Left ventricular hypertrophy and angiotensin-converting enzyme gene polymorphism in renal allograft recipients

Left Ventricular Hypertrophy and Angiotensin-Converting Enzyme Gene Polymorphism in Renal Allograft Recipients M. Koc¸, I.C. " O¨zener, H. Tezcan, A. Bihorac, T. Isbir, and E. Akog˘lu

C

ARDIOVASCULAR complications are the major cause of late mortality in transplant recipients.1 Of the many factors involved in the pathogenesis of these complications,1,2 left ventricular hypertrophy (LVH) is considered a major independent risk factor for cardiac disease.3 In addition, LVH occurs in more than 50% of patients with end-stage renal disease (ESRD),4 and cardiovascular disease is the most common cause of death in ESRD patients.5 Hemodynamic advantages associated with renal transplantation are expected to have a beneficial effect on the recipient’s cardiovascular system, especially with regard to LV H. However, there are conflicting data on the changes in left ventricular mass index (LVMI) that occur after renal transplantation.6,7 The fact that many subjects with LVH have normal blood pressure suggests that the factors traditionally associated with LVH may be less important than previously assumed, and/or that genetic background contributes to the development of LVH. Angiotensin-converting enzyme (ACE) is a key enzyme in the production of angiotensin II, and thus may function in the modulation of cardiac growth.8 The cloning of the ACE gene has made it possible to identify an insertion (I)-deletion (D) polymorphism in intron 16 that appears to affect serum ACE activity level.9,10 In addition, patients of DD genotype show the highest ACE levels and are at an increased risk for developing LVH if they are essential hypertensives11,12 or renal transplant recipients.13 In this study, we measured the morphological and functional cardiac changes characterized by cardiac echocardiography in 29 nondiabetic renal transplant recipients whose ACE genotypes were known. We investigated the potential association between insertion-deletion (I/D) polymorphism of the ACE gene and left ventricular mass and function. METHODS Patients were selected from the outpatient renal transplantation clinic. We included 29 nondiabetic renal transplant recipients in the study. All patients were routinely receiving 240 mg/d slow-release diltiazem in two separate doses to increase their plasma levels of cyclosporine A (CyA). Alpha adrenoceptor antagonists (doxazosin), ACE-inhibitors, diuretics, and centrally acting sympatholytics were sequentially added as clinically indicated, to achieve adequate blood pressure control. No patient had cardiac failure or angina pectoris during follow-up examination. Causes of pretransplantation renal failure were chronic glomerulonephritis in 76.6% and 0041-1345/00/$–see front matter PII S0041-1345(00)00882-4 542

chronic pyelonephritis in 23.3% of patients. The patients were all on a CyA-based immunosuppressive regimen. All patients were monitored using a Spacelab 90207 ambulatory monitor (Spacelabs Medical, Redmond, USA) every 15 minutes from 7:00 AM to 11:00 PM, and every 30 minutes from 11:00 PM to 7:00 AM. The monitors were calibrated five times against a mercury sphygmomanometer at the beginning of each session, and monitoring was performed in accordance with recent guidelines.14 All subjects completed a sleep and activity diary at the time of ambulatory blood pressure monitoring (ABPM) and the night time was defined as self-reported sleeping period by the patients. Mean night-time blood pressure was calculated automatically using the computerized program of the ABPM. Blood pressure monitoring recorded 24-hour mean systolic, 24-hour mean diastolic, and 24-hour mean arterial pressure (MAP). The upper limits of normotension were defined as 130/80 mm Hg for 24-hour ambulatory blood pressure data.15 Two-dimensional guided M-mode echocardiography was performed by standard methods using an ultrasound system (Ultramark 9, Advanced Technology Laboratories, Bothell, WA, USA) with a 2.25-MHz transducer, and the same cardiologist did the recordings for all patients. Left ventricular internal dimension (LVID) and septal (IVST) and posterior wall thickness (PWT) were measured at end-diastole, according to American Society of Echocardiography guidelines.16 Left ventricular mass (LVM) was calculated at end-diastole using the Penn convention formula (LVM ⫽ 1.04 [(LVIDd ⫹ IVSTd ⫹ PWTd)3 ⫺ LVIDd3] ⫺ 13.6 g).17 LVMI was calculated as the ratio of left ventricular mass to body surface area. Relative wall thickness (RWT) was measured at end-diastole as 2 ⫻ PWT/LVID.18 The cut-off level that defined left ventricular hypertrophy was LVMI ⬎ 134 g/m2 in males, and ⬎110 g/m2 in females.19 The previously described D and I alleles of the ACE gene were detected by polymerase chain reaction (PCR) amplification of a fragment of intron 16 of the ACE gene.20 mDNA was purified from 3 mL of blood by proteinase K digestion, phenol extraction, and ethanol precipitation, following standard protocols.21 Approximately 0.1 ␮g of DNA was amplified with primers hace3s, 5⬘ GCCCTGCAGGTGTCTGCAGCATGT 3⬘, and hace3s, 5⬘ GGATGGCTCTCCCCGCCTTGTCTC 3⬘, which yield PCR products of 319 bp and 597 bp for the D and I alleles, respectively. PCR From the Nephrology Division (M.K., I.C.O " ¨ ., A.B., E.A.), Department of Cardiology (H.T.), Marmara University School of Medicine; and the Department of Molecular Medicine (T.I.), Istanbul University, Istanbul, Turkey. Address reprint requests to Dr Koc, Tophanelioglu Cd. Kosk Sit., Bl-Blk D-5, Uskidar/Istanbul, Turkey. © 2000 by Elsevier Science Inc. 655 Avenue of the Americas, New York, NY 10010 Transplantation Proceedings, 32, 542–544 (2000)

