Leptin and its receptors are present in the rat olfactory mucosa and modulated by the nutritional status

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –14 1

a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m

w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s

Research Report

Leptin and its receptors are present in the rat olfactory mucosa and modulated by the nutritional status Christine Baly a,⁎, Josiane Aioun a , Karine Badonnel a , Marie-Christine Lacroix a , Didier Durieux a , Claire Schlegel b , Roland Salesse a , Monique Caillol a a

Unité de Neurobiologie de l'Olfaction et de la Prise Alimentaire, Equipe Récepteurs et Communication Chimique, UMR1197 Institut National de la Recherche Agronomique-Université Paris 11, CRJ, Domaine de Vilvert, 78352 Jouy-en-Josas Cedex, France b Unité de Neurobiologie de l'Olfaction et de la Prise Alimentaire, Equipe Biochimie de l'Olfaction et de la Gustation, UMR1197 Institut National de la Recherche Agronomique-Université Paris 11, CRJ, Domaine de Vilvert, 78352 Jouy-en-Josas Cedex, France

A R T I C LE I N FO

AB S T R A C T

Article history:

Leptin is an adipocyte-derived cytokine that regulates body weight mainly via the long form

Accepted 17 October 2006

of the leptin receptor (Ob-Rb). Leptin and its receptors are expressed in several tissues,

Available online 12 December 2006

suggesting that leptin might also be effective peripherally. We hypothesized that, as shown in taste cells, leptin and its receptors isoforms (Ob-Rs) could be present in the rat olfactory

Keywords:

mucosa (OM). Using RT-PCR, light and electron microscopy immunohistochemistry (ICC),

Olfactory mucosa

we found that different isoforms of the receptor were expressed in OM and localized in

Leptin

sustentacular cells and in a subpopulation of maturating neurons; in addition,

Leptin receptors

immunoreactivity was also present in differentiated neurons and enriched at the cilia

Food intake

membranes, where the odorants bind to their receptors. Moreover, using RT-PCR, ICC and

Immunohistochemistry

RIA measurements, we showed that leptin is synthesized locally in the olfactory mucosa. In

Electron microscopy

addition, we demonstrate that fasting causes a significant enhanced transcription of both leptin and Ob-Rs in rat OM by quantitative RT-PCR data. Altogether, these results strongly

Abbreviations:

suggested that leptin, acting as an endocrine or a paracrine factor, could be an important

CNS, central nervous system

regulator of olfactory function, as a neuromodulator of the olfactory message in cilia of

HO, hypothalamus

mature olfactory receptors neurons (ORN), but also for the homeostasis of this complex

OE, olfactory epithelium

tissue, acting on differentiating neurons and on sustentacular cells. © 2006 Elsevier B.V. All rights reserved.

OM, olfactory mucosa ORN, olfactory receptor neurons SC, sustentacular cells

1.

Introduction

Leptin, a cytokine hormone produced by white mature adipocytes, is one of the major hormones controlling energy balance. Recent studies have emphasized the production of leptin by other tissues, such as the central nervous system (Morash et al., 1999), the placenta (Dotsch et al., 1999) and,

more recently, the salivary glands (De Matteis et al., 2002). In rodents, leptin reduces food intake by acting on various feeding centers in the hypothalamus (HO), targeting orexigenic and anorexigenic neuron (Sahu, 2003, 2004). Leptin interacts with receptors (Ob-Rs) bearing sequence homology to the class I cytokine receptor family. Various splicing isoforms, from Ob-Ra to Ob-Re, have been cloned (Lee et al., 2002)

⁎ Corresponding author. NOPA-RCC, INRA-CRJ, Domaine de Vilvert, 78352 Jouy-en-Josas Cedex, France. Fax: +33 1 34 65 22 41. E-mail address: [email protected] (C. Baly). 0006-8993/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2006.10.030

131

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –1 41

and are expressed in several CNS areas (Guan et al., 1997; Elmquist et al., 1998), in addition to many different tissues, such as lung, adrenals, mammary gland… (for a review, see Bjorbaek and Kahn, 2004) and very recently mice olfactory mucosa (Getchell et al., 2006). These isoforms differ in the length of the intracellular carboxy-terminus domain, and they display different capabilities of signaling (Sweeney, 2002). If both the long (ObRb) and some of the short isoforms activate the Janus kinases pathways (Jaks), only Ob-Rb has been shown to activate Stats (Bjorbaek et al., 1997). Both Ob-Ra and Ob-Rc are expressed in rat brain endothelial cells (Bjorbaek et al., 1998) and microvessel epithelial cells of the choroid plexus (Tartaglia et al., 1995; Hileman et al., 2002) and are believed to be implicated in leptin transport into the CNS (Banks et al., 1996; Hileman et al., 2000). Besides its roles in hypothalamic nuclei, leptin displays physiological actions in a number of peripheral tissues. Paracrine or autocrine actions of leptin on adipose tissue metabolism (Siegrist-Kaiser et al., 1997) and on pituitary secretion (OrtigaCarvalho et al., 2002) have been suggested. In addition, in mice, leptin suppresses taste nerve response to sweet stimuli (Kawai et al., 2000; Shigemura et al., 2004) and is possibly involved in olfactory pre-ingestive performance (Getchell et al., 2006). At a behavioral level, the reactivity to food odors is influenced by the nutritional status of the animal (O'Doherty et al., 2000; Getchell et al., 2006); at a cellular level, in the olfactory bulb, the reactivity of mitral cells to food odors is increased in fasted rats (Pager, 1978). However, no data are dealing with a direct relationship between nutritional status and olfactory mucosa functioning. Located in the upper cavity of the nose, the olfactory mucosa (OM) is composed of the olfactory neuroepithelium (OE) and the underlying lamina propria (Bowman's glands, olfactory nerves, blood vessels and connective tissue). From the apical surface of the OE down to the basal membrane, numerous cell types are present: non-neuronal sustentacular cells (SC), mature olfactory neurons (ORNs), immature ORNs, progenitor globose basal

cells (GBC) and horizontal basal cells (HBC) which participate in the coordinated development and regeneration of the OE during the entire life (Mackay-Sim and Chuah, 2000). Odorant binding to a subset of mature ORNs results in the activation of tissue-specific downstream components of the sensory transduction pathways. The electrical signal is then processed and modulated in the olfactory bulb (Mombaerts, 2001). Both anatomical and functional evidences suggest a possible modulation of the primary olfactory signal by neuropeptides or hormones: PACAP (Hegg et al., 2003a,b), dopamine (Feron et al., 1999; Hegg and Lucero, 2004), orexins and their receptors (Caillol et al., 2003) have been identified in the OM. ATP modulates odor sensitivity, via activation of purinergic receptors subtypes in ORNs (Hegg et al., 2003a,b); a dopaminergic modulation of ORN excitability has been recently evidenced (Hegg and Lucero, 2004) showing that olfactory receptor neurons can be modulated at the periphery. The present study was undertaken to examine the expression and localization of leptin and its receptors in the rat olfactory mucosa. We carefully examined a possible endogenous production of leptin by the OM to provide a potential basis for an autocrine regulation. We then investigated whether the expression of both leptin and leptin receptors genes in the OM was modulated by the nutritional status of rats.

