Lentiviral vectors for efficient transduction of isolated primary quiescent hepatocytes

Journal of Hepatology 36 (2002) 459–465 www.elsevier.com/locate/jhep

Lentiviral vectors for efficient transduction of isolated primary quiescent hepatocytes Jurgen Seppen*, Martijn Rijnberg, Michel P. Cooreman, Ronald P.J. Oude Elferink Department of Experimental Hepatology, F0-116, Academic Medical Center, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands

Background/Aims: Lentiviral vectors were designed to obtain efficient transduction of primary quiescent hepatocytes. Methods: A hepatitis B virus (HBV) fragment containing enhancers and posttranscriptional regulatory element was used to increase expression levels. The human immunodeficiency virus (HIV) central polypurine tract (PPT) was used to increase transduction of quiescent cells. HBV elements were incorporated downstream and the HIV PPT was incorporated upstream of green fluorescent protein expression cassettes in third generation self inactivating lentiviral vectors. Results: The HBV fragment increased mean fluorescence of transduced HepG2 hepatoma cells 4.3 ^ 1.7-fold and 2.3–6.0-fold in various other cell types. A role of HBV £ protein in the function of the HBV element was excluded. The HBV element increased the number of transducing units per pg of HIV p24 twofold. The unmodified lentiviral vector transduced 5 ^ 1% of cultured quiescent primary rat hepatocytes, HBV elements increased transduction to 54 ^ 13% and increased fluorescence 2.8 ^ 0.6-fold. The PPT increased transduction to 47 ^ 11% and increased fluorescence 2.3 ^ 0.4-fold. The vector with PPT and HBV elements transduced 68 ^ 10% of hepatocytes and increased fluorescence synergistically, 17 ^ 6 fold. Conclusions: This study shows that HBV elements or HIV PPT are required for efficient transduction of primary hepatocytes. q 2002 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. Keywords: Gene therapy; Posttranscriptional regulatory element; Polypurine tract; Liver; Human immunodeficiency virus; Hepatitis B virus

1. Introduction Stable expression of therapeutic proteins in the liver would be beneficial for patients suffering from a wide variety of disorders. Vectors based on adeno-associated virus (AAV) are able to transduce quiescent hepatocytes in vivo and mediate long-term expression [1,2]. Murine retroviruses can transduce hepatocytes stimulated by mitogens such as epidermal-, hepatocyte-, or keratinocyte growth factor [3– 6]. However, this transduction is inefficient and the high cost of growth factors makes it unattractive for human applications. Vectors based on lentiviruses such as human immunodeReceived 22 June 2001; received in revised form 6 November 2001; accepted 2 December 2001 * Corresponding author. Tel.: 131-205665948; fax: 131-205669190. E-mail address: [email protected] (J. Seppen).

ficiency virus (HIV) are, unlike murine retroviral vectors, able to transduce quiescent cells [7–9]. This property makes lentiviral vectors attractive candidates for the development of gene transfer into cell types that are normally not dividing such as hepatocytes. The ability of lentiviral vectors to transduce quiescent hepatocytes in vivo is controversial; an initial report documented efficient transduction in vivo [10] but a more recent study showed that cell cycling of hepatocytes was required for efficient transduction [11]. No published studies on lentiviral transduction of isolated quiescent primary hepatocytes are available. Recent studies show that the central polypurine tract (PPT) and termination sequence from HIV strongly improve vector performance [12,13], especially the transduction of non-dividing cells. We therefore investigated whether inclusion of the HIV PPT increased transduction efficiency of primary quiescent rat hepatocytes.

0168-8278/02/$20.00 q 2002 European Association for the Study of the Liver. Published by Elsevier Science B.V. All rights reserved. PII: S 0168-827 8(01)00308-7

460

J. Seppen et al. / Journal of Hepatology 36 (2002) 459–465

Fig. 1. Schematic representation of the vectors used in this study and the HBV fragment. The left panel depicts the vectors used in this study. PGK, the third generation self inactivating lentiviral vector which was used to construct the improved vectors described in this study. PGK, phosphoglycerate kinase promoter. PT, HIV central polypurine tract. eGFP, enhanced green fluorescent protein. HBV, hepatitis B virus posttranscriptional element and enhancers. LTR, HIV long terminal repeat with deleted U3 region. SD, HIV splice donor. SA, HIV splice acceptor. The right panel shows an enlargement of the HBV fragment incorporated in the lentiviral vectors. The fragment encompasses HBV nucleotides 682–1818, the relative positions of the PRE and enhancers I and II are indicated. The bottom bar gives the positions of the start and stop codons of the HBV open reading frames present on this fragment. HBV-S, HBV surface protein, HBV-P, HBV polymerase, HBV-C, HBV pre-core protein. The AatII restriction site, used to interrupt the HBVx open reading frame in PGKPREdx, and the NsiI restriction site used to construct the minimal element in PGKPREm are indicated. Note that the figure is not to scale.

