Leishmania aethiopica: Identification and characterization of cathepsin L-like cysteine protease genes

Experimental Parasitology 115 (2007) 283–290 www.elsevier.com/locate/yexpr

Leishmania aethiopica: IdentiWcation and characterization of cathepsin L-like cysteine protease genes 夽 Teklu Kuru a,b,e, Dagim Jirata a,b,c, Abebe Genetu a,b,d, Stephen Barr e, Yohannes Mengistu f, Abraham AseVa a, Lashitew Gedamu e,¤ a Armauer Hansen Research Institute, Addis Ababa, Ethiopia Addis Ababa University, Science Faculty, Department of Biology, Addis Ababa, Ethiopia c Debub University, Dilla College of Teachers Education and Health Sciences, Dilla, Ethiopia d Gondar University, Faculty of Medicine and Health Sciences, Department of Microbiology, Gondar, Ethiopia e University of Calgary, Department of Biological Sciences, Calgary, Canada f Addis Ababa University, Faculty of Medicine, Department of Microbiology, Immunology and Parasitology, Addis Ababa, Ethiopia b

Received 12 May 2006; received in revised form 11 September 2006; accepted 12 September 2006 Available online 2 November 2006

Abstract There is limited information on the biology and pathogenesis of Leishmania aethiopica, causative agent of cutaneous leishmaniasis (CL) in Ethiopia. In this study we have identiWed and characterized two cathepsin L-like cysteine protease genes, Laecpa and Laecpb, from L. aethiopica. The predicted amino acid sequence of Laecpa and Laecpb is more than 75% identical with homologous cathepsin Llike cysteine protease genes of other Leishmania species and less than 50% identical with human cathepsin L. Laecpa is expressed predominantly in the stationary, and to a lower level, during the amastigote stage while Laecpb is speciWcally expressed in the stationary stage of L. aethiopica development. Phylogenetic analysis showed that the two genes are grouped into separate clades which are the result of gene duplication. The isolation of these genes will be useful in developing Leishmania species speciWc diagnostics for molecular epidemiological studies and serves as a Wrst step to study the role of cysteine proteases in L. aethiopica pathogenesis. © 2006 Elsevier Inc. All rights reserved. Index Descriptors and Abbreviations: Leishmania aethiopica; Cysteine Proteases; Cathepsin L; CL, Cutaneous leishmaniasis

1. Introduction Leishmaniasis is a disease caused by Xagellated protozoan parasites of the genus Leishmania, which belong to the order kinetoplastida and family trypanosomatidae. Leishmaniasis is prevalent in 88 countries of which 72 are developing countries (Desjeux, 1996; WHO, 1998). Both visceral and cutaneous forms of leishmaniasis are prevalent in Ethiopia. Visceral leishmaniasis is mainly caused

夽 Nucleotide sequence data reported in this paper are available in the GenBank. The accession numbers are DQ071679 for Laecpa, DQ071678 for Laecpb, DQ071680 for Lmacpa and DQ286773 for Ltrcpb. * Corresponding author. Fax: +403 289 9331. E-mail address: [email protected] (L. Gedamu).

0014-4894/$ - see front matter © 2006 Elsevier Inc. All right reserved. doi:10.1016/j.exppara.2006.09.011

by Leishmania donovani in Ethiopia (Ayele and Ali, 1984; Hailu et al., 1996). All the three forms of cutaneous leishmaniasis (localized, mucocutaneous and diVused) found in Ethiopia are mainly caused by Leishmania aethiopica and occasionally due to Leishmania major and Leishmania tropica (Sarojini et al., 1984). Fast and reliable species-speciWc tools are not available for diagnosis and identiWcation of L. aethiopica. Moreover, cutaneous Leishmaniasis caused by L. aethiopica usually responds poorly to conventional doses of antimonial drugs and relapsing is common after treatment (Chulay et al., 1983). There is no eVective vaccine for any form of leishmaniasis to date. Cysteine proteases are one of the potential diagnostics, drug and vaccine candidates being studied extensively in diVerent pathogenic organisms. They have been reported