LVH AND ACE GENE POLYMORPHISM

543

Table 1. Characteristics of the Renal Transplant Recipients Classified According to Their Angiotensin-Converting Enzyme Genotype Status Characteristics

DD (n ⫽ 12)

ID (n ⫽ 12)

II (n ⫽ 5)

Age (y) Gender (male/female) BMI (kg/m2) Time since grafting (mos) Serum creatinine (mg/mL) Creatinine clearance (mL/min) Cyclosporine A level (ng/mL) Hemoglobin (g/dL) No. of antihypertensives Hypertension (%) 24-h SBP (mm Hg) 24-h DBP (mm Hg) 24-h mean MAP (mm Hg)

37.5 ⫾ 2.0 7/5 27.0 ⫾ 1.5 44.2 ⫾ 6.8 1.75 ⫾ 0.3 49.5 ⫾ 7.2 144.8 ⫾ 10.5 12.5 ⫾ 0.6 1.8 ⫾ 0.2 50 129.6 ⫾ 7.5 83.7 ⫾ 4.6 99.4 ⫾ 5.7

35.7 ⫾ 2.6 10/2 24.0 ⫾ 1.1 32.5 ⫾ 8.2 1.8 ⫾ 0.3 49.4 ⫾ 6.0 159.3 ⫾ 16.3 12.3 ⫾ 0.5 1.3 ⫾ 0.1 66 130.1 ⫾ 4.6 81.0 ⫾ 2.1 97.5 ⫾ 2.7

30.8 ⫾ 4.3 2/3 21.1 ⫾ 0.9 73.4 ⫾ 23.6* 1.7 ⫾ 0.4 44.6 ⫾ 11.1 118.8 ⫾ 15.5* 11.8 ⫾ 0.4 1.2 ⫾ 0.2 60 128.6 ⫾ 8.7 86.0 ⫾ 6.6 103.0 ⫾ 7.1

Abbreviations: BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; MAP, mean arterial pressure. Values are expressed as mean ⫾ SEM. *P ⬍ .05 II versus ID.

reaction conditions included 10 mmol/L Tris-HCl, pH 9.0, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% Triton X-100, 0.1 mmol/L dNTP, 0.5 ␮mol/L of each primer, and 1 U taq DNA polymerase. A Perkin-Elmer 480 thermal cycler was used to perform 30 amplification cycles with the following temperature profile: 94°C (1 minute), 62°C (1 minute), and 72°C (1 minute). Ten microliters of the amplification product were resolved by electrophoresis in 5% polyacrylamide gels and visualized under ultraviolet light after staining with 0.5 ␮g/mL ethidium bromide. Clinical and biochemical data were collected at the time of ABPM. Serum creatinine and other biochemical parameters were measured in a computerized autoanalyzer (Hitachi 717, Boehringer Manheim, Germany). Total blood CyA levels were quantified by fluorescence immunoassay (CyA monoclonal whole blood assay, Abbot, Ill, USA).