2.

Results

2.1. Four isoforms of the leptin receptors are transcribed in the olfactory mucosa To test whether different leptin receptors mRNAs were expressed in OM, different sets of primer pairs corresponding to several isoforms of the rat leptin receptors were designed (Table 1) and RT-PCR analysis was carried out in parallel in OM and HO reverse-transcribed polyA+ RNAs. The mRNA

Table 1 – Primers used for conventional and real-time RT-PCR amplification

Conventional PCR

Q-PCR

Oligonucleotides name

Sequences (5′ to 3′)

Product size (in bp)

LeptR3 LeptR4 LeptRL5 LeptRS1 LeptRc1 LeptRc2 LeptRf1 LeptRf2 Leptin1 Leptin2 Leptin3 Leptin4 GAPDH1 GAPDH2 qLeptin1 qLeptin2 qObRa1 qObRA2 qObRb1 qObRB2 β-actin1 β-actin2

GAGATGGTACCAGCAGCTATGG CCCTCCAGTTCCAAAAGCTCATCC GATGATGGAATGAAGTGGCTTAG GAGTGTCCGCTCTCTTTTGGA ATTGTACCGGTAATTATTTCCT CTGCAACCTTAGATATCTT AATGAAGTGGCTTAGAATCC CTAATTTCTGCCAGGCATT CCTGTGGCTTTGGTCCTATCTG CTGCTCAGAGCCACCACCTCTG CTATGTTCAAGCTGTGCCTATCC CGCCATCCAGGCTCTCTGGCTTC AAACCCATCACCATCTTCCAG AGGGGCCATCCACAGTCTTCT TTCACACACGCAGTCGGTATC CCCGGGAATGAAGTCCAAA TTTCCAAAAGAGAGCGGACAC AGGTTGGTAGATTGGATTCATCTGT AAAGCCTGAAACATTTGAGCATC CCAGAAGAAGAGGACCAAATATCAC GACCCAGATCATGTTTGAGACCTT CACAGCCTGGATGGCTACGT

397 348 182 349 420 349 361 61 69 71 61

132

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –14 1

Fig. 1 – Detection of different Ob-Rs mRNA isoforms by RT-PCR analysis in hypothalamus or olfactory mucosa tissues from normal rats. PCR products were run on an ethidium bromide stained–1.5% agarose gel. Products were of the expected size (see Table 1 for oligonucleotide sequences) and were controlled by sequencing the PCR products derived from OM samples. R3/R4: Ob-Rb; L5/S1: Ob-Ra; Rc1/Rc2: Ob-Rc; Rf1/Rf2: Ob-Rf. HO = hypothalamus; OM = olfactory mucosa; MWM = 1 kb DNA ladder.

encoding Ob-Rb (R3/R4) was easily detected as a 397 bp amplified fragment in rat OM as well as in HO (Fig. 1). mRNAs encoding the short receptor forms Ob-Ra (L5/S1), ObRc (Rc1/Rc2) and Ob-Rf (Rf1/Rf2) were also selectively amplified in both tissues and displayed specific bands of the expected size (see Table 1). On the contrary, Re− and Rd− receptor forms mRNAs were not amplified using already published conditions (Lee et al., 2002) (data not shown).

2.2. Leptin receptors are localized in different cell types in the olfactory mucosa We next determined in which cell type(s) these receptors were expressed by studying the cellular and subcellular localization of Ob-Rs using 2 different antibodies.

At the light microscopy level, using an antibody raised against the beginning of intracytoplasmic domain corresponding to several isoforms of the receptor (M18), Ob-Rs immunoreactivity was largely distributed in septum and turbinates of the olfactory mucosa (Figs. 2A, B). The labeling was clearly identified at the apical part of the epithelium, probably mainly in dendritic knobs of mature olfactory neurons (Fig. 2A). In addition, a dense labeling of cell bodies located in the inner part of the epithelium was observed. Basal cells were also slightly immunoreactive. In the lamina propria, a faint labeling was localized in Bowman's gland cells. In specimens where the primary specific antibody was omitted, no labeling was detected (Fig. 2C). Due to the low spatial resolution of the light microscopy, we were unable to distinguish which cell types in the apical part of the epithelium, ORNs or sustentacular cells (SC) expressed Ob-Rs. In order to clarify the localization of leptin receptors at the ultrastructural level, we used two different antibodies, either the M18 antibody directed against several Ob-Rs isoforms (Figs. 2D, H) or a specific antibody directed against Ob-Rb (Figs. 2E, F, J). Both antibodies revealed electron-dense DAB deposits both in SC (Figs. 2E, F, H) and in ORNs (Figs. 2D, E) with no qualitative differences in the distribution of the labeling. In SC, Ob-Rs was identified in microvilli at the apical part of the epithelium (Fig. 2D) and in the cytoplasm deeper in the cell, associated with the tubulovesicular network and endoplasmic reticulum cisternae (Fig. 2H). The latter localization suggested a local synthesis of Ob-Rs in SC. At the most apical part of SC, the immunolabeling was sometimes associated with vesicles in formation observed between labeled microvilli (Fig. 2F), suggesting that endocytosis or exocytosis of the receptor could occur. In ORNs, ObRs, including Ob-Rb, were mostly located in olfactory cilia, with a higher occurrence in their proximal part (Figs. 2D, E)