Human hepatitis B virus (HBV) enhancers I and II are able to increase expression from heterologous promoters in an orientation independent and liver specific fashion [14– 16]. This property has been exploited to construct liver specific promoter elements for gene therapy [17]. The HBV posttranscriptional regulatory element (PRE) is a cis acting element able to increase expression of transgenes when included in the transcribed region of the gene [18,19], probably by stimulating export of unspliced mRNA from the nucleus [20]. We investigated whether the inclusion of HBV PRE plus enhancers I and II in a lentiviral vector was able to specifically increase expression in liver cells. The PRE element contains the start codon and most of the coding region of the HBVx protein (HBVx) [21]. HBVx is essential for viral replication and is implicated in the development of hepatocellular carcinoma associated with HBV infection [21]. Because HBVx can transactivate heterologous promoters and carboxy terminally truncated HBVx mutants retain this transactivation function [21], a role of HBVx in the function of these elements must be excluded. We therefore also investigated whether the interruption of the HBVx reading frame would compromise the function of the HBV element.

2. Materials and methods 2.1. Production of recombinant virus To obtain a fragment from HBV containing the enhancers I, II and the PRE, a 1237 bp HBV fragment was amplified by PCR with the following primers: GACGGAAATTGCACCTGTA, CATGGTGCTGGTGCGCAGA. The fragment was sequenced and cloned as a SacI/SalI fragment containing 1142 bp HBV sequence (HBV subtype AYW accession J02203, bases 682–1818) into the lentiviral vector backbones pRRLpgkgfpsin (PGK) and pRRLcmvgfpsin (CMV) [22]. The lentiviral vectors pRRLpgkgfpsin and pRRLcmvgfpsin contain a phosphoglycerate kinase or cytomegalovirus promoter driving green fluorescent protein (GFP) expression. The HBV fragment was cloned after the GFP open reading frame in the sense and antisense orientation. This yielded four new vectors pRRLpgkgfpsinpresense (PGKPRES), pRRLcmvgfpsinpresense (CMVPRES), pRRLpgkg-

fpsinpreantisense (PGKPREAS) and pRRLcmvgfpsinpreantisense (CMVPREAS), Fig. 1. A 4 bp deletion in the X reading frame (J02203 bases 1416–1420) was introduced in PGKPRES by digesting this plasmid with AatII, removing the protruding ends with T4 DNA polymerase and self ligation. This vector was designated PGKPREdx. The deletion was confirmed by sequencing. To obtain a minimal element, a 385 bp Sma1/Nsi1 fragment was deleted from PGKPRES, the ends blunted and relegated and this vector was designated PGKPREm. Construction of lentiviral vectors containing the PPT was essentially as described [12,13]. A 180 bp fragment of the infectious HIV-1 clone LAI-1 containing the PPT, nucleotides 4302–4482 of GenBank accession # NC_001802, was amplified using the following primers: CAGTATCGATAAGCTTACAAATGGCAGTATTCATCC, CCTTATCGATTCCAAAGTGGATCTCTGCTGTCC. The HIV PPT was cloned in the sense orientation upstream of the PGK promoter, into the PGK and PGKPRES vectors using XhoI and EcoRV, yielding two new vectors PPTPGK and PPTPGKPRE. The third generation self inactivating lentiviral vector system [22,23] was used as described [24]. Briefly, expression vectors for HIV Gag/Pol, HIV Rev, VSVg and the viral transfer vector were cotransfected overnight using calcium phosphate into 293T cells. The medium was changed and virus was collected twice for 24 h, passed through 0.45 mm filters and stored at 2808C. HIV p24 levels were determined by antigen capture ELISA as described [25].