Statistical Analysis All values are expressed as mean ⫾ SE. The Kruskall Wallis two-way analysis of variance by ranks tests was used to compare the three groups’ variables. Chi-squared analyses were used when the baseline characteristics were categorical. P ⬍ .05 was considered statistically significant. The statistical analyses were performed using SPSS version 6.0 for Windows.

compared to the II group (159.3 ⫾ 16.3 ng/mL versus 118.8 ⫾ 15.5 ng/mL, respectively; P ⬍ .05). The prevalence of hypertension was 50%, 66%, and 60% in the DD, ID, and II groups, respectively, and there were no differences among the groups with regard to number of patients with hypertension (Table 1). The percentage of patients using the different classes of antihypertensive drugs was statistically similar in the three groups (␣-blockers 25%, 25%, and 20%; ACE inhibitors, 50%, 16%, and 20%; centrally acting sympatholytics, 8.3%, 0%, and 0% in the DD, ID, and II groups, respectively). The groups were also similar with regard to 24-hour systolic pressure, 24-hour diastolic pressure, and 24-hour MAP (Table 1). Echocardiographic data from three groups are summarized in Table 2. LVH was present in 41.6% of DD patients, 33.3% of ID patients, and 80% of II patients. LVMI was also similar among the groups (116.0 ⫾ 9.1 g/m2, 114.9 ⫾ 9.3 g/m2, and 124.4 ⫾ 11.1 g/m2 in the DD, ID, and II groups, respectively). IVST, PWT, RWT, and percentage of patients with LVH were similar among the three groups as well as (Table 2). DISCUSSION

RESULTS

The distribution of the DD, ID, and II genotypes in our patients was 41.4% (n ⫽ 12), 41.4% (n ⫽ 12), and 17.2% (n ⫽ 5), respectively. The frequencies of the D and I alleles were 0.62 and 0.38, respectively. The clinical characteristics of the DD, ID, and II groups of our renal transplant recipients are presented in Table 1. There were no differences among the groups with regard to age, gender, body mass index, number of prescribed hypertensives, serum creatinine, creatinine clearance, and hemoglobin levels. Time since renal grafting was longer in the II group compared to the ID group (73.4 ⫾ 23.6 months versus 32.5 ⫾ 8.2 months, respectively; P ⬍ .05). Similarly, the level of CyA was also statistically higher in the ID group

Left ventricular hypertrophy is common in renal transplant recipients. Prospective studies have shown a significant regression of LVH in these patients.23 However, some observations and the fact that LVH persists even in wellcontrolled hypertensive renal transplant recipients suggest that other factors, including the renin-angiotensin system, may be involved in the development and persistence of LVH.23,24 Several groups have reported that the DD genotype of ACE gene polymorphism is associated with increased serum ACE activity, which affects the production of angiotensin II and may modulate cardiac growth.25 Prospective echocardiographic studies of essential hypertensive patients and renal transplant recipients have shown that there is significantly less regression, and even an increase, of

KOC¸, O¨ZENER, TEZCAN ET AL

544

Table 2. The echocardiographic parameters for the renal transplant recipients Parameters

DD (n ⫽ 12)

ID (n ⫽ 12)

II (n ⫽ 5)

LAD (mm) LVM (g) LVMI (g/m2) LVEDD (mm) IVST (mm) PWT (mm) RWT Patients with LVH (%)

39.0 ⫾ 1.8 214.0 ⫾ 14.4 116.0 ⫾ 9.1 51.6 ⫾ 1.3 10.9 ⫾ 0.4 8.8 ⫾ 0.3 0.34 ⫾ 0.01 41.6

41.5 ⫾ 2.3 212.0 ⫾ 19.6 114.9 ⫾ 9.3 51.3 ⫾ 2.1 9.5 ⫾ 0.4 8.7 ⫾ 0.4 0.33 ⫾ 0.02 33.3

35.8 ⫾ 1.7 194.4 ⫾ 21.5 124.4 ⫾ 11.1 49.2 ⫾ 1.8 10.2 ⫾ 1.0 8.8 ⫾ 0.5 0.35 ⫾ 0.03 80

Abbreviations: LAD, left atrial diameter; LVM, left ventricular mass; LVMI, left ventricular mass index; LVEDD, left ventricular end diastolic diameter; IVST, interventricular septal thickness; PWT, posterior wall thickness; RWT, relative wall thickness; LVH, left ventricular hypertrophy. Values are expressed as mean ⫾ SE.