284

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290

from bacteria (Morihara, 1974), viruses (Bazan and Fletterick, 1988), fungi (Apodaca and McKerrow, 1989) and protozoan parasites (Omara-Opyene and Gedamu, 1997; Robertson and Coombs, 1994). Parasite cysteine proteases have been implicated in several processes including diVerentiation, nutrition, host cell infection, and evasion of the host immune response (Klemba and Goldberg, 2002; Mottram et al., 2004; Sajid and McKerrow, 2002). Cathepsin Llike cysteine proteases (CPA and CPB) have been shown to be necessary for the survival of Leishmania mexicana within macrophages in vitro (Denise et al., 2003). Knockout studies in L. mexicana have also shown that cathepsin L-like cysteine proteases act as modulators of host immune responses (Alexander et al., 1998; Buxbaum et al., 2003). Knockout and antisense mRNA inhibition studies of Leishmania chagasi cpa (LdcCys2) indicated that cysteine proteases help in the infection and survival of amastigotes within macrophages (Mundodi et al., 2005). Furthermore, the fact that cathepsin L-like cysteine proteases from diVerent Leishmania species exhibit PCR-RFLP suggests their potential for the development of speciWc molecular diagnostics (Tintaya et al., 2004). Leishmania CPA cysteine proteases are encoded by a single gene and characterized by having short C-terminal extension of only 10 amino acids. The expression of CPA is constitutive in L. mexicana while it is strictly amastigote speciWc in L. chagasi (Mottram et al., 1992; Mundodi et al., 2005). Leishmania CPB is the major cathepsin L-like cysteine protease having long C-terminal extensions and encoded by a multiple copy of 5 in L. chagasi, 6 in L. dononvani (Mundodi et al., 2002), and 19 in L. mexicana (Souza et al., 1992). L. donovani and L. chagasi CPB expression is mainly promastigote stage while L. mexicana CPB expression is amastigote stage. In the present study, we have identiWed and studied the expression and evolutionary classiWcation of two distinct cathepsin L-like cysteine protease genes, Laecpa and Laecpb from L. aethiopica. This study will be useful in developing species speciWc molecular diagnostics and serves as a Wrst step to study the role of cysteine proteases in L. aethiopica pathogenesis. 2. Material and methods 2.1. Cell culture Leishmania aethiopica 1093/02 isolate, typed by isoenzyme electrophoresis (Genetu et al., 2006), was cultured at 26 °C in complete RPMI medium (which consists of RPMI-1640 medium (Sigma) supplemented with 10% fetal bovine serum (Sigma), 2 mM glutamine (Flow Laboratories), 100 U/ml penicillin (Gibco- BRL) and 100 g/ ml streptomycin (Gibco-BRL)). The Human monocyte cell line THP1 (ATCC), was used to generate the amastigote stage of L. aethiopica. THP1 cells were cultured in complete RPMI medium at 37 °C in the presence of 5% CO2.

2.2. Infection of THP1 cells Infection of THP1 cells was carried out as previously described (Mohamed et al., 1992). BrieXy, THP1 cells were washed two times with RPMI-1640 at 1600 rpm in Allegra6R™ centrifuge (Beckman Coulter) for 10 min. The cells were resuspended at a concentration of 2 £ 105 viable cells per ml with complete RPMI medium. Viability was determined using trypan blue. Retinoic acid (Sigma) was added to a Wnal concentration of 1 £ 10¡6 M to diVerentiate the cells. The retinoic acid treated cells were incubated at 37 °C in 5% CO2 for 5 days. The diVerentiated THP1 cells were washed three times at 1600 rpm in Allegra6R™ centrifuge (Beckman Coulter) for 10 min with RPMI-1640 supplemented with 100 U/ml penicillin and 100 g/ml streptomycin. Cells were then resuspended in complete RPMI medium to a Wnal concentration of 2 £ 105 viable cells per ml and incubated for 30 min at 37 °C in 5% CO2. DiVerentiation and viability of THP1 cells were checked using Wright stain and trypan blue exclusion respectively. Stationary phase promastigote L. aethiopica were pelleted at 3000 rpm for 20 min and resuspended in complete RPMI medium. The diVerentiated THP1 cells were incubated for 16 h at 37 °C in 5% CO2 with live stationary L. aethiopica parasites at a parasite to cell ratio of 20:1. Free parasites were removed by washing three times with RPMI at 600 rpm and 4 °C for 10 min. Infection was monitored by cytospin preparation and Wright stain. Infected cells were cultured for 3 days and total RNA was extracted for RTPCR analysis. 2.3. DNA and RNA extraction Genomic DNA was isolated from early stationary phase parasite as previously described (Omara-Opyene and Gedamu, 1997). BrieXy, about 1010 promastigotes were centrifuged at 3000 rpm in Allegra6R™ centrifuge (Beckman Coulter) for 20 min. The pellet was suspended in 1 ml lysis buVer (10 mM Tris–HCl (pH 8.3), 50 mM EDTA (pH 8.0), 1% SDS) and incubated with 1 mg of RNAse A (Sigma) at 37 °C for 1 h. Proteinase K (Roche Applied Bioscience) was then added to a Wnal concentration of 100 g/ml and incubated over night at 42 °C. Equal volumes of Phenol/chloroform/isoamylalcohol (25:24:1; Sigma) was added and centrifuged at 12,000g in a microcentrifuge (Eppendorf). The aqueous phase was transferred to a clean Eppendorf tube. The DNA was precipitated from the aqueous phase with isopropanol for 30 min at ¡20 °C, centrifuged at 12,000g at room temperature and the supernatant was discarded. The pellet was washed with 75% ethanol and centrifuged at 12,000g at room temperature and the supernatant discarded. The DNA pellet was air dried at 37 °C and suspended in 20 l sterile distilled water. Total RNA was extracted from logarithmic, stationary and amastigote stages (infected THP1 cells) of L. aethiopica, and from uninfected THP1 cells using Trizol reagent as recommended by the manufacturer (Gibco-BRL).