Fig. 2 – Immunohistochemical localization of Ob-Rs leptin receptor in the olfactory mucosa. Abbreviations: Bv: blood vessel; LP: lamina propria; m: mitochondria; Mv: microvilli; NC: nasal cavity; oc: olfactory cilia; OE: olfactory epithelium; ORN: olfactory receptor neuron; ER: endoplasmic reticulum; SC: sustentacular cell; sg: secretion granule; v: secretion vesicles. A, B: at light microscope level, Ob-Rs leptin receptors were visualized at the apical part of the epithelium, inner in the mucosa in the cytoplasm of neurons, and in basal cells (black arrows). A faint labeling was also found in the lamina propria, in Bowman's glands (white arrows). C: control without the primary antibody. The images were obtained on a Zeiss LSM 510 confocal microscope; green color corresponding to leptin receptors immunoreactivity and gray color corresponding to transmission image. Scale bars = 20 μm. D–K: ultrastructural localization of the different isoforms of the leptin receptor in the olfactory mucosa. The localization of the short and long isoforms (Ob-Rs) of the leptin receptors was performed using the Santa Cruz M18 antibody (D, H), whereas the Ob-Rb isoform was visualized using the Linco antibody (E, F, J). In each case, the presence of leptin receptors was materialized by the presence of electron-dense DAB deposits. D–I: at the apical level of the olfactory epithelium, the ultrastructural localization of either the Ob-Rs (D, H) or the Ob-Rb (E, F) isoforms was not different. Electron-dense DAB deposits were observed both in olfactory neurons, at olfactory cilia level (arrows) and in sustentacular cells, at microvillar level or in the apical cytoplasm (arrowheads). In control sections in which specific antisera have been omitted, no electron-dense deposits were ever observed (G, I). In the most apical part of sustentacular cells, some microvilli were immunoreactive for Ob-Rb (F, bold arrows); between microvilli protruding in the nasal cavity, the immunolabeling was associated with vesicles in formation (F, short bold arrows) suggesting that exocytosis or endocytosis of the receptors occurs at the apical part of the epithelium. In a neighboring cell, such vesicles were devoid of immunolabeling (thin arrows). In the lower part of the cytoplasm of sustentacular cells characterized by a well-developed tubulo-vesicular network (H), immunoreactivity for Ob-Rs was associated with endoplasmic reticulum (bold arrows) and with secretion vesicles (arrowheads). In control section (I), such vesicles were negative (arrows). J–K: in the lower part of the olfactory mucosa, the synthesis of the Ob-Rb isoform was visualized in ER cisternae of Bowman's gland cells (arrows, J), whereas some cisternae appeared devoid of immunolabeling (arrowheads). No immunolabeling was observed in control sections incubated without the specific antiserum (K, arrowheads showing non-immunoreactive ER cisternae).

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –1 41

but also in their very distal part (not shown). The presence of Ob-Rs at ciliary level suggests a possible interaction with olfactory signalization pathways as soon as the odorant binds to its receptor on the ciliary membrane. In some dendritic knobs, the immunolabeling seemed to be asso-

133

ciated to the cisternae of endoplasmic reticulum, suggesting a synthesis of Ob-Rs in ORNs also. In the lamina propria, some cells in Bowman's glands were highly immunoreactive (Fig. 2J), visualizing an important synthesis of Ob-Rb at their level. In sections where the specific

134

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –14 1

Fig. 3 – Detection of housekeeping GAPDH and leptin mRNAs by RT-PCR. Total mRNAs were prepared from white adipose tissue (WAT), olfactory mucosa (OM) or adrenals (Ad), and RT-PCR amplification products for housekeeping GAPDH gene (A) and leptin (B and C) were run on an ethidium bromide stained–1.5% agarose gel. WAT−: RT-PCR without reverse transcriptase; C, control without matrix. Products were of the expected size (see Table 1) and were controlled by sequencing PCR products derived from OM samples. MWM = 1 kb DNA ladder.

primary antibody was omitted, no DAB deposits were ever observed (Figs. 2G, I, K).

2.3.

There is a local synthesis of leptin in olfactory mucosa

The evidence of a large presence of Ob-Rs in the OM prompted us to examine whether leptin displayed detectable levels in the OM. Mean leptin content of OM evaluated by radioimmunoassay was 22.3 ± 4 pg/mg of protein (n = 7), when mean leptin content in white adipose tissue (WAT) taken as a control was 2.6 ± 0.7 ng/mg of protein. Therefore, the OM expressed low, albeit detectable levels of leptin in normal rats. To address the question of the origin of leptin, i.e. originating from blood vessels or endogenously produced, conventional RT-PCRs were conducted on OM samples using WAT and adrenal samples (Ad) as positive controls for leptin expression (Charbonneau et al., 2004). GAPDH gene expression was chosen as a quality control test for all the cDNA samples (Fig. 3A). In OM, with the first set of leptin1–leptin2 primers (Table 1), no PCR amplification for leptin was obtained except the expected band in both Ad and WAT control samples (Fig. 3B). A second round of amplification

using the nested primer set leptin 3–4 yielded a clear band in all samples (Fig. 3C), thus attesting the presence of low levels of leptin mRNAs in OM. To further determine in which cell types leptin was present, we performed light and electron microscopy experiments using a leptin antibody (Fig. 4). At the light microscope level, leptin was visualized mainly at the apical part of the epithelium (Fig. 4A). Deeper in the epithelium, some basal cells were faintly immunoreactive. In the lamina propria, a faint labeling was observed in Bowman's glands. No specific labeling was observed when the specific antibody was omitted (Fig. 4B). At the ultrastructural level, electron-dense DAB deposits indicated the presence of leptin. Whatever the postfixation protocol (see Experimental procedures), the leptin distribution did not differ. Leptin was identified mostly at the apical part of SC, at the base of microvilli (Fig. 4D) or in microvilli protruding in the nasal cavity (Figs. 4E, F). In ORNs, a faint labeling was observed in olfactory cilia, either at their proximal part (Fig. 4E) or their distal part in the nasal cavity (not shown). In some cases, DAB deposits were observed outside the dendritic knob, at the base of olfactory cilia (Figs. 4E, F), suggesting that leptin was secreted in the nasal cavity. In the lamina propria, some endothelial cells were immunoreactive for leptin (not shown). No internal labeling of subcellular structures such as Golgi cisternae was observed either in ORNs or in SC.

2.4. Food deprivation enhances peptide and receptors expression in the olfactory mucosa Since modifications in the nutritional status result in variations of leptin circulating levels, we hypothesized that such modifications could be followed by a positive or negative feedback regulation in expression of both leptin and different leptin receptors isoforms genes in the olfactory system. We performed a Q-PCR analysis of OM from fed (NF, n = 7) vs. 46-h food-deprived (FD, n = 4) rats (Fig. 5B) for both leptin and its receptors mRNAs.

2.5. Metabolic parameters of normally fed and food restricted rats Glucose, triglycerides (TG) and leptin concentrations were measured in plasma from NF or FD rats. For the 3 tested parameters, plasma levels were significantly reduced in fooddeprived animals: 6.9 ± 0.38 mg/ml (FD) vs. 10.6 ± 0.33 mg/ml (NF)

Fig. 4 – Immunohistochemical localization of leptin in the olfactory mucosa. Abbreviations: BG: Bowman's gland; Mv: microvilli; NC: nasal cavity; oc: olfactory cilia; ORN: olfactory receptor neuron; SC: sustentacular cell. A–B: at the histological level (14 μm section), leptin was visualized at the apical part of the epithelium (arrows). Deeper in the epithelium, some basal cells were immunoreactive (short arrows). In the lamina propria, some faintly immunoreactive cells corresponding to Bowman's gland cells (arrowheads) were visualized. In control sections incubated without the specific antibody, no immunolabeling was observed (B). C–F: ultrastructural localization of leptin in the olfactory epithelium (postfixation with OsO4 2% and dehydration with 1% p-phenylenediamine in ethanol 70%). In sections incubated with the antiserum (D–F), the presence of electron-dense DAB deposits confirmed the presence of leptin at the apical pole of the epithelium, both in ORN and in SC. Within sustentacular cells, the immunolabeling was observed in the most apical part of the cell (D) and in microvilli surrounding some dendritic knobs or protruding in the nasal cavity (arrows D–F). In the ORN, DAB deposits were observed in olfactory cilia, in their proximal as well as in their distal parts protruding in the nasal cavity (F). At the dendritic knob level, DAB deposits seemed to be localized outside the ORN, between the proximal parts of cilia (arrowheads E, arrows F). C: control sections in which the antibody specific for leptin was omitted, no electron-dense DAB deposit was ever observed.

