- Email: [email protected]
β-catenin signaling pathway
Biochemical and Biophysical Research Communications 519 (2019) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
LGR6 promotes osteogenesis by activating the Wnt/b-catenin signaling pathway Sheng-Li Liu a, 1, Yan-Man Zhou b, 1, Da-Bin Tang a, Neng Zhou a, Wei-Wei Zheng a, Zhong-Hua Tang a, Cai-Wen Duan a, Liang Zheng a, **, Jing Chen a, * a Key Laboratory of Pediatric Hematology and Oncology Ministry of Health and Pediatric Translational Medicine Institute, Department of Hematology and Oncology, Shanghai Children's Medical Center, Shanghai Collaborative Innovation Center for Translational Medicine and Department of Pharmacology and Chemical Biology, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai, 200025, China b Department of Endocrinology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai, 200025, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 July 2019 Accepted 23 August 2019 Available online 6 September 2019
Leucine-rich repeat containing G-protein-coupled receptor 6 (LGR6) is a member of the rhodopsin-like 7transmembrane domain receptor superfamily and has high homology to LGR4 and LGR5. LGR6 is highly expressed in osteoblastic progenitors, and LGR6-deficient mice show nail and bone regeneration defect. However, the effect of LGR6 on the osteogenic differentiation of osteoblastic progenitors and its underlying mechanisms are largely unknown. In this study, we overexpressed and knockdown LGR6 with lentivirus in the preosteoblastic cell MC3T3-E1 to observe the effect of LGR6 on osteogenic differentiation and explore its possible molecular mechanism. LGR6 overexpression promoted osteogenic differentiation and mineralization by stabilizing b-catenin to potentiate the Wnt/b-catenin signaling pathway in MC3T3-E1 cells. Conversely, LGR6 knockdown inhibited osteogenic differentiation and mineralization by enhancing b-catenin degradation to inactivate the Wnt/b-catenin signaling pathway. These results reveal that LGR6 is highly expressed in osteoblastic progenitors, and promotes osteogenesis by enhancing bcatenin stability to strengthen the Wnt signaling pathway. This study provides an important reference into the exact mechanisms of osteogenic differentiation. © 2019 Published by Elsevier Inc.
Keywords: LGR6 Osteoblast Osteogenesis b-catenin Osteoporosis
1. Introduction Skeletal remodeling is a physiological process involving osteoblast-regulated bone formation and osteoclast-regulated bone resorption, and bone homeostasis is typically orchestrated coordinately by these two phenomena [1]. Disruption of bone homeostasis contributes to bone disease, especially osteoporosis (OP), a metabolic bone disease that poses a considerable threat to human health [2]. The incidence of OP to the aging people, particularly for postmenopausal group, are expected to continuously increase [3]. Two key strategies for the current treatment of OP are promotion of bone formation or inhibition of bone resorption [4]. However, antiresorptive drugs only alleviate the development of bone loss in OP
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (L. Zheng), [email protected] (J. Chen). 1 Sheng-Li Liu and Yan-Man Zhou contribute equally to this work. https://doi.org/10.1016/j.bbrc.2019.08.122 0006-291X/© 2019 Published by Elsevier Inc.