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290

285

2.4. PCR ampliWcation of cysteine protease genes

2.6. RT-PCR analysis

Primers Xanking start and stop codons were used to amplify the open reading frames of cysteine proteases from L. aethiopica. The Primers were designed based on cpa (LdcCys2; GenBank Accession No. AF004593) and cpb of L. chagasi (LdcCys1; GenBank Accession No. AF004592) to identify Laecpa and Laecpb respectively. cpaATG2: 5⬘ GATCGGATCCGCGATAGTGGTAAC TATCC 3⬘ (forward primer) cpaTAG2: 5⬘ GATCGGATCCCTAGGCCGCTGTC GTCGGCA 3⬘ (reverse primer) cpbATG: 5⬘ GGCGCCGGATCCATGGCGACGTCG AGG 3⬘ (forward primer) cpbTAG: 5⬘ GCTCCAGGATCCCGTGTACTGGCA GGTGTTC 3⬘ (reverse primer) A 25 l total reaction mixture was used for PCR ampliWcation using ready to go PCR beads (Amersham–Pharmacia Biotech), 100 ng of genomic DNA and 10 pmol of each primer. The PCR condition was 35 cycles of 94 °C denaturation for 30 s, 60 °C (for Laecpa) and 64 °C (for Laecpb) annealing for 30 s, and 72 °C extension for 1 min using a Hybaid thermocycler (Hybaid). DNA sequences were determined by sequencing both strands of DNA at the UCDNA facility, University of Calgary, Canada.

cDNA was synthesized using the Omniscript protocol as recommended by the manufacturer (Qiagen). PCR ampliWcation was done using 1 g of the cDNA template and 10 pmol of each forward and reverse primer in a 25 l total volume. The same PCR conditions described above for the identiWcation of the genes were used to amplify the cDNA. The PCR condition for the ampliWcation of Leishmania alpha tubulin gene was 35 cycles of 94 °C denaturation for 30 s, 64 °C annealing for 30 s, and 72 °C extension for 1 min. The RT-PCR product was analyzed on a 1% agarose gel. 3. Results and discussion Leishmania aethiopica is the major causative agent of CL in Ethiopia. Little is known about the biology and pathogenesis of L. aethiopica at the molecular level. We have identiWed and characterized two distinct cysteine protease genes, Laecpa and Laecpb, from L. aethiopica. Sequence analysis and comparison indicated that Laecpa and Laecpb code for cysteine proteases that share similar characteristics with cathepsin L-like cysteine proteases. 3.1. IdentiWcation of L. aethiopica CP genes

2.5. Sequence analysis and construction of phylogenetic tree Signal peptides were predicted using Signal P server http://www.cbs.dtu.dk/services/SignalP/(Nielsen et al., 1997) and Pro, mature, and CTE regions were determined by sequence comparison with homologous cysteine proteases. To study the phylogenetic relationship of L. aethiopica cathepsin L-like cysteine proteases, careful sampling of LaeCPA and LaeCPB homologues was done for Leishmania parasites and Trypanosoma cruzi. Homologous sequences were identiWed using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/blast). Each of the BLAST identiWed sequences were then blasted back to nr database and only those that hit cathepsin L-like cysteine proteases were used for analysis. Alignment of the identiWed sequences was done using the Clustal X program (Thompson et al., 1997). The Clustal output was then edited and only regions of unambiguously aligned sequences were retained for Wnal analysis. This resulted in a Wnal alignment of 37 taxa and 233 sites corresponding to the conserved mature region of cysteine proteases. Then, Maximum Likelihood (ML) distance analyses were performed using Tree-Puzzle 5.2 (Schmidt et al., 2002) to calculate ML distance matrices in coordination with Puzzleboot (A. Roger and M. Holder; http://members.tripod.de/korbi/puzzle/). All bootstrap support values are based on 100 replicates. Bayesian analysis was performed using Mr. Bayes 3.0 analysis (Ronquist and Huelsenbeck, 2003) ran for 500,000 generations with-with the burn in value estimated graphically by removing all trees prior to the plateau.