2.2. Cell culture and viral transduction All cell lines except rat hepatocytes, primary murine splenocytes and SupT1 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal calf serum at 378C in a 10% CO2 atmosphere. SupT1 cells were cultured in RPMI with 10% fetal calf serum and murine splenocytes were isolated from Balb/c mice and cultured as described [26]. Cells were seeded in six well plates, or 24 well plates in the case of primary murine splenocytes, at a density of 10 5 cells/well and incubated with virus for 4 h in the presence of 10 mg/ml DEAE dextran the following day. Viral transductions were performed at a multiplicity of infection ,1 to avoid multiple integrations per cell. The cells were harvested 3 days after transduction and fixed in 4% paraformaldehyde. GFP expression was analysed by flow cytometry.

2.3. Cell culture and viral transduction of rat hepatocytes Rats were starved overnight and hepatocytes were isolated according to standard procedures with slight modifications [27]. The cells were seeded and allowed to attach to the substrate for 3–4 h in DMEM with 10% fetal

J. Seppen et al. / Journal of Hepatology 36 (2002) 459–465 calf serum. Hepatocytes were plated at a density of 4 £ 10 4 per cm 2 in six well plates on coverslips coated with rat tail collagen for fluorescence microscopy or at a density of 2 £ 10 4 per cm 2 in Primaria dishes (Becton Dickinson, Lincoln Park, NJ, USA) when cells were used for flow cytometry. The cells were washed and the medium was replaced with hepatozyme SFM (Life Technologies, Breda, the Netherlands) or DMEM without serum. Viral supernatants were added and the cells were incubated overnight for 16 h. The viral transductions were perfomed at multiplicities of infection between 5 and 10. Cellular proliferation was determined as described [24], by incubation with 80 mM 5-bromo-2 0 -deoxyuridine (BrDU) (Sigma, Zwijndrecht, the Netherlands) for 20 h. The cells were fixed in acetone/methanol 1/4 (v/v) and denatured in 2 M HCl for 30 min at room temperature. BrDU incorporation was detected using a monoclonal antibody against BrDU (Sigma, Zwijndrecht, the Netherlands), and a FITC conjugated goat anti-mouse immunoglobulins (Jackson Immunoresearch, Amsterdam, the Netherlands). A polyclonal antibody against the liver specific enzyme rat carbamoylphosphate synthetase 1 (EC 6.3.4.16) (CPS) [28] was used to identify hepatocytes. The cells were fixed in acetone/methanol 1/4 (v/v) and CPS was detected with a rabbit antiserum to CPS and a secondary goat antirabbit antibody conjugated with TRITC (Nordic Immunological Laboratories, Tilburg, the Netherlands).

2.4. Northern blotting HeLa cells were transduced with CMV, CMVPRES and CMVPREAS vectors and cultured for 1 week. RNA was isolated using Trizol (GIBCOBRL, Breda, the Netherlands) according to instructions provided by the manufacturer. Northern blots were performed as described previously [29]. A 218 bp fragment, positions 801–1018 of GenBank accession # M33197, of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard and lentivirus mediated gene expression was detected with a 763 bp GFP fragment obtained by digesting CMVGFP with EcoRI and BamHI. Blots were quantified using a phosphoimager and analysed using imagequant software (Molecular Dynamics, Krefeld, Germany), autoradiograms were made on biomaxMR film (Kodak, Rochester, NY, USA). To correct for uneven RNA loading, the GFP signal was normalised to the signal of the housekeeping gene GAPDH. The transduction percentage of the cells used for RNA analysis was measured by flow cytometry. This enabled us to correct the GFP RNA signal for differences in transduction efficiency between the different populations.

3. Results 3.1. Construction of lentiviral vectors Diagrams of the different lentiviral transfer vectors described in this study are shown in Fig. 1. Several studies have mapped the PRE and enhancer elements in the HBV genome, largely with identical results but with some differences in the 5 0 and 3 0 ends of the different subelements. For the initial studies, we therefore used a large HBV fragment, positions 682–1818 of HBV. Fig. 1 shows a schematic drawing of the positions of the HBV enhancers and PRE, in the fragment used in our study. Transduction of HeLa cells with lentiviral vectors could be inhibited completely when the reverse transcriptase inhibitor Zidovudine was added during and after transduction, confirming viral gene transfer and not pseudotransduction by protein or plasmid DNA (not shown).