rather than increase the bone mass, and drugs that promote bone formation, which is mainly regulated and determined by osteoblasts, are rarely developed. Therefore, a deep understanding of the potential and exact mechanisms in osteoblastic differentiation may provide an opportunity to establish therapeutic strategies for OP. Leucine-rich repeat containing G-protein-coupled receptor 6 (LGR6) belongs to the leucine-rich repeat containing subgroup of the G-protein-coupled 7-transmembrane protein superfamily [5]. LGR6 is a recently discovered molecule acting as a marker of stem cells in taste buds, lung, and skin [6e8], and participates in multiple pathological and physiological processes [9e12]. For instance, LGR6 promotes wound healing, angiogenesis, and nascent hair follicle development in damaged epithelial tissues [9]. LGR6þ mesenchymal cells may also be a specific target for airway disease [10]. A recent study reported that LGR6 could be a contributor to digit tip regeneration, and bone reconstruction defects are observed in LGR6-deficient mice [12]. Thus, this molecule has a key role in bone metabolism. Furthermore, LGR6 protein expression was detected in mesenchymal stem cells (MSCs) that give rise to osteoblasts [13],
2
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
and this molecule was identified as a novel marker of osteoprogenitor cells in bone marrow [14]. However, the effect of LGR6 on the osteogenic differentiation of osteoblastic progenitors and its underlying mechanisms are largely unknown. The Wnt signaling pathway is a key regulator of developmental processes and postnatal health and disease [15e18], and its major branch is the canonical Wnt/b-catenin pathway. In essence, this signaling is initiated by the binding of Wnt ligands to the dual receptor complex comprising frizzled (Fzd) and either LRP5 or LRP6. Thus, the multiprotein b-catenin “destruction complex” is inactivated to prevent b-catenin phosphorylation and its proteasomal degradation. b-catenin subsequently accumulates in the cytoplasm and translocates into the nucleus where it associates with transcription factors to regulate target gene transcription [19]. Numerous studies highlighted the importance of the canonical Wnt signaling in regulating bone homeostasis [20e22], the activation of this pathway leads to increased bone mass and strength of the osteoblast-mediated bone formation [23e25]. Therefore, the canonical Wnt signaling is essential for osteoblast proliferation and differentiation. However, whether LGR6 promotes osteogenic differentiation via the activation of the Wnt/b-catenin signaling pathway remains unclear. In this study, we evaluated the effect and potential mechanisms of LGR6 on osteoblastic differentiation in MC3T3-E1 cells.
sequences: CCGAATCCT GGAGCTGTCTCATAAT, shRNA2 sequences: top strand: GATCCGCCGAATCCTG GAGCTGTCTCATAATTTCAAGAGAATTATGAGACAGCTCCAGGATTCGGTTTTTTG, bottom strand: AATTCAAAAAACCGAATCCTG GAGCTGTCTCATAATTC TCTTGAAATTATGAGACAGCTCCAGGATTCGGCG. SiRNA3 sequences: GACC TATGGTCAGTTCGCTGAGTAT, shRNA3 sequences: top strand: GATCCGACCTAT GGTCAGTTCGCTGAGTATTTCAAGAGAATAC, bottom strand: AATTCAAA AAAGACCTATGGTCAGTTCGCTGAGTATTCTCTTG AAATACTCAGCGAACT GACCATAGGTCG. A negative shRNA (TTCTCCGAACGTGTCACGTAA), which has no complementary sequences in the murine genome, was used as the control. MC3T3-E1 cells were plated in a 6-well plate (1 104 cells/cm2) and cultured in complete growth medium. On the next day, transfection experiments were performed using the experimental lentivirus or negative control lentivirus at the MOI of 20 in 1 ml of transfection medium containing 6 mg/ml polybrene, and the culture medium was added up to 2 ml after 4 h. The medium was discarded and replaced by a fresh complete medium after 24 h of transfection. The efficiency of infection was assessed on the basis of the fluorescence intensity of green fluorescent protein (GFP)-positive cells, and the knockdown efficiency of LGR6 gene was verified via real-time PCR and Western blot analysis (WB). The stable transfected cells were obtained after treatment with 2 mg/ml puromycin (Yeasen Biotech) for 14 days.