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –1 41

for glucose substrate, 2.13± 0.32 mg/ml (FD) vs. 5.71± 0.74 mg/ml (NF) for TG and <1 ng/ml (FD) for leptin vs. 6.14 ng/ml ± 0.9 (NF), thus attesting the significant impact of fasting (Fig. 5A). Plasma concentrations of glucose, TG and leptin were lowered by 35%, 65% and 92% in fasted rats compared to fed controls.

2.6. Effect of fasting on leptin and Ob-Rs mRNAs expression in the OM Q-PCR analysis of samples revealed a 7-fold increase in leptin messenger RNA levels in the OM of food-deprived rats

135

compared to controls (Fig. 5B). An increased expression for Ob-Ra and Ob-Rb was observed, ranging from a 2-fold increase for Ob-Ra to an 8-fold increase for Ob-Rb expression level in the OM of FD rats. When compared to Ob-Rb, Ob-Ra mRNA was expressed 11fold more in the OM of NF rats (Fig. 5C). Since fasting caused a preferential up-regulation of Ob-Rb mRNA (Fig. 5B), the ratio between the two mRNAs was consistently reduced to 2.5 by fasting. Therefore, a 46-h fasting is correlated to a modification of the expression ratio between the 2 differentially spliced Ob-Rs mRNA isoforms in the OM.

136

3.

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –14 1

Discussion

In the present study, by using a combination of immunohistochemical, biochemical and molecular approaches, we show that the long form and some of the short forms of leptin receptors are expressed in rat olfactory mucosa together with their biological ligand leptin. Different cell types of the OM exhibit Ob-Rs immunoreactivity at the ultrastructural level. Moreover, we provide the first evidence of a local synthesis of leptin. In addition, we demonstrate that the expression of these molecules is dynamically controlled at the transcriptional level by the nutritional status of rats. We establish the presence of Ob-Rb and of some short forms (Ob-Ra, Ob-Rc and Ob-Rf) by RT-PCR identifying different forms of Ob-R mRNA and by ICC analysis localizing these isoforms. We show that Ob-Rs are mostly expressed in the apical part of the epithelium, in neurons, in the dendritic knobs and olfactory ciliae and in sustentacular cells. In addition, a cytoplasmic labeling of cells located deeper in the olfactory mucosa is also observed and basal cells are faintly stained. As ORNs move apically in the epithelium during their differentiation, the localization of these cells in the OE indicates that they are probably neurons in the process of maturation (Schwob, 2002). The cytoplasmic localization of Ob-Rs is in agreement with previous observations on hypothalamic nuclei showing that a large part of the leptin receptor immunoreactivity is found in the cytoplasm associated with Golgi rather than at the cell surface (Diano et al., 1998). The presence of immunoreactive vesicles at the apical part of SC in the OE is in agreement with the model of constitutive endocytosis of the receptor recently proposed to account for the low levels of cell surface expression of the leptin receptor (Belouzard et al., 2004). Ob-Ra mRNA is expressed almost 12-fold more than Ob-Rb in OM of fed rats. Relative proportions of leptin receptor isoforms mRNAs are also highly variable in different other tissues (Hileman et al., 2002). The possible functions of short isoforms of the leptin receptor in OM remain unclear with respect to their putative roles in other tissues. Ob-Ra is found in HO at low levels (Smith and Waddell, 2003) and is thought to act as a transporter of leptin across epithelial cells in vitro (Hileman et al., 2000). Other short receptor isoforms (Ob-Rc and Ob-Rf) are also described in cerebral microvessels, but their functions are largely controversial (Hileman et al., 2002). We also demonstrate that the olfactory mucosa expresses leptin, albeit at a low level. The tissue leptin concentrations are a hundred times lower than in the white adipose tissue, and the mRNA can be amplified only by a nested PCR. Comparable evidence of a local leptin synthesis using very sensitive methods has been accumulated in human salivary glands (De Matteis et al., 2002; Bohlender et al., 2003) and in stomach (Bado et al., 1998). In these tissues, leptin is proposed to be secreted by epithelial cells and to exert a local action through binding to Ob-Rs located in the same or in proximal cells. In the olfactory mucosa, whereas the leptin immunolabeling was clearly observed at the apical part of the OE, ultrastructural studies failed to assess the presence of leptin in ORNs or SC organites. The intense leptin labeling at the apical part of the olfactory epithelium, in a region where we also

localized the leptin receptors, could correspond to both endocrine or paracrine mechanisms: transcytosis of blood leptin from vessels located in the lamina propria and secretion of leptin into the mucus by Bowman's glands, since we show a faint labeling in these glands. A free diffusion of leptin through the olfactory mucosa has been recently demonstrated: the intranasal administration of leptin is followed by central effects on neuropeptide levels in the brain and by a decrease of food intake (Schulz et al., 2004). Very recently, posterior glands of the nasal septum as well as vomeronasal glands were identified as leptin-secreting organs by ICC studies in the mice (Getchell et al., 2006), thus suggesting a possible involvement of neighboring discrete secreting glands in the olfactory mucosa (Pes et al., 1998). Interestingly, our observation of increased leptin and receptors expression in fasted rats indicates that nutritional changes, like food deprivation, exert significant effects in the OM transcriptional profile. In the OM, we do not know whether these transcriptional changes result in changes of the protein levels. Anyway, both Ob-Ra and Ob-Rb mRNA are concerned by this short-term regulation. If Ob-Rs mRNA expression is modulated by physiological changes linked to development, age or sex in peripheral placental or hypothalamus tissues (Smith and Waddell, 2002, 2003), few data concern the nutritional status. Here, we chose a short-term food deprivation to ascertain a clear-cut hypoleptinemia and acute regulation of other hormonal signals involved in the control of food intake. Central effects of a 48 h fasting are documented in hypothalamus, where an increase in Ob-Rb mRNA expression arises from an increase in the number of Ob-Rb expressing neurons in the arcuate nucleus (McAlister and Van Vugt, 2004). Besides, short forms of Ob-Rs remain unchanged in brain microvessels following fasting (Hileman et al., 2002). In the thalamus, fasting causes a differential regulation of leptin receptors mRNAs, with an increase in the abundance of Ob-Rb despite a global decrease of Ob-Rs (Bennett et al., 1998). In our study, we have also found such alterations in the balance between Ob-Rb and Ob-Ra in the OM, which might affect different transduction pathways, via Janus kinases or Stats (Bjorbaek et al., 1997). In the OM, we also find that leptin gene is up-regulated by fasting. In that physiological situation, circulating leptin arising from adipose tissue is reduced. The up-regulation of leptin gene in the OM outlines a differential feedback control for leptin expression in the OM, as a consequence of the dramatic fall in the uptake by microvessels. The presence of both leptin and its receptors supplies a neuroanatomical basis in favor of a complex endocrine, paracrine or autocrine regulation of OM by leptin. The wide distribution of leptin and its receptors within the olfactory mucosa indicates a broad role of leptin in the OM functions, and two alternative, but non-exclusive, functions can be drawn. In the mucosa, ORNs undergo a permanent renewal throughout normal life of animals or neuronal regeneration following injury (Schwob, 2002). Although the molecular regulation of epitheliopoiesis is still not fully understood, a growing number of factors regulating the proliferation of epithelial cells are now described, such as leukemia inhibitory factor (LIF) in ORN terminal maturation (Moon et al., 2002) or IGF-1 in the balance of proliferation/differentiation in adult