461

3.2. Transduction of cells with lentiviral vectors containing HBV elements Titers obtained with lentiviral vectors containing the HBV element in the sense orientation were consistently higher than titers of lentiviral vectors without the HBV element. However, the concentrations of HIV p24 in PGK or PGKPRES preparations were the same. We determined the number of transducing units (TU) per pg of HIV p24 in three different virus batches. There was a significant difference ðP , 0:01Þ in the ratio of transducing units (TU) per pg of p24 between PGK (0.93 ^ 0.3 TU/pg p24) and PGKPRES (2.0 ^ 0.3 TU/pg p24). We therefore analysed expression levels in individual cells by flow cytometry, to exclude variability due to differences in transduction efficiency. Several cell lines were transduced with lentiviral vectors, at a multiplicity of infection (MOI) lower than one to avoid multiple integrations per cell. Liver specificity of the HBV enhancers has been documented extensively in the human hepatoma line HepG2 [14,16,17,30]. We therefore initially used HepG2 cells to determine liver specificity of the HBV element. The data from all experiments are tabulated in Tables 1 and 2. To be able to compare the results from multiple experiments, we normalised the fluorescence signal to the signal from cells transduced with vectors without the HBV element. In HepG2 cells, the increase was 4.3 ^ 1-fold ðn ¼ 7Þ in various cell types of non-hepatic origin which ranged from 2.3 to 6.0 Table 1. These data indicate that the HBV element is not liver specific. When the CMV promoter was driving GFP expression, an 1.7–3.4-fold increase in fluorescence was observed (Table 2). The HBV element increased expression in primary and transformed cells from hematopoietic (primary murine splenocytes, SupT1), fibroblastic (primary human fibroblasts, 293T), epithelial (CaCo-2, HeLa) and hepatic (HepG2) origin. The inclusion of the HBV element in the reverse orientation consistently decreased expression levels. We deleted 385 bp from the 5 0 end of the HBV element obtaining a minimal HBV fragment of 757 bp (J02203 bases 1067–1818) containing the enhancers and PRE. The lentiviral vector containing the minimal PRE element was designated PGKPREm. As can be seen from Table 1, the minimal HBV element functions as efficiently as the full length fragment and the difference in increase of expression between PGKPRES and PGKPREm was not significant. 3.3. Role of HBVx protein The HBV element contains the promoter, start codon and 95% of the HBVx protein (HBVx) coding frame and lacking 5% at the C terminus. We made a frameshift of 40 bp after the HBVx start codon and the lentiviral vector with this HBVx frameshift was designated PGKPREdx. Interrupting the HBVx reading frame reduced the efficiency of the HBV

462

J. Seppen et al. / Journal of Hepatology 36 (2002) 459–465

Table 1 The effect of the HBV element on PGK promoter driven GFP expression a Cell type

PGK

PGKPRES

PGKPREAS

PGKPREm

PGKPREdx

PKGPREdxm

HeLa HepG2 Human fibroblasts 293T CaCo-2 Murine splenocytes SupT1

1 1 1 1 1 1 1

5.8 ^ 2 ðn ¼ 7Þ 4.3 ^ 1 ðn ¼ 7Þ 6.0 ^ 0.9 ðn ¼ 4Þ 5.9 ^ 1 ðn ¼ 3Þ 2.9 ðn ¼ 2Þ 2.3 ðn ¼ 2Þ 2.3

0.33 ^ 0.07 ðn ¼ 4Þ 0.36 ^ 0.1 ðn ¼ 4Þ 0.48 ^ 0.3 ðn ¼ 3Þ 0.62 ^ 0.02 ðn ¼ 3Þ 0.6 ðn ¼ 2Þ 0.73 ðn ¼ 2Þ 0.6

4.4 ^ 1 ðn ¼ 3Þ 4.6 ^ .2 ðn ¼ 3Þ 5.5 ^ 1 ðn ¼ 3Þ 4.1 ðn ¼ 2Þ 2.7

4.2 ^ 1 ðn ¼ 5Þ 3.1 ^ .6 ðn ¼ 5Þ 5.6 ^ 0.8 ðn ¼ 3Þ 3.9 ðn ¼ 2Þ 2.4

2.9 ^ 1 ðn ¼ 5Þ 2.9 ^ .4 ðn ¼ 5Þ 3.5 ^ 0.9 ðn ¼ 3Þ 2.8 ðn ¼ 2Þ 2.2

a The effect of the HBV element and mutant HBV elements on GFP expression in different cells is depicted. Cells were transduced and analysed for GFP expression as described. Mean fluorescence intensities are normalised to the intensity in cells transduced with a lentiviral vector without the HBV element.