2. Materials and methods 2.1. MC3T3-E1 culture and osteogenic induction Murine osteoblastic MC3T3-E1 cells (American Type Culture Collection, ATCC CRL-2594) were incubated at 37 C and 5% CO2 in a-MEM medium (GIBCO BRL) supplemented with 10% fetal bovine serum (FBS, GIBCO BRL) and 1% antibiotic (streptomycin and penicillin, GIBCO BRL). The culture medium was replaced every 2 days. Upon cell growth up to 80% confluence, the media were replaced by an osteogenic medium containing 10 mmoL/l b-glycerophosphate disodium salt hydrate (Sigma-Aldrich) and 50 mmoL/l L-ascorbic acid (Sigma-Aldrich) for osteogenic induction. 2.2. Extraction and culture of bone marrow MSCs The bones of 6e8 week-old mice were crushed and placed into the digestive juice (1 mg/ml type IV collagenase, 2 mg/ml dispase II, and 1% BSA in PBS) and shaken on a shaker with 140e220 rpm at 37 C for 1 h. Digestion was terminated by PBS, and the erythrocytes were lysed by ACK buffer at room temperature for 5 min. The supernatant was discarded, and the remaining cells were resuspended in a-MEM containing 10% FBS and 1% antibiotics and cultured in 10 cm culture flasks at 37 C of 5% CO2. After 24 h, the culture was washed with PBS to remove non-adherent cells. The cells were passaged at 80% confluence and at passage 3 were used for the experiments. 2.3. Lentiviral transfection of MC3T3-E1 cell and stable strain screening The lentivirus-based LGR6 overexpression-GFP-PURO and shRNA-GFP-PURO were purchased from Shanghai Hanbio Biotechnology Co., Ltd. (Shanghai, China). The sequences of murine LGR6, which is the target of short hairpin RNA, were listed as follows: siRNA1 sequences: TGGAGACACTAGACCTG AACTATAA, shRNA1 sequences: top strand: GATCCGTGGAGACACTAGACC TGAACTATAATTCAAGAGATTATAGTTCAGGTCTAGTGTCTCCATTTTT TG, bottom strand: AATTCAAAAAATGGAGACACTAGACCTGAACTATAATCTCTT GAATTATAGTTCAGGTCTAGTGTCTCCACG. SiRNA2
2.4. Western blot (WB) analysis MC3T3-E1 cells were plated in a 6-well plate at 1 104 cells/ cm . Total cellular protein and nuclear/plasma protein were collected at 7 or 14 days after osteogenic induction. Nuclear and cytoplasmic protein extractions were conducted by using a nuclear protein extraction kit (ComWin Biotech Co. Ltd.). Protein concentration was determined using a Pierce BCA protein assay kit (Thermo Fisher Scientific). WB was performed via a conventional method, and the antibodies involved in this experiment include LGR6 (1:200, Santa Cruz Biotechnology), RUNX2 (1:1000, CST), OSX (1:1000, CST), b-catenin (1:1000, CST), p-b-catenin (1:1000, CST), GAPDH (1:5000, CST), and HistoneH3 (1:5000, CST). Images were acquired by using a chemiluminescent detection kit (Merck Millipore). 2
2.5. Quantitative real-time PCR (qRT-PCR) analysis MC3T3-E1 cells were plated in a 12-well plate at 1 104 cells/ cm . Total cellular RNA was isolated using a TRIzol reagent (SigmaAldrich) and collected at 7 or 14 days after osteogenic induction. Reverse transcription and Real-time PCR were performed using a GoScript™ Reverse Transcription System (Takara) and Maxima SYBR Green qPCR Master Mix (2 ) kit (Takara), respectively. The PCR primers were designed as follows: alkaline phosphatase (ALP): forward (F): 50 -TGATCACTCCCACGTTTTCA-30 and reverse (R): 50 GCTGTGAAGGGCTTCTTGTC-30 ; collagenI1 (Cola1): F: 50 -TCCTGCC GATGTCGCTATC-30 and R: 50 -CAAGTTCCGGTGTGACTCGT-30 ; osteocalcin (OCN): F: 50 -CAGGAGGGCAGTAAGGTGG-30 and R: 50 CAGGGGATCTGGGTAGGG-30 ; RUNX2: F: 50 -GCACCGACAGCCCC AACTT-30 and R: 50 -CCACGGGCAGGGTCTTGTT-30 ; OSX: F: 50 GATGGCGTCCTCTCTGCTT-30 and R: 50 -TATGGCTTCTTTGTGCCTCC30 ; b-catenin: F: 50 -ACGCTGCTCATCCCACTAAT-30 and R: 50 AGTTCCGCGTCATCCTGATA-30 ; LGR6: F: 50 -GAGGACGGCAT0 0 CATGCTGTC-3 and R: 5 -GCTCCGTGAGGTTGTTCATACT-30 ; and bactin: F: 50 -GGCTGTATTCCCCTCCATCG-30 and R: 50 -CCAGTTGGTAACAATGCCATGT-30 . 2
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
2.6. Immunofluorescence (IF) MC3T3-E1 and MSCs were cultured into a 24-well plate containing cell slide (1 104 cells/cm2) for 2 days and fixed with 4% paraformaldehyde. The slides were subsequently incubated with primary antibody against LGR6 (1:50, Santa Cruz Biotechnology) overnight at 4 C. On the next day, the cells were incubated with Alexa Fluor 488 secondary antibody (1:200, CST) for 90 min at room temperature, stained with DAPI (1:1000, Beyotime), and mounted with sealing liquid (Beyotime). Images were acquired using a Leica SP8 confocal microscope.