In an attempt to isolate cysteine protease genes from L. aethiopica, two primers were designed containing nucleotides Xanking the start and stop codons of cpa (LdcCys2) and cpb (LdcCys1) of L. chagasi (see Materials and methods section). Two separate PCR’s were done using L. aethiopica genomic DNA. PCR, using cpaATG2 and cpaTAG2 primers, yielded a PCR product of 1062 bp in length (named Laecpa). The second PCR reaction, using cpbATG and cpbTAG primers, yielded a PCR product of 1332 bp in length (named Laecpb). 3.2. Sequence analysis of L. aethiopica CP genes Sequence analysis of Laecpa and Laecpb revealed open reading frames of 354 amino acids and 444 amino acids respectively. Amino acid residues important in cysteine protease activity such as the catalytic residues cysteine and histidine, glutamine, which helps form oxyanion hole, and asparagine, which orientates the imidazole ring of histidine, are conserved in LaeCPA and LaeCPB (Fig. 1). Amino acid residues surrounding cysteine, histidine and asparagine are also conserved (Fig. 1). Comparison of the amino acid sequences of the entire coding region of Laecpa and Laecpb showed signiWcant divergence with only 34.6% similarity while comparison with their respective homologues in other Leishmania species shows sequence identity of more than 75% (Table 1). However, both Laecpa and Laecpb showed coding predicted amino acid sequence similarity of less than 50% with Human Cathepsin L cysteine protease.

286

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290

Fig. 1. Multiple sequence alignment of LaeCPA and LaeCPB deduced amino acid sequences with L. chagasi homologues. The putative signal peptides are underlined. The predicted pro cleavage sites are indicated by shaded arrow (for LaeCPA) and Wlled arrow (for LaeCPB). R1, traYcking domain; R2, conserved region surrounding cysteine catalytic residue and glutamine forming oxyanion hole indicated by line arrow; R3, conserved residues Xanking histidine catalytic residue indicated by arrow; R4, conserved residues Xanking asparagine indicated by arrow; R5, S2 subsite with the critical tyrosine residue indicated by arrow.

Table 1 Predicted amino acid sequence identity of L. aethiopica cysteine protease genes

LaeCpb coding LaeCpb mature LaeCpa coding LaeCpa mature

L. tropica

L. major

LtrCpb

Cathepsin L CPA

L. major

L. donovani L. donovani L. infantum L. infantum L. mexicana LdCys1

LdCys2

LinfCys1

LinfCpa

L. mexicana Homo sapiens

LmexCPB2.8 LmexCPA

Cathepsin L

DQ286773 AAB48120

CAJ07238 AAL09443

AAL09448

CAF32698

CAD12392 CAA90236

CAA44094

AAH12612

91.7 88.6 34.2 —

35.6 — 83.1 83.7

34.6 — 83.7 82.2

85.6 80.5 33.3 —

34.7 — 83.4 81.3

35 — 77.7 76.1

24 — 30.2 —

79.3 85.9 34.9 —

86.7 82.3 34.7 —

81.5 78.6 34.5 —

The identity based on the coding and mature region predicted amino acid sequence is given in percentage. The identity for the mature is presented only for the homologous genes of the respective L. aethiopica sequences.

3.2.1. Pre-, Pro-, mature and CTE domains of L. aethiopica cysteine proteases Cathepsin L-like cysteine proteases are synthesized as prepropolypeptides with an N-terminal signal peptide, a proregion, a central catalytic domain, and a C-terminal extension (CTE). Signal P server was used to predict cysteine protease signal peptides and their probable cleavage sites by weight matrix analysis (Nielson et al., 1997). The signal peptide cleavage site was predicted to be between Ser22 and Ala23 for LaeCPA and between Ala27 and Ile28 for LaeCPB (Fig. 1). Using sequence comparison with cathepsin L cysteine proteases, the pro-region cleavage site was found to be between Ser127 and Gly128 for LaeCPA and between Ser124 and Ala125 for LaeCPB (Fig. 1). The

Val-Gly/Gly-Pro cleavage site between the mature and the C-terminal extension regions found in Cruzain (Eakin et al., 1992) was not found in LaeCPA and LaeCPB. However, residues 348-355 representing areas of Xexible polypeptide indicate that LaeCPB could readily be proteolytically cleaved in this area (Traub-Cseko et al., 1993). LaeCPB consists of 100 amino acid C-terminal extension which is a characteristic of the most abundant group of trypanosomatid cysteine proteases. However, unlike LaeCPB, LaeCPA possess very short CTE region. The CTE region of LaeCPB is 90 amino acids longer than LaeCPA. Like Trypanosomatid CTEs the CTE of LaeCPB is cysteine-glycine rich, cysteine and glycine comprising approximately 20% of the total amino acids of LaeCPB.