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –1 41

Fig. 5 – Effects of a 46-h food deprivation on plasma metabolites concentrations and OM leptin and receptors mRNA levels. A: plasma concentrations of glucose, triglycerides and leptin of normal (NF, black bars) or fasted (FD, hatched bars) rats. Values are mean ± SEM for 7 normally fed and 4 food-deprived rats. B: relative expression levels for leptin (empty bars), Ob-Ra (gray bars) and Ob-Rb (black bars) mRNA in OM of rats subjected to a 46-h food deprivation (FD, n = 4) compared to fed rats (n = 7). Significant difference versus fed rats is denoted by * for P < 0.05 and ** for P < 0.01. C: effect of the nutritional status on differential expression levels of ObRa and Ob-Rb mRNAs in OM of either fed (black bars) or starved (hatched bars) rats. For each animal, the difference between Ob-Ra and Ob-Rb mRNA expression levels was calculated. Values are mean ± SEM for 7 normally fed and 4 food-deprived rats.

olfactory epithelial cells (McCurdy et al., 2005). Indeed, the examination of ob/ob mutants emphasized the role of leptin during hypothalamic development, acting as a neurotrophic factor for both neuronal and glial cells maturation (Ahima et al., 1999; Steppan and Swick, 1999; Bouret et al., 2004). In vivo and in vitro studies also provided indications of leptin neuroprotective effects on cultured neuroblastoma cells (Russo et al., 2004) and on cortical neurons (Dicou et al., 2001). In accordance with all these data, we propose that leptin may serve the long-term regulation of OE homeostasis, through the control of proliferation/survival of neurons by the combinatory expression of long and short Ob-R isoforms. Secondly, as the OM is the primary center of olfactory coding, a short-term regulation through modulation of

137

olfactory performances may also be envisaged. This hypothesis is reinforced by the fact that leptin and its Ob-Rs isoform are mostly found at the base of cilia, a region where the binding of odorants takes place and the transduction of the olfactory message is initiated. In CNS, recent data suggest that leptin might stimulate synaptic excitability of hippocampal neurons (Shanley et al., 2002). Leptin also modulates neurophysiologic responses of neurons of tractus solitary nucleus after gastric distension (Schwartz and Moran, 2002). In addition, acute leptin-induced activation of vagal afferent neurons results in a rapid influx of extracellular calcium (Peters et al., 2004). Therefore, we propose that leptin may act at the OE level as a neuromodulator of ORN performances. Karlsson et al. (2002) showed that olfactory performances in humans correlate with their serum leptin levels. Finally, a suppressive effect of leptin on responses to sweet substances has been shown in taste cells, suggesting that other sensory systems are also sensitive to leptin (Shigemura et al., 2004). The recent description of the olfactory behavior of leptindeficient ob/ob mice is another strong argument in favor of leptin as a central regulator of olfactory performances in rodents (Getchell et al., 2006). A role in the regulation of OM mucus secretion, consistent with the involvement of Bowman's glands as a leptin secreting organ, might also be proposed, as shown in goblet cells of the large bowel (Plaisancie et al., 2006). The up-regulation of leptin gene expression could indicate that food restriction modifies the mucus composition to allow a refinement in olfactory performances thus linking our data to changes in olfactory behavior of rats towards food search. Altogether, these results give a strong molecular basis for a possible modulation of olfactory mucosa functions by leptin, i.e. by the nutritional status of the animals, such as linking food intake and olfaction at the primary level of olfactory coding in rodents.

4.

Experimental procedures

4.1.

Animals

Male Wistar rats of 2–3 months from our breeding stock were housed in 12 h light, 12 h dark cycles with free access to food and water until the start of the study. For experiments dealing with the nutritional status, a 2-h-restricted time window for food administration was chosen. Seven-days-habituated rats were sacrificed either 2 h after the end of the meal (normal fed (NF) rats; n = 7) or after a 46-h food restriction (food-deprived (FD) rats; n = 4). All animals were killed at the beginning of the night phase to exclude possible daily variations in hormones levels. All experiments were conducted according to the European Communities Council Directive of 24 November 1986 (86/609/ EEC). All efforts were made to minimize the number and the suffering of rats.

4.2.

Experimental procedures for mRNA studies

Animals were deeply anaesthetized under CO2 and sacrificed by decapitation. Trunk blood samples were collected

138

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –14 1

via the exposed dorsal aorta, centrifuged at 3000×g for 30 min to collect plasma then kept at −20 °C until assayed. The brain was quickly removed to dissect the hypothalamus (HO, used as a positive control) and olfactory mucosa on an ice-cold plate. We carefully eliminated the lateral nasal glands and the vomeronasal organ from dissected samples. Other tissues such as liver (L), adrenals (Ad) or white adipose tissue (WAT) were occasionally used as controls.

apparatus under standard conditions. All Q-PCR Ct expression data were normalized to β-actin expression level from the same individual sample. The primers used for Q-PCR were designed with Primer Express software (Applied Biosystems). A melt curve analysis was conducted on each sample after the final cycle to ensure that a single product was obtained. Each standard and sample point was run in triplicate.

4.6. 4.3.

Total RNAs were isolated from freshly collected samples using the guanidium–thiocyanate–phenol–chloroform extraction method (Chomczynski and Sacchi, 1987) and were DNase Itreated (Roche Diagnostics, Meylan, France). cDNAs were reverse-transcribed from 3 μg of total RNA by 50 U of Superscript II reverse transcriptase (Gibco-BRL, Life Technologies, Cergy Pontoise, France). A control reaction omitting the enzyme was systematically performed to confirm the absence of genomic contamination. For each experiment, at least 2 different rats were independently treated and gave comparable RT-PCR results.

4.4.