element slightly and only significantly in HepG2 cells, P ¼ 0:018 (Table 1). The expression increase mediated by the HBV element can therefore not be explained by transactivation of the PGK promoter through expression of a truncated HBVx. The HBVx reading frame deletion was also introduced in the minimal HBV element and was designated PGKPREdxm. The double mutant HBV element was significantly less effective than the intact element in all cell lines tested, P , 0:05, but still mediated a 2.2–3.9-fold increase in GFP fluorescence (Table 1).

3.4. RNA analysis of lentivirally transduced cells Fig. 2 shows an autoradiogram of a Northern blot of mRNA from HeLa cells transduced with CMV, CMVPRES and CMVPREAS, hybridised with a GFP and a GAPDH probe. The cells were transduced at low multiplicity of infection to ensure a single integration event per cell. The transduction percentage was determined by flow cytometry and intensity of the bands was measured by phosphoimager. The inclusion of the HBV element increases the size of the GFP transcript by approximately 1 kb. After correction for transduction efficiency and loading, we could determine that the HBV element increased RNA levels 2.5-fold and decreased RNA levels with a factor of 5 when present in the reverse orientation.

3.5. Characterisation of hepatocytes Using immunofluorescence labeling experiment with an antibody raised against the liver specific mitochondrial enzyme carbamoylphosphate synthetase 1 (CPS) [28], we demonstrated that almost all cells in our preparations are hepatocytes. Fig. 3 shows a low power immunofluorescence micrograph of CPS stained rat hepatocytes. In Fig. 3 (panel C) a higher magnification (40£) of the CPS stained hepatocytes shows hepatocyte morphology and mitochondrial staining. We confirmed that isolated primary hepatocytes do not divide in cell culture by labeling with BrDU for 20 h. Cells that had incorporated BrDU were detected using a monoclonal BrDU antibody. We observed no labeled hepatocytes, irrespective of plating density or whether the cells were incubated with viral supernatant. As a positive control,

Table 2 The effect of the HBV element on CMV promoter driven GFP expression a Cell type

CMV

CMVPRES

CMVPREAS

HeLa HepG2 Human fibroblasts 293T CaCo-2

1 1 1 1 1

3.4 ^ 1 ðn ¼ 4Þ 2.7 ^ 2 ðn ¼ 3Þ 2.2 ^ 1 ðn ¼ 3Þ 1.7 ðn ¼ 2Þ 2 ðn ¼ 2Þ

0.21 ^ 0.2 ðn ¼ 4Þ 0.16 ^ 0.1 ðn ¼ 3Þ 0.15 ^ 0.02 ðn ¼ 3Þ 0.33 ðn ¼ 2Þ 0.51 ðn ¼ 2Þ

a

The effect of the HBV element and mutant HBV elements on GFP expression in different cells is depicted. Cells were transduced and analysed for GFP expression as described. Mean fluorescence intensities are normalised to the intensity in cells transduced with a lentiviral vector without the HBV element.

Fig. 2. Northern blot of transduced HeLa cells. HeLa cells were transduced with CMV (lane 1), CMVPRES (lane 2) and CMVPREAS (lane 3). Lane 4 contains RNA from untransduced cells. Northern blots were performed as described. The positions of the 18S and 28S ribosomal bands are indicated. As expected, the inclusion of the HBV element results in an increase in size of the messenger mRNA. The blots were also probed for GAPDH and this signal is shown to demonstrate equal loading.

J. Seppen et al. / Journal of Hepatology 36 (2002) 459–465

463

Fig. 3. Fluorescence microscopy of rat hepatocytes. Rat hepatocytes were cultured on collagen coated glass coverslips as described. Hepatocytes were fixed after 1 day of cell culture and stained for the liver specific mitochondrial enzyme carbamoyl phosphate synthetase 1 (CPS) as described. Panel CPS C shows rat hepatocytes stained with an irrelevant primary antibody and panel CPS shows rat hepatocytes stained with an antiserum raised against rat CPS, both micrographs made with a 10 £ objective. Panel 3 shows a micrograph of rat hepatocytes stained for CPS made with a 40 £ objective, showing hepatocyte morphology and mitochondrial localisation of the staining. Panel C shows control rat hepatocytes 3 days after plating and panels PGKPRE and PPTPGKPRE show hepatocytes transduced with the PGKPRE and PPTPGKPRE vectors, respectively. All micrographs of lentivirus tranduced hepatocytes were made with a 10 £ objective.