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290

3.2.2. TraYcking and substrate speciWcity domains TraYcking of Leishmania cysteine proteases to lysosomes is directed by sequence elements in the pro-domain (Brooks et al., 2000; Huete-Perez et al., 1999). Alignment and sequence analysis with cathepsin L-like cysteine proteases indicate that the predicted traYcking motifs “F44KKRHGKAF52” and ‘F41KRTYRRPY49’ are found conserved in the pro-domain of LaeCPA and LaeCPB respectively (Fig. 1). The cathepsins also have amino acid residues that contribute to substrate speciWcity known as the S2 subsite (Sajid and McKerrow, 2002). The S2 subsites ‘N327QCMLKRYT335’ and‘L330LTEYPVSA338’ are conserved in LaeCPA and LaeCPB respectively and have the critical tyrosine residue, which is conserved in cathepsin L-like cysteine proteases (Fig. 1). The strong identity with cathepsin L-like cysteine proteases and the fact that they share common domains with cathepsin L-like cysteine proteases suggest Laecpa and Laecpb code for cathepsin L-like cysteine protease enzymes. Cathepsin L-like cysteine proteases have been reported to be important for the survival of Leishmania parasites inside macrophages and have been identiWed as promising drug targets and vaccine candidates (McKerrow et al., 1999). The strong identity of L. aethiopica cysteine protease genes (>75%) with cysteine protease genes of other Leishmania species and the lower identity (<50%) with the human cathepsin L cysteine proteases (Table 1) indicate the possibility of developing speciWc common vaccine and/or drug against Leishmania parasites. Comparison of the cysteine protease sequences of L. aethiopica and other Leishmania parasites showed nucleotide diVerences which could be utilized for the development of species speciWc molecular diagnostics. Within the coding region of the cysteine protease genes, the diVerences are observed much more at the CTE domain than the mature domain. Therefore, the CTE domain could provide opportunity for speciWc PCR-based diagnostics. In this regard, we have recently developed speciWc primers from this region of Laecpb to diagnose diVerent species of Leishmania (Gadissa, E., et al., in preparation). Laecpa and Laecpb similarity with homologous genes seems to be correlated to their geographical classiWcation rather than clinical manifestations. They show the highest similarity with their old world Leishmania homologues especially when the internal mature region is compared (Table 1). The mature region of Leishmania cysteine proteases represents the active part of the enzyme as they are produced as proenzymes. 3.3. Phylogenetic analysis To determine the phylogenetic classiWcation of L. aethiopica cathepsin L-like cysteine protease genes, we conducted phylogenetic analysis of 26 cathepsin L-like cysteine protease genes from diverse Leishmania species using all 11 cathepsin L genes found in the completed Trypanosoma cruzi genome as an out group. This was done by bayesian