3
culture medium and cell lysate were measured using an ALP assay kit (Nanjing Jiancheng Bioengineering Institute) following the manufacturer's protocols. The protein concentration of the cell homogenate was determined using the BCA assay. Finally, the ALP activity of the cell lysate was normalized to the total cellular protein content. For ALP staining, MC3T3-E1 cells were fixed with 4% paraformaldehyde for 15 min after 7 days of osteoclastic induction. ALP staining was performed using a ALP staining Kit (Beyotime) following the manufacturer's instructions. The cells were washed three times with PBS and observed under a light microscope (Leica).
2.7. ALP activity and ALP staining assay 2.8. Alizarin red staining For ALP activity assay, MC3T3-E1 cells were cultured into a 96well plate with osteogenic medium for 7 days at 37 C of 5% CO2. Then the medium was collected, and 50 ml of RIPA buffer was added into each well to lyse the cells on ice for 30 min. The ALP activity of
After 14 days of osteoclastic induction, MC3T3-E1 cells were fixed with 95% ethanol for 10 min. The mineralized nodules of late osteogenic differentiation were stained with 0.1% alizarin red and
Fig. 1. LGR6 expression was increased during osteogenic differentiation and mineralization in MC3T3-E1 A. mRNA level of LGR6 in MC3T3-E1 by using MSC as a positive control. B. IF analysis of LGR6 protein level in MC3T3-E1 (630 ). CeF. mRNA levels of osteoblast differentiation markers ALP, Cola1, OCN, OSX, and RUNX2 after induced for 7 or 14 days in MC3T3-E1. G. ALP staining after induction for 7 days. H. Alizarin red staining after induction for 14 days. I and J. mRNA and protein level of LGR6 after induced for 7 or 14 days. Data were presented as the mean ± SD, and at least three independent experiments were conducted. **P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
4
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
washed three times with ddH2O. Images were acquired under a light microscope.
3. Results 3.1. LGR6 expression is increased during osteogenic differentiation and mineralization in MC3T3-E1
2.9. Statistical analysis Data are presented as the mean ± SD of at least three separate experiments. Statistical differences between two groups were determined by Student's t-test, and one-way ANOVA was used when more than two groups were compared. P < 0.05 was considered significant.
To determine the role of LGR6 in the osteogenic differentiation of osteoblastic progenitors, we detected its expression level in the preosteoblast cell line MC3T3-E1 via qRT-PCR and IF. As shown in Fig. 1A and B, LGR6 had a relatively lower expression in MC3T3-E1 than in bone marrow MSCs. Osteogenic differentiation was then induced by culturing with conditional medium for 7 or 14 days. The
Fig. 2. LGR6 promotes the osteogenic differentiation and mineralization of MC3T3-E1 A. IF images showed GFPþ cells transfected by lentiviruses after 72 h (100 ). B and C. qRT-PCR and WB confirmed the successful overexpression of LGR6 in stable LGR6 overexpressing cell line compared to control. D. mRNA levels of ALP, Cola1, OCN were determined after induced for 7 days. E and F. Extracellular and intracellular ALP activity after induction for 7 days. G. ALP staining after induction for 7 days. H. Alizarin red staining after 14 days of induction. I and J. mRNA and protein levels of OSX and RUNX2 after induced for 7 days. **P < 0.01 vs. Lv-con, ##P < 0.01 vs. Lv-con þ AAþb-GP. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