HeLa cells were indentically labeled with BrDU and were found to be highly positive for BrDU incorporation (results of BrDU labeling not shown). 3.6. Transduction of hepatocytes with lentiviral vectors Representative fluorescence micrographs of control hepatocytes and hepatocytes transduced with PGKPRES and PPTPGKPRE are shown in Fig. 3. Fluorescence in hepatocytes transduced with the PGK vector could not be detected

microscopically. The PPTPGKPRE vector mediates higher GFP expression levels than the PGKPRES vector, while transduction efficiency is comparable. To obtain more quantitative data, transduced hepatocytes were analysed by flow cytometry. Table 3 shows the averages from three independent experiments. The mean fluorescence intensity (MFI) of transduced cells was normalised to the MFI of PGK transduced cells. The PPTPGK vector increased the MFI 2.3 ^ 0.4-fold, the PGKPRES vector increased the MFI 2.8 ^ 0.6-fold. Inter-

464

J. Seppen et al. / Journal of Hepatology 36 (2002) 459–465

Table 3 Transduction efficiency and GFP expression levels of primary rat hepatocytes a

Transduction efficiency Fluorescence intensity

PGK

PGKPRES

PPTPGK

PPTPGKPRE

5 ^ 1% 1

54 ^ 13% 2.8 ^ .6

47 ^ 11% 2.3 ^ .4

68 ^ 10% 17 ^ 6

a

Primary rat hepatocytes were transduced and analysed by flow cytometry as described. Fluorescence intensity was normalised to PGK transduced cells. The values shown are the average of three independent experiments.

estingly, the PPTPGKPRE vector increased the MFI in a synergistic manner by 17 ^ 6-fold.

4. Discussion Safe third generation lentiviral vectors were improved by introduction of HBV elements and the HIV PPT. These improvements were shown to be essential for the efficient transduction of quiescent hepatocytes. Our results indicate that HBV elements increase expression levels of a transgene delivered by lentiviral vectors. The amount of transducing units per pg of HIV p24 is increased in vectors with the HBV element, this might be an important property for in vivo gene transfer because viral preparations with the HBV element will contain less defective or empty viral particles. When studied separately, the HBV enhancers I and II have been shown to function in an orientation independent manner. The HBV element in reverse orientation decreased GFP mRNA and expression levels, its mechanism of action is not as a classical enhancer element but probably takes place on posttranscriptional level. Incorporation of the HIV PPT in third generation lentiviral vectors has been reported to increase gene transfer into quiescent hematopoietic cells [12,13]. Our study extends this by showing that the PPT enables efficient lentiviral transduction of quiescent hepatocytes. The combination of the PPT and HBV PRE increases gene expression synergistically, which might be explained by the fact that these elements act by different mechanisms. We also showed that an intact coding region of HBVx is not required for the HBV element mediated expression increase. For human gene therapy purposes, it is important that HBVx expression can be excluded because HBVx is involved in HBV pathogenicity. A minimal fragment of 757 bp was shown to be fully active, however, when the minimal element was combined with a 4 bp deletion in the HBVx open reading frame, its efficiency was reduced. The HBV element probably increases expression levels by several mechanisms [31] and some redundancy in the function of this element could exist. When deletions are made that compromise the function slightly the efficiency will not be decreased. In the minimal element, the part of the PRE that could compensate for the 4 bp deletion might not be present. The HBV element increased expression levels when