287

and maximum likelihood corrected distance methods. The Trypanosoma cruzi genes formed a single clade and based on organismal relationships, were used to root Leishmania sequences. Leishmania cathepsin L-like cysteine proteases are divided into two clades (clade I and clade II) supported strongly by bootstrap and bayesian posterior probability (Fig. 2). Clade I contains LaeCPB and its homologues and clade II contains LaeCPA and its homologues. In the case of both clades L. guyanensis formed the most basal branch. The phylogenetic analysis suggests that a single cathepsin L-like cysteine protease gene was present in Leishmania– Trypanosoma common ancestor. This gene underwent duplication in the ancestral Leishmania after the separation of the Trypanosoma and Leishmania lineages. The duplication of the genes was then followed by speciation of diVerent Leishmania species having distinct CPA and CPB cathepsin L-like cysteine protease homologues. It is also possible to infer L. guyanensis as the Wrst evolving species of those analyzed after cysteine protease gene duplication. Our phylogenetic analysis correlates with previous reports (Davila and Momen, 2000; Luyo-Acero et al., 2004). One implication of this result for Leishmania phylogeny would be that a Leishmania species found to possess a pre duplication homologue of cathepsin L would be an excellent candidate as a basal Leishmania lineage. Furthermore, there is a good resolution among old world cutaneous, new world cutaneous and visceral causing species. Therefore, cathepsin L-like cysteine proteases of Leishmania could be useful phylogenetic markers. 3.4. Expression of cysteine protease genes Leishmania cysteine proteases are expressed diVerentially at diVerent stages of the parasite development (Heussler and Dobbelaere, 1994; Mottram et al., 1992; Mundodi et al., 2002, 2005; Souza et al., 1992; TraubCseko et al., 1993). RT-PCR using speciWc primers was done to analyze the expression levels of Laecpa and Laecpb in the diVerent stages of L. aethiopica (Fig. 3). The results of the RT-PCR showed that Laecpa is predominantly expressed in the stationary stage and at a lower level in the amastigote stage while Laecpb predominantly expressed in the stationary stage of the parasite development. There was no ampliWcation from non infected macrophages as the primers were speciWc to Leishmania and Leishmania alpha tubulin gene was used as a loading control (Fig. 3). The diVerential expression of Laecpa in the stationary and amastigote stage of the parasite suggest the role they may play during infection of the mammalian host and survival of the parasite inside host macrophages. LdcCys2, CPA of L. chagasi has been shown to be necessary for macrophage infection and for survival of L. chagasi amastigotes inside the macrophage cells (Mundodi et al., 2005). DiVerential expression of Laecpb in the stationary stage of L. aethiopica correlates with cpb1 and cpb2 of L. mexicana, which are predominantly expressed in metacyclic stages (Mottram et al., 1997). The diVerential

288

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290 L. major CathepsinL-A; CAJ02287 100/1.00

L. major cathepsinL-B; AAB48120 L. major cathepsinL-C; CAJ02282 L. aethiopica LaeCPB; DQ071678

86/0.99

79/0.88

L. tropica LtrCPB; DQ286773 L. donovani chagasi LdcCys1; AAC38832 L. infantum LinfCys1-A; CAD12393 L. infantum LinfCys1-B; CAF32698 L. donovani LdCys1; AAL09443

99/0.97

L. mexicana CPB2.8; CAA90236 76/1.00 74/0.93

100/1.00

100/1.00

Clade I

100/1.00

L. pifanoi LpCys2; A48566 L. mexicana CPB1; CAA90237

L. mexicana CPB-A; CAA78443 L. mexicana CPB-B; CAA71085

L. guyanensis LguyCys1-B; CAD54748

*

L. major LmaCPA-A; CAJ07238 L. major LmaCPA-B; CAB43538 L. major LmaCPA-C; DQ 071680 97/1.00

100/1.00

L. infantum LinfCPA; CAD12392 L. donovani LdCys2; AAL09448

95/0.96

L. aethiopica LaeCPA; DQ071679

Clade II

L. donovani chagasi LdcCys2; AAC38833 96/1.00

L. mexicana LmexCPA; CAA44094 100/1.00

100/1.00

L. pifanoi LpifCys1; P35591 L. amazonensis LamaCys1; AAP21894

L. guyanensis LguyCys1-A; CAD54747

*

T. cruzi Cruzipain-B; AAG35357 T. cruzi Cysteine protease putative-B; EAN96727 T. cruzi Cysteine protease; AAM33131 T. cruzi Cysteine protease putative-A; XP_818578

T. cruzi Cruzain; 1AIM T. cruzi Cysteine protease putative-D; EAN84100 T. cruzi Cysteine protease putative-C; EAN98323

Outgroup

T. cruzi Cysteine protease putative-F; EAN96728

T. cruzi Cruzipain-C; AAB41119 100 /1.00

T. cruzi Cruzipain-A; AAF75547 T. cruzi Cysteine protease putative-E; EAN81598 0.1

Fig. 2. Phylogenetic analysis. Maximum parsimony and Bayesian phylogenetic analysis based on amino acid sequence of cysteine proteases. The boot strap values for the maximum likely hood ( >50) and bayesian probability ( >0.8) are indicated above the branches (as boot strap/Bayesian). The value for branches which are not supported either by >50 boot strap value or >0.80 probability were not shown. The stars indicate the deepest branching taxa. The accession numbers of the taxa are also given.

L1 1.332 kb 1.062 kb 1.3 kb

L2

L3

L4 Laecpb Laecpa Alpha tubulin

Fig. 3. L. aethiopica cysteine proteases expression. Ethidium bromide stained Laecpa, Laecpb and alpha tubulin control RT-PCR products. L1, log phase promastigotes; L2, stationary phase promastigotes; L3, infected THP1 cells; L4, uninfected THP1 cells.

expression of Laecpb in the stationary stage of the parasite suggests that LaeCPB may play a role during the infectious stage of the parasite (Robertson and Coombs, 1992). Overall, our study on the identiWcation and characterization of L. aethiopica cysteine protease genes could provide an opportunity for the development of speciWc molecular diagnostics for epidemiological studies and serves as a Wrst step to study the role of cysteine proteases in L. aethiopica pathogenesis.