Radioimmunoassay (RIA)

Total RNAs isolation

RT-PCR

For PCR amplification, a 1 μl reverse transcription aliquot was added to 20 μl of a reaction mixture containing each pair of primers (Table 1) and 0.5 U Taq polymerase (Promega, Charbonnieres, France). A thermal cycler apparatus was used in the following conditions: 45 s 94 °C, 45 s 57 °C, 45 s 72 °C, 35 cycles (Ob-Rs); 45 s 94 °C, 45 s 58 °C, 45 s 72 °C, 25 cycles (GAPDH1/GAPDH2) or 45 s 94 °C, 45 s 56 °C, 45 s 72 °C, 25 cycles (leptin1–2). For nested PCR, 1 μl of the leptin1–leptin2 PCR product (diluted 1:100) was used for a second round of amplification using internal primers (leptin3–leptin4) for 35 additional cycles. Controls including absence of DNA matrix or reverse transcriptase were systematically included in all PCRs experiments. PCR products (3 μl aliquot) were resolved on 1.5–3% agarose gel in 1× TAE buffer containing 1 μg/ml ethidium bromide. A molecular weight marker (MWM) was systematically included (1 kb DNA ladder, Gibco BRL, InVitrogen, Cergy-Pontoise, France). Gels were photographed under UV light. PCR products from the most relevant samples were sequenced (Genome Express, Paris, France) then analyzed using BLAST programs.

4.5. Real-time quantitative polymerase chain reaction (Q-PCR) To quantify leptin and Ob-Rs transcripts in OM, 60 ng of OM-derived cDNAs obtained either from control or fooddeprived rats was mixed with 10 μl Power SYBR Green PCR Master Mix (Applied Biosystems, les Ulis, France), 300 nM of each primer complementary to either the gene of interest or β-actin (housekeeping control gene) in 20 μl total volume (see Table 1). The reaction was finally transferred into a 96well optical reaction plate, sealed with appropriate optical caps and ran on the ABI Prism 7900HT (Applied Biosystems)

To test whether OM contained detectable levels of leptin, tissues were homogenized in a cold buffer (100 mM NH4HCO3, 10 mM EGTA, 10 mM EDTA, pH 9.3) containing 1% phenyl methyl sulfonyl fluoride and a cocktail of anti-proteases (Complete, Roche Diagnostics, France) for 1 min in an UltraTurrax homogenizer and kept at 4 °C for 1 h on a rotating wheel. Homogenates were centrifuged at 3000×g for 20 min, and the supernatants were concentrated on Centricon YM-3 (Amicon Millipore Co., Bedford, MA). As a control, white adipose tissue (WAT) was extracted in same conditions. Plasmas were used directly. Mean extraction efficiency, evaluated by adding iodinated leptin in OM extracts, was 70 ± 3% (n = 4). Leptin levels were measured in extracts or plasmas by radioimmunoassay using a standard RIA procedure (Rat leptin RIA kit Linco Research, St. Charles, MO). Sensitivity of the assay was 0.5 ng/ml. Intra- and inter-assay coefficient of variation was 5 and 8% respectively. Displacement of leptin tracer by serial dilutions of OM extract paralleled the standard curve with the free unlabeled recombinant mouse leptin.

4.7. Immunohistochemical (ICC) study at light and electron microscopy level 4.7.1.

Light microscopy

After deep anesthesia (i.p. injection of pentobarbital, Sanofi Synthelabo, France), four rats were transcardially perfused with 300 ml of saline followed by 200 ml of a freshly prepared fixative solution of Zamboni solution for leptin receptors ICC (2% paraformaldehyde, 0.1% picric acid in 0.1 M phosphatebuffered saline (PBS)) or McLean and Nakane fixative for leptin ICC (McLean and Nakane, 1974). Olfactory mucosa (septum and turbinates) was carefully removed as a block and postfixed overnight at 4 °C in the same fixative. Blocks were cryoprotected with saccharose (30%) and cut in a cryostat in horizontal sections (14 μm thick). Sections were kept frozen at −80 °C until use. The different isoforms of the leptin receptor were localized using the M18 antibody raised in goat and diluted 1:100 (Santa Cruz, Tebu, France). This antibody recognized both the long and short forms of the leptin receptor. The peptide was localized using an antibody against leptin raised in rabbit (L 7108, generous gift of Dr. Djiane) (Bonnet et al., 2002). It was used at a 1:1000 dilution. Interspersed with several PBS washes, sections were treated with 10% normal horse or goat serum in 0.25% Triton X-100, PBS for 30 min, then with the primary antibodies in Triton-X100 0.1%–BSA 2% in PBS for 48– 72 h at 4 °C. Labeling was visualized using biotinylated secondary antibodies (goat anti-rabbit, Vectastain Elite Kit;

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –1 41

donkey anti-goat, Jackson, Interchim, Montluçon, France) and streptavidin–FITC (1/1000, Vector, Abcys, Paris, France).

4.7.2.

Electron microscopy images were recorded on Kodak electron microscope films. Microphotographs were scanned and processed with Photoshop 7.0 as described above.

Electron microscopy

To determine the cellular and subcellular localization of the different isoforms of the leptin receptors, as well as the localization of the peptide itself in the OM, an ultrastructural ICC study was undertaken. The short and long forms of the leptin receptor were localized using the M18 antibody, whereas the Ob-Rb isoform was localized using an antibody raised in rabbits and used at a 1/75 dilution (Linco Research, CliniSciences, Montrouge, France). The peptide was localized using the L 7108 antibody used at a 1:1000 dilution. Three rats (1 for Ob-Rs localization, 2 for leptin) were transcardially perfused with 200 ml of saline followed by a freshly prepared fixative solution (4% paraformaldehyde, 0.2% picric acid and 0.125% glutaraldehyde in 0.1 M phosphate buffer, PB). For the localization of Ob-Rb, the fixation protocol of McLean and Nakane slightly modified was applied on one rat. The fixative consisted in a mixture of paraformaldehyde 4%, glutaraldehyde 0.125%, 0.1 M lysine and 0.01 M sodium metaperiodate in PB. After perfusion, the olfactory mucosa from septum and turbinates was peeled off, postfixed for 2 h at 4 °C in the same fixative and washed overnight in PB. The ICC was performed on free-floating fragments of septum and turbinate epithelium using the same procedure as for light microscopy, except that Triton-X100 was omitted. For each ICC, some control fragments were incubated without the primary antibody. The antigens were revealed in 0.05 M sucrose–Tris buffer (pH 7.6) using the DAB method adapted for electron microscopy. The most immunostained fragments were selected, osmicated in a 1% OsO4 solution and dehydrated in a graded series of ethanol with 1% uranyl acetate in 70% alcohol. They were then embedded in Epoxy resin (LX112, Ladd, Inland Europe, Conflans/Lanterne, France). For leptin ICC, one specimen was submitted to a protocol leading to a better preservation: after revelation by the DAB method, the sections were osmicated in a 2% OsO4 solution in PB before to be dehydrated in a graded series of ethanol with 1% p-phenylenediamine (Sigma-Aldrich) in ethanol 70%. The embedding step was as described above. Ultrathin sections (50–100 nm) were collected on copper grids and contrasted with lead citrate. Specimens were observed using either a CM12 electron microscope and classical electron microscope films or a Zeiss 902 electron microscope equipped with a Megaview III camera.