either the viral CMV promoter or the human PGK promoter were driving GFP expression. This is important because viral promoters are often inactivated in vivo and are therefore not useful for gene therapy targeted to a variety of tissues [32,33]. The ability to increase expression of mammalian constitutive promoters would be very helpful for the development of effective gene therapy. This study shows that lentiviral transduction of quiescent isolated hepatocytes requires HBV elements or the HIV PPT. This is a significant finding because a previous study in mice and rats documented inefficient transduction of quiescent hepatocytes and reported that cell cycling was required for lentiviral gene transfer into hepatocytes [11]. Whether our data can be extrapolated to the transduction of hepatocytes in vivo remains to be established. However, the strongly improved performance of our novel lentiviral vectors suggests that these vectors are very promising for the development of in vivo liver gene therapy. Because of the shortage of liver donors and risks associated with liver transplantation, liver cell transplantation is becoming an alternative [34]. A previous clinical trial of ex vivo murine retroviral transduction of isolated hepatocytes from patients with severe familial hypercholesterolaemia reported modest clinical improvements [35]. The limitation in these experiments was the inefficient transduction of hepatocytes by murine retroviral vectors because hepatocyte proliferation had to be induced by growth factors [35]. The ability to efficiently transduce hepatocytes might bring the ex vivo approach in focus again and could have important implications for the treatment of patients with inherited liver disorders.

Acknowledgements We are grateful to Drs D. Trono and R. Zufferey (University of Geneva, Geneva, Switzerland) for providing us with the third generation lentiviral vector system. We wish to thank Dr B. Berkhout (Academic Medical Center, Amsterdam, the Netherlands) for SupT1 cells, for helpful discussions and for providing us with a fragment of the HIV clone LAI-1, Dr J. van Wamel (Academic Medical Center, Amsterdam, the Netherlands) for help with the p24 ELISA, Dr B. van Montfrans (Academic Medical Center, Amsterdam, the Netherlands) for primary murine splenocytes, Dr G. van Woerkom (Academic Medical Center, Amsterdam, the Netherlands) for isolation of primary rat

J. Seppen et al. / Journal of Hepatology 36 (2002) 459–465

hepatocytes, Dr D. Geerts (Academic Medical Center, Amsterdam, the Netherlands) for the GAPDH probe and Dr Renee te Morsche (University of Nijmegen, the Netherlands) for providing us with the HBV fragment. This research was made possible by a grant from NWO, 90223-248 to J.S.

[18]

[19]

[20]

References [1] Snyder RO, Miao C, Meuse L, Tubb J, Donahue BA, Lin HF, et al. Correction of hemophilia B in canine and murine models using recombinant adeno-associated viral vectors. Nat Med 1999;5:64–70. [2] Koeberl DD, Alexander IE, Halbert CL, Russell DW, Miller AD. Persistent expression of human clotting factor IX from mouse liver after intravenous injection of adeno-associated virus vectors. Proc Natl Acad Sci USA 1997;94:1426–1431. [3] Wilson JM, Jefferson DM, Chowdhury JR, Novikoff PM, Johnston DE, Mulligan RC. Retrovirus-mediated transduction of adult hepatocytes. Proc Natl Acad Sci USA 1988;85:3014–3018. [4] Bosch A, McCray Jr PB, Walters KS, Bodner M, Jolly DJ, van Es HH, et al. Effects of keratinocyte and hepatocyte growth factor in vivo: implications for retrovirus-mediated gene transfer to liver. Hum Gene Ther 1998;9:1747–1754. [5] Patijn GA, Lieber A, Schowalter DB, Schwall R, Kay MA. Hepatocyte growth factor induces hepatocyte proliferation in vivo and allows for efficient retroviral-mediated gene transfer in mice. Hepatology 1998;28:707–716. [6] Forbes SJ, Themis M, Alison MR, Sarosi I, Coutelle C, Hodgson HJ. Synergistic growth factors enhance rat liver proliferation and enable retroviral gene transfer via a peripheral vein. Gastroenterology 2000;118:591–598. [7] Buchschacher Jr GL, Wong-Staal F. Development of lentiviral vectors for gene therapy for human diseases. Blood 2000;95:2499– 2504. [8] Trono D. Lentiviral vectors: turning a deadly foe into a therapeutic agent. Gene Ther 2000;7:20–23. [9] Naldini L. Lentiviruses as gene transfer agents for delivery to nondividing cells. Curr Opin Biotechnol 1998;9:457–463. [10] Kafri T, Blomer U, Peterson DA, Gage FH, Verma IM. Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 1997;17:314–317. [11] Park F, Ohashi K, Chiu W, Naldini L, Kay MA. Efficient lentiviral transduction of liver requires cell cycling in vivo. Nat Genet 2000;24:49–52. [12] Follenzi A, Ailles LE, Bakovic S, Geuna M, Naldini L. Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat Genet 2000;25:217–222. [13] Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P. HIV-1 genome nuclear import is mediated by a central DNA flap. Cell 2000;101:173–185. [14] Antonucci TK, Rutter WJ. Hepatitis B virus (HBV) promoters are regulated by the HBV enhancer in a tissue-specific manner. J Virol 1989;63:579–583. [15] Shaul Y, Rutter WJ, Laub O. A human hepatitis B viral enhancer element. EMBO J 1985;4:427–430. [16] Yee JK. A liver-specific enhancer in the core promoter region of human hepatitis B virus. Science 1989;246:658–661. [17] Sandig V, Loser P, Lieber A, Kay MA, Strauss M. HBV-derived