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290

Acknowledgments This study was carried out at Armauer Hansen Research Institute (AHRI). It has received Wnancial support from AHRI core budget (NORAD, SIDA and Ethiopian Government) and a grant provided to L. Gedamu (University of Calgary, Canada) by the Natural Sciences and Engineering Council (NSERC) of Canada and the Canadian Institute of Health Research (CIHR). We thank Joel Dacks for phylogenetics analysis training to one of the authors (T.K.), Genet Amare, Girma Birhanu and the ALERT Dermatology Clinic StaV for handling the Leishmania patients and specimen. We thank Howard Engers for his inputs on the study and reading the manuscript. References Alexander, J., Coombs, G.H., Mottram, J.C., 1998. Leishmania mexicana cysteine proteinase-deWcient mutants have attenuated virulence for mice and potentiate a Th1 response. The Journal of Immunology 161, 6794–6801. Apodaca, G., McKerrow, J.H., 1989. PuriWcation and characterization of a 27,000-Mr extracellular proteinase from Trichophyton rubrum. Infection and Immunity 57, 3072–3080. Ayele, T., Ali, A., 1984. The distribution of visceral leishmaniasis in Ethiopia. The American Journal of Tropical Medicine and Hygiene 33, 548–552. Bazan, J.F., Fletterick, R.J., 1988. Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proceedings of the National Academy of Sciences USA 85, 7872–7876. Brooks, D.R., Tetley, L., Coombs, G.H., Mottram, J.C., 2000. Processing and traYcking of cysteine proteases in Leishmania mexicana. Journal of Cell Science 113 (Pt 22), 4035–4041. Buxbaum, L.U., Denise, H., Coombs, G.H., Alexander, J., Mottram, J.C., Scott, P., 2003. Cysteine protease B of Leishmania mexicana inhibits host Th1 responses and protective immunity. The Journal of Immunology 171, 3711–3717. Chulay, J.D., Anzeze, E.M., Koech, D.K., Bryceson, A.D., 1983. High-dose sodium stibogluconate treatment of cutaneous leishmaniasis in Kenya. Transactions of the Royal Society of Tropical Medicine and Hygiene 77, 717–721. Davila, A.M., Momen, H., 2000. Internal-transcribed-spacer (ITS) sequences used to explore phylogenetic relationships within Leishmania. Annals of Tropical Medicine and Parasitology 94, 651–654. Denise, H., McNeil, K., Brooks, D.R., Alexander, J., Coombs, G.H., Mottram, J.C., 2003. Expression of multiple CPB genes encoding cysteine proteases is required for Leishmania mexicana virulence in vivo. Infection and Immunity 71, 3190–3195. Desjeux, P., 1996. Leishmaniasis. Public health aspects and control. Clinics in Dermatology 14, 417–423. Eakin, A.E., Mills, A.A., Harth, G., McKerrow, J.H., Craik, C.S., 1992. The sequence, organization, and expression of the major cysteine protease (cruzain) from Trypanosoma cruzi. The Journal of Biological Chemistry 267, 7411–7420. Genetu, A., Gadisa, E., AseVa, A., Barr, S., Lakew, M., Jirata, D., Kuru, T., Kidane, D., Hunegnaw, M., Gedamu, L., 2006. Leishmania aethiopica Strain identiWcation and characterization of superoxide dismutase-B genes. Experimental Parasitology 113, 221–226. Hailu, A., Berhe, N., Yeneneh, H., 1996. Visceral leishmaniasis in Gambela, western Ethiopia. Ethiopian Medical Journal 34, 33–42. Heussler, V.T., Dobbelaere, D.A., 1994. Cloning of a protease gene family of Fasciola hepatica by the polymerase chain reaction. Molecular Biochemical Parasitology 64, 11–23. Huete-Perez, J.A., Engel, J.C., Brinen, L.S., Mottram, J.C., McKerrow, J.H., 1999. Protease traYcking in two primitive eukaryotes is mediated