LVMI in patients with the DD genotype of ACE polymorphism.13,26 Hernandez et al, in their prospective study, reported that mean percent increase of LVMI after 12 months of follow-up was significantly greater in patients with the DD genotype compared to those together with (ID and II) group (21.3 ⫾ 7.9% versus ⫺0.08 ⫾ 4.9%, respectively; P ⬍ .05).13 In another study, Kohno et al reported that after 2 years of treatment with ACE inhibitors, reduction in LVMI was significantly less in the DD group than in the II group.26 In contrast to these studies, Lindpainter et al found no link between ACE genotype and LVMI in essential hypertension.27 Similarly, our study showed no significant differences in LVM and LVMI among the three ACE genotypes. This may be due to the fact that blood pressure was well controlled in all three of our patient groups. Himelman et al also found that renal transplant recipients’ LVH regressed after they controlled blood pressure.10 Another potential explanation may be the higher percentage of patients using ACE inhibitors in the DD (50%) group versus the ID (16%) and II (20%) groups. A meta-analysis has shown that ACE inhibitors are more effective than other groups of antihypertensive drugs at reducing left ventricular mass in hypertensive patients.28 We investigated a small number of patients, and our results need to be tested in larger studies. Also, the response of the three ACE genotypes to ACE inhibitors and angiotensin II receptor antagonists should be investigated in more depth in a larger group of renal transplant recipients. REFERENCES 1. First MR: Am J Kidney Dis 22:477, 1993 2. Kasiske Bl: Miner Electrol Metab 19:186, 1993 3. Levy D, Garrison RJ, Savage DD, et al: N Engl J Med 322:1561, 1990 4. Bullock RE, Hussein AA, Simpson I, et al: Br Med J 289:1479, 1984 5. Compty CM, Shapiro FL: In Drukker, Parsons, Maher (eds):

Replacement of Renal Function by Dialysis; 2nd Ed. Boston, Nijhoff; 1983 6. Hu ¨ting J: Am J of Cardiol 70:1481, 1992 7. Himelman RB, Landzberg JS, Simonson JS, et al: J Am Coll Cardiol 12:915, 1988 8. Lindpainter K, Ganten D: Circ Res 68:905, 1991 9. Soubrier F, Alhenc, Gelas F, et al: Proc Natl Acad Sci USA 85:9386, 1988 10. Rigat B, Hubert C, Alhenc-Gelas F, et al: J Clin Invest 86:1343, 1990 11. Schunkert H, Hense H-W, Holmer SR, et al: N Engl J Med 330:1634, 1994 12. Marian AJ, Yu Q-T, Workman R, et al: Lancet 342:1085, 1993 13. Hernandez D, Lacalzada J, Rufino M, et al: Kidney Int 51:1205, 1997 14. White WB, Berson AS, Robbins C, et al: Hypertension 21:504, 1993 15. Staessen JA, Bieniaszewski L, O’Brien ET, et al: Nephrol Dial Transplant 11:241, 1996 16. Sahn DJ, DeMaria A, Kisslo J, et al: Circulation 58:1076, 1978 17. Devereux RB, Reichek N: Circulation 55:613, 1977 18. Reichek N, Devereux RB: Am Heart J 103:202, 1982 19. Krumholz HM, Larson M, Levy D: J Am Coll Cardiol 25:879, 1995 20. Lindpainter K, Pfeffer MA, Kreutz R, et al: N Engl J Med 332:706, 1995 21. Davis LG, Dibner MD, Battey JF: Basic Methods in Molecular Biology. New York: Elsevier; 1986, p 44 22. Teruel JL, Rodriguez Padial L, Qereda C, et al: Transplantation 43:307, 1987 23. Schunkert H, Jackson B, Tang SS, et al: Circulation 87:1328, 1993 24. Perticone F, Maio R, Cosco C, et al: Cardiovasc Res 43:192, 1999 25. Baker KM, Aceto JF: Am J Physiol 259:H610, 1990 26. Kohno M, Yokokawa K, Minami M, et al: Am J Med 106:544, 1999 27. Lindpainter K, Lee M, Larson MG, et al: N Engl J Med 334:1023, 1996 28. Dahlo ¨f B, Pennert K, Hansson L: Am J Hypertens 5:95, 1992