[21] [22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30] [31]

[32]

[33]

[34] [35]

465

promoters direct liver-specific expression of an adenovirally transduced LDL receptor gene. Gene Ther 1996;3:1002–1009. Huang J, Liang TJ. A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products. Mol Cell Biol 1993;13:7476–7486. Huang ZM, Yen TS. Hepatitis B virus RNA element that facilitates accumulation of surface gene transcripts in the cytoplasm. J Virol 1994;68:3193–3199. Huang ZM, Yen TS. Role of the hepatitis B virus posttranscriptional regulatory element in export of intronless transcripts. Mol Cell Biol 1995;15:3864–3869. Murakami S. Hepatitis B virus X protein: structure, function and biology. Intervirology 1999;42:81–99. Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, et al. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 1998;72:9873–9880. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998;72:8463–8471. Seppen J, Barry SC, Klinkspoor JH, Katen LJ, Lee SP, Garcia JV, et al. Apical gene transfer into quiescent human and canine polarized intestinal epithelial cells by lentivirus vectors. J Virol 2000;74:7642– 7645. Back NK, Nijhuis M, Keulen W, Boucher CA, Oude Essink BO, van Kuilenburg AB, et al. Reduced replication of 3TC-resistant HIV-1 variants in primary cells due to a processivity defect of the reverse transcriptase enzyme. EMBO J 1996;15:4040–4049. Camoglio L, te Velde AA, de Boer A, ten Kate FJ, Kopf M, van Deventer SJ. Hapten-induced colitis associated with maintained Th1 and inflammatory responses in IFN-gamma receptor-deficient mice. Eur J Immunol 2000;30:1486–1495. Groen AK, Sips HJ, Vervoorn RC, Tager JM. Intracellular compartmentation and control of alanine metabolism in rat liver parenchymal cells. Eur J Biochem 1982;122:87–93. Charles R, de Graaf A, Moorman AF. Radioimmunochemical determination of carbamoyl-phosphate synthase (ammonia) content of adult rat liver. Biochim Biophys Acta 1980;629:36–49. Seppen J, Steenken E, Lindhout D, Bosma PJ, Elferink RP. A mutation which disrupts the hydrophobic core of the signal peptide of bilirubin UDP-glucuronosyltransferase, an endoplasmic reticulum membrane protein, causes Crigler–Najjar type II. FEBS Lett 1996;390:294–298. Huan B, Siddiqui A. Regulation of hepatitis B virus gene expression. J Hepatol 1993;17:S20–S23. Huang Y, Wimler KM, Carmichael GG. Intronless mRNA transport elements may affect multiple steps of pre-mRNA processing. EMBO J 1999;18:1642–1652. Palmer TD, Rosman GJ, Osborne WRA, Miller AD. Geneticallymodified skin fibroblasts persist long after transplantation but gradually inactivate introduced genes. Proc Natl Acad Sci USA 1991;88:1330–1334. Wei MQ, Lejnieks DV, Ramesh N, Lau S, Seppen J, Osborne WR. Sustained gene expression in transplanted skin fibroblasts in rats. Gene Ther 1999;6:840–844. Strom SC, Chowdhury JR, Fox IJ. Hepatocyte transplantation for the treatment of human disease. Semin Liver Dis 1999;19:39–48. Raper SE, Grossman M, Rader DJ, Thoene JG, Clark III BJ, Kolansky DM, et al. Safety and feasibility of liver-directed ex vivo gene therapy for homozygous familial hypercholesterolemia. Ann Surg 1996;223: 116–126.