4.8.

139

Image processing

Fluorescence images were acquired on a DMBR Leica epifluorescence microscope equipped with an Olympus DP-50 CCD camera using CellR dedicated software. Confocal images were acquired with a Zeiss LSM 510 microscope equipped with an ion-Argon laser using LSM acquisition and analysis softwares. They were processed using Photoshop 7.0 (Adobe, Asap software, France). Images were adjusted for contrast and brightness to equilibrate light levels. The content of images was not altered in any case. Observations were performed at the confocal and electron microscopy facilities Mima2 of Jouy-en-Josas.

4.9.

Statistical analysis

All quantitative data are presented as the mean ± SEM. Comparison between groups was evaluated using unpaired Student t-test. A value of P < 0.05 or P < 0.01 was considered significant or highly significant.

Acknowledgments We acknowledge the Région Ile-de-France in the framework of a Sésame contract. K.B. is financially supported by the French Agence Nationale de la Recherche (Number 59000033). Authors are also grateful to the UEAR (Jouy-en-Josas) for animal care.

REFERENCES

Ahima, R.S., Bjorbaek, C., Osei, S., Flier, J.S., 1999. Regulation of neuronal and glial proteins by leptin: implications for brain development. Endocrinology 140, 2755–2762. Bado, A., Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J.P., Bortoluzzi, M.N., Moizo, L., Lehy, T., Guerre-Millo, M., Le Marchand-Brustel, Y., Lewin, M.J., 1998. The stomach is a source of leptin. Nature 394, 790–793. Banks, W.A., Kastin, A.J., Huang, W., Jaspan, J.B., Maness, L.M., 1996. Leptin enters the brain by a saturable system independent of insulin. Peptides 17, 305–311. Belouzard, S., Delcroix, D., Rouille, Y., 2004. Low levels of expression of leptin receptor at the cell surface result from constitutive endocytosis and intracellular retention in the biosynthetic pathway. J. Biol. Chem. 279, 28499–28508. Bennett, P.A., Lindell, K., Karlsson, C., Robinson, I.C., Carlsson, L.M., Carlsson, B., 1998. Differential expression and regulation of leptin receptor isoforms in the rat brain: effects of fasting and oestrogen. Neuroendocrinology 67, 29–36. Bjorbaek, C., Kahn, B.B., 2004. Leptin signaling in the central nervous system and the periphery. Recent Prog. Horm. Res. 59, 305–331. Bjorbaek, C., Uotani, S., da Silva, B., Flier, J.S., 1997. Divergent signaling capacities of the long and short isoforms of the leptin receptor. J. Biol. Chem. 272, 32686–32695. Bjorbaek, C., Elmquist, J.K., Michl, P., Ahima, R.S., van Bueren, A., McCall, A.L., Flier, J.S., 1998. Expression of leptin receptor isoforms in rat brain microvessels. Endocrinology 139, 3485–3491. Bohlender, J., Rauh, M., Zenk, J., Groschl, M., 2003. Differential distribution and expression of leptin and the functional leptin receptor in major salivary glands of humans. J. Endocrinol. 178, 217–223. Bonnet, M., Gourdou, I., Leroux, C., Chilliard, Y., Djiane, J., 2002. Leptin expression in the ovine mammary gland: putative sequential involvement of adipose, epithelial, and myoepithelial cells during pregnancy and lactation. J. Anim. Sci. 80, 723–728. Bouret, S.G., Draper, S.J., Simerly, R.B., 2004. Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304, 108–110. Caillol, M., Aioun, J., Baly, C., Persuy, M.A., Salesse, R., 2003.

140

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –14 1

Localization of orexins and their receptors in the rat olfactory system: possible modulation of olfactory perception by a neuropeptide synthetized centrally or locally. Brain Res. 960, 48–61. Charbonneau, C., Bai, F., Richards, B.S., Argyropoulos, G., 2004. Central and peripheral interactions between the agouti-related protein and leptin. Biochem. Biophys. Res. Commun. 319, 518–524. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. De Matteis, R., Puxeddu, R., Riva, A., Cinti, S., 2002. Intralobular ducts of human major salivary glands contain leptin and its receptor. J. Anat. 201, 363–370. Diano, S., Kalra, S.P., Horvath, T.L., 1998. Leptin receptor immunoreactivity is associated with the Golgi apparatus of hypothalamic neurons and glial cells. J. Neuroendocrinol. 10, 647–650. Dicou, E., Attoub, S., Gressens, P., 2001. Neuroprotective effects of leptin in vivo and in vitro. NeuroReport 12, 3947–3951. Dotsch, J., Nusken, K.D., Knerr, I., Kirschbaum, M., Repp, R., Rascher, W., 1999. Leptin and neuropeptide Y gene expression in human placenta: ontogeny and evidence for similarities to hypothalamic regulation. J. Clin. Endocrinol. Metab. 84, 2755–2758. Elmquist, J.K., Bjorbaek, C., Ahima, R.S., Flier, J.S., Saper, C.B., 1998. Distributions of leptin receptor mRNA isoforms in the rat brain. J. Comp. Neurol. 395, 535–547. Feron, F., Vincent, A., Mackay-Sim, A., 1999. Dopamine promotes differentiation of olfactory neuron in vitro. Brain Res. 845, 252–259. Getchell, T.V., Kwong, K., Saunders, C.P., Stromberg, A.J., Getchell, M.L., 2006. Leptin regulates olfactory-mediated behavior in ob/ob mice. Physiol. Behav. 87, 848–856. Guan, X.M., Hess, J.F., Yu, H., Hey, P.J., van der Ploeg, L.H., 1997. Differential expression of mRNA for leptin receptor isoforms in the rat brain. Mol. Cell. Endocrinol. 133, 1–7. Hegg, C.C., Lucero, M.T., 2004. Dopamine reduces odor- and elevated-K(+)-induced calcium responses in mouse olfactory receptor neurons in situ. J. Neurophysiol. 91, 1492–1499. Hegg, C.C., Au, E., Roskams, A.J., Lucero, M.T., 2003a. PACAP is present in the olfactory system and evokes calcium transients in olfactory receptor neurons. J. Neurophysiol. 90, 2711–2719. Hegg, C.C., Greenwood, D., Huang, W., Han, P., Lucero, M.T., 2003b. Activation of purinergic receptor subtypes modulates odor sensitivity. J. Neurosci. 23, 8291–8301. Hileman, S.M., Tornoe, J., Flier, J.S., Bjorbaek, C., 2000. Transcellular transport of leptin by the short leptin receptor isoform ObRa in Madin-Darby Canine Kidney cells. Endocrinology 141, 1955–1961. Hileman, S.M., Pierroz, D.D., Masuzaki, H., Bjorbaek, C., El-Haschimi, K., Banks, W.A., Flier, J.S., 2002. Characterization of short isoforms of the leptin receptor in rat cerebral microvessels and of brain uptake of leptin in mouse models of obesity. Endocrinology 143, 775–783. Karlsson, A.C., Lindroos, A.K., Lissner, L., Torgerson, J.S., Carlsson, B., Carlsson, L.M., Sjostrom, L., 2002. Evidence for gender-specific associations between leptin and olfaction. J. Gend.-Specif. Med. 5, 25–32. Kawai, K., Sugimoto, K., Nakashima, K., Miura, H., Ninomiya, Y., 2000. Leptin as a modulator of sweet taste sensitivities in mice. Proc. Natl. Acad. Sci. U. S. A. 97, 11044–11049. Lee, Y.J., Park, J.H., Ju, S.K., You, K.H., Ko, J.S., Kim, H.M., 2002. Leptin receptor isoform expression in rat osteoblasts and their functional analysis. FEBS Lett. 528, 43–47. Mackay-Sim, A., Chuah, M.I., 2000. Neurotrophic factors in the primary olfactory pathway. Prog. Neurobiol. 62, 527–559. McAlister, E.D., Van Vugt, D.A., 2004. Effect of leptin administration versus re-feeding on hypothalamic

