness is not associated with a clear increase in BAT thermogenic capacity. This unexpected observation led us to question as to whether the tissue would be deficient in this rat strain. Cold exposure, a classical stimulus of BAT thermogenesis [10,17,18], led to a clear stimulation of BAT in both strains as shown by an increase in iBAT mass (3 fold, when expressed in g per 100 g body mass), mitochondrial GDP-sensitive respiration, UCP1 mRNA and protein. These results demonstrate that BAT is not deficient in Lou/C rats and can be recruited when necessary for instance for thermoregulatory purposes. It follows that the leanness exhibited by Lou/C exposed to thermoneutral conditions does not require an increased BAT thermogenic capacity although a direct assessment of the thermogenic contribution of BAT to the higher metabolic rate of Lou/C rats would strengthen this conclusion. 4.3. Increased spontaneous locomotor activity in lean Lou/C rats The spontaneous activity of Lou/C rats was amazingly higher by comparison with Wistar rats, when rats had free access to a running wheel, in agreement with previous studies [19]. Locomotor activity is well known to increase energy expenditure [20] and activityassociated thermogenesis was found to amount to 11% of the resting metabolism in lean rats [20] during daylight, when spontaneous activity is low, and to 18% when measurements were performed over a 24 h cycle [21]. Thus, the lower adiposity observed in Lou/C rats could be partly accounted for by a higher locomotor activity leading to a higher energy expenditure. The energy expenditure stimulated by spontaneous activity would therefore be sufficient to dissipate excess energy intake and avoid BAT thermogenic stimulation. In the cold by contrast, spontaneous activity was reduced in Lou/C rats and BAT thermogenesis had to be recruited for regulatory thermogenesis in order to keep body temperature constant. Exercise at low temperature partially substitutes for thermoregulatory costs but is thermally unfavourable as it also increases convective heat loss [22] especially for small-size rats like Lou/C rats. The low adiposity of Lou/C rats is likely to reduce their thermal isolation and increase the cooling effect of running in the cold. The reason why Lou/C rats continue to exhibit a high level of spontaneous activity in the cold despite the negative cooling effect is unclear and deserves further experimentation. For instance, it should be investigated as to whether this could be related somehow to some addictive effect of running that would further increase the potential interest of this strain. 4.4. Other sources of energy dissipation in lean Lou/C rats Although increased locomotor activity may contribute to the higher daily expenditure of Lou/C rats, particularly during the active phase, it remains that the energy expenditure of Lou/C rats was also higher than that of Wistar rats in resting animals. Accordingly, Lou/C rats exhibited a higher energy expenditure than Wistar rats during the quiescent phase [9]. It follows that the high metabolic activity of Lou/C rats cannot be entirely explained by an increased physical activity. Additional thermogenic mechanisms that do not implicate BAT should be involved. Among these, the potential contribution of white adipose tissue characterised in Lou/C rats by an upregulation of peroxysome proliferator-activated receptor (PPAR)γ and PPARγ coactivator (PGC) 1α and an unexpected expression of UCP1 by comparison with the Wistar strain [23] should be evaluated. Transdifferentiation of white
into brown adipocytes might indeed result in a BAT-like phenotype in WAT contributing to the increase in whole-body EE. The potential implication of the liver should also be further investigated [24] as this metabolically active tissue can also contribute to facultative diet induced thermogenesis [25]. Finally, some degree of ‘metabolic uncoupling’ resulting from a shift from carbohydrate to fat oxidation in various tissues, [24] could also significantly contribute to enhanced whole-body energy expenditure in Lou/C rats independently of any changes in UCP1 expression. In conclusion, the present study brings new elements contributing to understand the reduced adiposity observed in obesity-resistant Lou/C rats. Present data show that brown adipose tissue, the tissue responsible for reducing metabolic efficiency in rodents, does not exhibit a higher thermogenic capacity in Lou/C rats kept at thermoneutrality as compared wih Wistar rats but could be recruited by cold exposure. Further studies are required to characterize the site and mechanisms of the enhanced energy expenditure of Lou/C rats. Acknowledgements MB and LT were in receipt of a fellowship from the French Ministère de l'Enseignement Supérieur et de la Recherche. This study was supported by grants from the Agence Nationale pour