289

by a prodomain protein motif. The Journal of Biological Chemistry 274, 16249–16256. Klemba, M., Goldberg, D.E., 2002. Biological roles of proteases in parasitic protozoa. Annual Review of Biochemistry 71, 275–305. Luyo-Acero, G.E., Uezato, H., Oshiro, M., Takei, K., Kariya, K., Katakura, K., Gomez-Landires, E., Hashiguchi, Y., Nonaka, S., 2004. Sequence variation of the cytochrome b gene of various human infecting members of the genus Leishmania and their phylogeny. Parasitology 128, 483–491. McKerrow, J.H., Engel, J.C., CaVrey, C.R., 1999. Cysteine protease inhibitors as chemotherapy for parasitic infections. Bioorganic and Medicinal Chemistry 7, 639–644. Mohamed, A.M., Taye, T., AkuVo, H.O., 1992. Mechanisms of resistance to Leishmania aethiopica. I. Interferon-gamma in combination with a cytokine (not tumor necrosis factor-alpha) is required, but cannot act alone in the inhibition of intracellular forms of L. aethiopica in THP1 cells. Europian Journal of Immunology 22, 2331–2337. Morihara, K., 1974. Comparative speciWcity of microbial proteinases. Advances in Enzymology and Related areas of Molecular Biology 41, 179–243. Mottram, J.C., Robertson, C.D., Coombs, G.H., Barry, J.D., 1992. A developmentally regulated cysteine proteinase gene of Leishmania mexicana. Molecular Microbiology 6, 1925–1932. Mottram, J.C., Frame, M.J., Brooks, D.R., Tetley, L., Hutchison, J.E., Souza, A.E., Coombs, G.H., 1997. The multiple cpb cysteine proteinase genes of Leishmania mexicana encode isoenzymes that diVer in their stage regulation and substrate preferences. The Journal of Biological Chemistry 272, 14285–14293. Mottram, J.C., Coombs, G.H., Alexander, J., 2004. Cysteine peptidases as virulence factors of Leishmania. Current Opinion in Microbiology 7, 375–381. Mundodi, V., Somanna, A., Farrell, P.J., Gedamu, L., 2002. Genomic organization and functional expression of diVerentially regulated cysteine protease genes of Leishmania donovani complex. Gene 282, 257–265. Mundodi, V., Kucknoor, A.S., Gedamu, L., 2005. Role of Leishmania (Leishmania) chagasi amastigote cysteine protease in intracellular parasite survival: studies by gene disruption and antisense mRNA inhibition. BMC Molecular Biology 6, 3. Nielsen, H., Engelbrecht, J., Brunak, S., von Heijne, G., 1997. IdentiWcation of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10, 1–6. Omara-Opyene, A.L., Gedamu, L., 1997. Molecular cloning, characterization and overexpression of two distinct cysteine protease cDNAs from Leishmania donovani chagasi. Molecular Biochemical Parasitology 90, 247–267. Robertson, C.D., Coombs, G.H., 1992. Stage-speciWc proteinases of Leishmania mexicana mexicana promastigotes. FEMS Microbiology Letters 73, 127–132. Robertson, C.D., Coombs, G.H., 1994. Multiple high activity cysteine proteases of Leishmania mexicana are encoded by the Imcpb gene array. Microbiology 140 (Pt 2), 417–424. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Sajid, M., McKerrow, J.H., 2002. Cysteine proteases of parasitic organisms. Molecular Biochemical Parasitology 120, 1–21. Sarojini, P.A., Humber, D.P., Yemane-Berhan, T., Fekete, E., Belehu, A., Mock, B., WarndorV, J.A., 1984. Cutaneous leishmaniasis cases seen in two years at the All Africa Leprosy and Rehabilitation Training Centre Hospital. Ethiopian Medical Journal 22, 7–11. Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002. TREEPUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18, 502–504. Souza, A.E., Waugh, S., Coombs, G.H., Mottram, J.C., 1992. Characterization of a multi-copy gene for a major stage-speciWc cysteine proteinase of Leishmania mexicana. FEBS Letters 311, 124–127. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: Xexible strategies for

290

T. Kuru et al. / Experimental Parasitology 115 (2007) 283–290

multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882. Tintaya, K.W., Ying, X., Dedet, J.P., Rijal, S., De Bolle, X., Dujardin, J.C., 2004. Antigen genes for molecular epidemiology of leishmaniasis: polymorphism of cysteine proteinase B and surface metalloprotease glycoprotein 63 in the Leishmania donovani complex. The Journal of Infectious Diseases 189, 1035–1043.

Traub-Cseko, Y.M., Duboise, M., Boukai, L.K., McMahon-Pratt, D., 1993. IdentiWcation of two distinct cysteine proteinase genes of Leishmania pifanoi axenic amastigotes using the polymerase chain reaction. Molecular Biochemical Parasitology 57, 101–115. WHO, 1998. Leishmania and HIV in gridlock. WHO/UNAIDS report. Geneva: World Health Organization, 15-25.