neuropeptide gene expression in fasted male rats. Can. J. Physiol. Pharmacol. 82, 1128–1134. McCurdy, R.D., Feron, F., McGrath, J.J., Mackay-Sim, A., 2005. Regulation of adult olfactory neurogenesis by insulin-like growth factor-I. Eur. J. Neurosci. 22, 1581–1588. McLean, I.W., Nakane, P.K., 1974. Periodate–lysine– paraformaldehyde fixative. A new fixation for immunoelectron microscopy. J. Histochem. Cytochem. 22, 1077–1083. Mombaerts, P., 2001. How smell develops. Nat. Neurosci. 4, 1192–1198 (Suppl.). Moon, C., Yoo, J.Y., Matarazzo, V., Sung, Y.K., Kim, E.J., Ronnett, G.V., 2002. Leukemia inhibitory factor inhibits neuronal terminal differentiation through STAT3 activation. Proc. Natl. Acad. Sci. U. S. A. 99, 9015–9020. Morash, B., Li, A., Murphy, P.R., Wilkinson, M., Ur, E., 1999. Leptin gene expression in the brain and pituitary gland. Endocrinology 140, 5995–5998. O'Doherty, J., Rolls, E.T., Francis, S., Bowtell, R., McGlone, F., Kobal, G., Renner, B., Ahne, G., 2000. Sensory-specific satiety-related olfactory activation of the human orbitofrontal cortex. NeuroReport 11, 893–897. Ortiga-Carvalho, T.M., Oliveira, K.J., Soares, B.A., Pazos-Moura, C.C., 2002. The role of leptin in the regulation of TSH secretion in the fed state: in vivo and in vitro studies. J. Endocrinol. 174, 121–125. Pager, J., 1978. Ascending olfactory information and centrifugal influxes contributing to a nutritional modulation of the rat mitral cell responses. Brain Res. 140, 251–269. Pes, D., Mameli, M., Andreini, I., Krieger, J., Weber, M., Breer, H., Pelosi, P., 1998. Cloning and expression of odorant-binding proteins Ia and Ib from mouse nasal tissue. Gene 212, 49–55. Peters, J.H., Karpiel, A.B., Ritter, R.C., Simasko, S.M., 2004. Cooperative activation of cultured vagal afferent neurons by leptin and cholecystokinin. Endocrinology 145, 3652–3657. Plaisancie, P., Ducroc, R., El Homsi, M., Tsocas, A., Guilmeau, S., Zoghbi, S., Thibaudeau, O., Bado, A., 2006. Luminal leptin activates mucin-secreting goblet cells in the large bowel. Am. J. Physiol.: Gastrointest. Liver Physiol. 290, G805–G812. Russo, V.C., Metaxas, S., Kobayashi, K., Harris, M., Werther, G.A., 2004. Anti-apoptotic effects of leptin in human neuroblastoma cells. Endocrinology 145, 4103–4112. Sahu, A., 2003. Leptin signaling in the hypothalamus: emphasis on energy homeostasis and leptin resistance. Front. Neuroendocrinol. 24, 225–253. Sahu, A., 2004. Minireview: a hypothalamic role in energy balance with special emphasis on leptin. Endocrinology 145, 2613–2620. Schulz, C., Paulus, K., Lehnert, H., 2004. Central nervous and metabolic effects of intranasally applied leptin. Endocrinology 145, 2696–2701. Schwartz, G.J., Moran, T.H., 2002. Leptin and neuropeptide y have opposing modulatory effects on nucleus of the solitary tract neurophysiological responses to gastric loads: implications for the control of food intake. Endocrinology 143, 3779–3784. Schwob, J.E., 2002. Neural regeneration and the peripheral olfactory system. Anat. Rec. 269, 33–49. Shanley, L.J., O'Malley, D., Irving, A.J., Ashford, M.L., Harvey, J., 2002. Leptin inhibits epileptiform-like activity in rat hippocampal neurones via PI 3-kinase-driven activation of BK channels. J. Physiol. 545, 933–944. Shigemura, N., Ohta, R., Kusakabe, Y., Miura, H., Hino, A., Koyano, K., Nakashima, K., Ninomiya, Y., 2004. Leptin modulates behavioral responses to sweet substances by influencing peripheral taste structures. Endocrinology 145, 839–847. Siegrist-Kaiser, C.A., Pauli, V., Juge-Aubry, C.E., Boss, O., Pernin, A., Chin, W.W., Cusin, I., Rohner-Jeanrenaud, F., Burger, A.G., Zapf, J., Meier, C.A., 1997. Direct effects of leptin on brown and white adipose tissue. J. Clin. Invest. 100, 2858–2864. Smith, J.T., Waddell, B.J., 2002. Leptin receptor expression in the

BR AI N R ES E ARC H 1 1 2 9 ( 2 00 7 ) 1 3 0 –1 41

rat placenta: changes in ob-ra, ob-rb, and ob-re with gestational age and suppression by glucocorticoids. Biol. Reprod. 67, 1204–1210. Smith, J.T., Waddell, B.J., 2003. Developmental changes in plasma leptin and hypothalamic leptin receptor expression in the rat: peripubertal changes and the emergence of sex differences. J. Endocrinol. 176, 313–319.

141

Steppan, C.M., Swick, A.G., 1999. A role for leptin in brain development. Biochem. Biophys. Res. Commun. 256, 600–602. Sweeney, G., 2002. Leptin signalling. Cell Signal. 14, 655–663. Tartaglia, L.A., Dembski, M., Weng, X., Deng, N., Culpepper, J., Devos, R., Richards, G.J., Campfield, L.A., Clark, F.T., Deeds, J., et al., 1995. Identification and expression cloning of a leptin receptor, OB-R. Cell 83, 1263–1271.