la Recherche. References [1] Felber JP, Golay A. Pathways from obesity to diabetes. Int J Obes Relat Metab Disord 2002;26(Suppl 2):S39–45. [2] Thompson D, Edelsberg J, Colditz GA, Bird AP, Oster G. Lifetime health and economic consequences of obesity. Arch Intern Med 1999;159:2177–83. [3] Couturier K, Servais S, Koubi H, Sempore B, Sornay-Mayet MH, Cottet-Emard JM, Lavoie JM, Favier R. Metabolic characteristics and body composition in a model of anti-obese rats (Lou/C). Obes Res 2002;10:188–95. [4] Helies JM, Diane A, Langlois A, Larue-Achagiotis C, Fromentin G, Tome D, Mormede P, Marissal-Arvy N. Comparison of fat storage between Fischer 344 and obesityresistant Lou/C rats fed different diets. Obes Res 2005;13:3–10. [5] Newby FD, DiGirolamo M, Cotsonis GA, Kutner MH. Model of spontaneous obesity in aging male Wistar rats. Am J Physiol Regul Integr Comp Physiol 1990;259: R1117–25. [6] Veyrat-Durebex C, Alliot J. Changes in pattern of macronutrient intake during aging in male and female rats. Physiol Behav 1997;62:1273–8. [7] Abdoulaye D, Wetzler S, Goubern M, Helies JM, Fromentin G, Tome D, LarueAchagiotis C. Comparison of energy balance in two inbred strains of rats: Fischer F344 prone to obesity and Lou rats resistant to obesity. Physiol Behav 2006;87:245–50. [8] Perrin D, Soulage C, Pequignot JM, Geloen A. Resistance to obesity in Lou/C rats prevents ageing-associated metabolic alterations. Diabetologia 2003;46:1489–96. [9] Soulage C, Soares AF, Lagarde M, Geloen A. Lou/C obesity-resistant rat exhibits hyperactivity, hypermetabolism, alterations in white adipose tissue cellularity, and lipid tissue profiles. Endocrinology 2008;149:615–25. [10] Cannon B, Nedergaard J. Brown adipose tissue: function and physiological significance. Physiol Rev 2004;84:277–359. [11] Rothwell NJ, Stock MJ. Energy balance, thermogenesis and brown adipose tissue activity in tube-fed rats. J Nutr 1984;114:1965–70. [12] Jansky L. Non-shivering thermogenesis and its thermoregulatory significance. Biol Rev Camb Philos Soc 1973;48:85–132. [13] Garait B, Couturier K, Servais S, Letexier D, Perrin D, Batandier C, Rouanet JL, Sibille B, Rey B, Leverve X, Favier R. Fat intake reverses the beneficial effects of low caloric intake on skeletal muscle mitochondrial H2O2 production. Free Radic Bio Med 2005;39:1249–61. [14] Favier RJ, Koubi HE. Metabolic and structural adaptations to exercise in chronic intermittent fasted rats. Am J Physiol 1988;254:R877–84. [15] Oufara S, Barre H, Rouanet JL, Minaire Y. Great adaptability of brown adipose tissue mitochondria to extreme ambient temperatures in control and cold-acclimated gerbils as compared with mice. Comp Biochem Physiol B 1988;90:209–14. [16] Himms-Hagen J. Obesity may be due to a malfunctioning of brown fat. Can Med Assoc J 1979;121:1361–4. [17] Jacobsson A, Muhleisen M, Cannon B, Nedergaard J. The uncoupling protein thermogenin during acclimation: indications for pretranslational control. Am J Physiol 1994;267:R999–R1007. [18] Matthias A, Ohlson KB, Fredriksson JM, Jacobsson A, Nedergaard J, Cannon B. Thermogenic responses in brown fat cells are fully UCP1-dependent. UCP2 or UCP3 do not substitute for UCP1 in adrenergically or fatty scid-induced thermogenesis. J Biol Chem 2000;275:25073–81. [19] Servais S, Couturier K, Koubi H, Rouanet JL, Desplanches D, Sornay-Mayet MH, Sempore B, Lavoie JM, Favier R. Effect of voluntary exercise on H2O2 release by subsarcolemmal and intermyofibrillar mitochondria. Free Rad Biol Med 2003;35: 24–32.
M. Belouze et al. / Physiology & Behavior 104 (2011) 893–899 [20] Girardier L, Clark MG, Seydoux J. Thermogenesis associated with spontaneous activity: an important component of thermoregulatory needs in rats. J Physiol 1995;488(Pt 3):779–87. [21] Brown D, Livesey G, Dauncey MJ. Influence of mild cold on the components of 24 hour thermogenesis in rats. J Physiol 1991;441:137–54. [22] Makinen T, Rintamaki H, Hohtola E, Hissa R. Energy cost and thermoregulation of unrestrained rats during exercise in the cold. Comp Biochem Physiol A Physiol 1996;114:57–63. [23] Veyrat-Durebex C, Montet X, Vinciguerra M, Gjinovci A, Meda P, Foti M, RohnerJeanrenaud F. The Lou/C rat: a model of spontaneous food restriction associated
899
with improved insulin sensitivity and decreased lipid storage in adipose tissue. Am J Physiol Endocrinol Metab 2009;296:E1120–32. [24] Taleux N, Guigas B, Dubouchaud H, Moreno M, Weitzel JM, Goglia F, Favier R, Leverve XM. High expression of thyroid hormone receptors and mitochondrial glycerol-3-phosphate dehydrogenase in the liver is linked to enhanced fatty acid oxidation in Lou/C, a rat strain resistant to obesity. Journal Biol Chem 2009;284: 4308–16. [25] Ma SW, Nadeau BE, Foster DO. Evidence for liver as the major site of the dietinduced thermogenesis of rats fed a “cafeteria” diet. Can J Physiol Pharmacol 1987: 1802–4 Lacraz.