expression levels of osteoblast differentiation markers ALP, Cola1, OCN, OSX, and RUNX2 were determined via qRT-PCR, and the results showed that their mRNA expression levels were significantly increased after induction for 7 and 14 days (Fig. 1CeF). Furthermore, osteoblastic differentiation was also identified via ALP staining (indicator of early osteogenic differentiation) after induction for 7 days and alizarin red staining (indicator of late osteogenic differentiation) after induction for 14 days (Fig. 1G and H). Successful osteogenic differentiation was observed. The mRNA and protein expression levels of LGR6 were dramatically upregulated during osteoblast differentiation (Fig. 1I and J), indicating that LGR6 might exert an important function in regulating osteogenic differentiation in MC3T3-E1. 3.2. LGR6 promotes the osteogenic differentiation and mineralization of MC3T3-E1 To investigate the effect of LGR6 on the regulation of osteogenic differentiation in MC3T3-E1, we overexpressed LGR6 via transfection with a LGR6 lentivirus (Fig. 2A). The successful overexpression of LGR6 in MC3T3-E1 was confirmed by qRT-PCR and WB (Fig. 2B and C), and the stable LGR6 overexpressed cell line was used in subsequent experiments. After osteogenic induction for 7 or 14 days, the detection of osteogenic gene expression, ALP staining, and alizarin red staining in MC3T3-E1 were performed. We found that the LGR6 overexpression remarkably increased the expression level of osteogenic differentiation markers ALP, Cola1, and OCN (Fig. 2D) after 7 days of induction. Meanwhile, ALP staining and activity after 7 days of induction showed that the LGR6 overexpression enhanced the early osteoblastic differentiation of MC3T3-E1 cells (Fig. 2EeG). Alizarin red staining after 14 days of induction revealed that the LGR6 overexpression accelerated the mineralization of differentiated cells (Fig. 2H). Moreover, OSX and RUNX2, which are key transcription factors that mediate osteoblast differentiation, were also noticeably upregulated in the LGR6 overexpression group than in the control (Fig. 2I and J). These results showed that LGR6 overexpression promotes osteogenic differentiation and mineralization. 3.3. LGR6 activates the Wnt signaling pathway by stabilizing bcatenin Upon the activation of the Wnt signaling pathway, the dephosphorylation level of b-catenin is increased to prevent bcatenin degradation, hence, the amount of b-catenin that enters the nucleus is increased, and the expression level of the osteogenicpromoting gene is regulated [15]. To determine whether LGR6 promotes the osteogenic differentiation of osteoblastic progenitors by triggering the Wnt/b-catenin signaling pathway, we measured
5
the total and phosphorylation levels of b-catenin via WB. LGR6 overexpression substantially increased the b-catenin level in the total cells (Fig. 3A), and the phosphorylation level of b-catenin in the cytoplasm was evidently decreased (Fig. 3B). Meanwhile, the bcatenin content in the nucleus was considerably elevated (Fig. 3C) compared with that of the control. However, we found no evidence that LGR6 overexpression improved the mRNA level of b-catenin (Fig. 3D), suggesting that LGR6 overexpression increases b-catenin stabilization to potentiate the Wnt signaling pathway.
3.4. LGR6 knockdown inhibits osteogenic differentiation and mineralization via degrading b-catenin and suppressing the Wnt signaling pathway To further determine whether LGR6 promotes osteogenic differentiation in MC3T3-E1 via activating the Wnt/b-catenin signaling pathway, we transfected MC3T3-E1 with three lentiviruses that carry three different interference sequences (Fig. 4A). We screened the stability of LGR6 knockdown cell lines. Among them, the stable cell line transfected with interference sequence 3 had the highest knockdown efficiency at the mRNA and protein levels (Fig. 4B and C) and thus was selected for subsequent experiments. After osteogenic induction for 7 or 14 days, we performed osteogenic gene expression, ALP staining, ALP activity, and alizarin red staining in MC3T3-E1. We found that the osteogenic differentiation markers (ALP, Cola1, and OCN) (Fig. 4D) and osteogenic differentiation transcription factors (OSX and RUNX2) (Fig. 4E and F) were downregulated in LGR6 knockdown cells compared with those in the control after 7 days of induction. Meanwhile, the ALP staining, ALP activity, and the mineralization of differentiated cells were reduced in LGR6 knockdown cells compared with those in the control (Fig. 4GeJ). These results revealed that LGR6 knockdown inhibits osteogenic differentiation, and LGR6 is indispensable for osteogenesis. To investigate whether the enhanced Wnt signaling pathway via LGR6 overexpression is eliminated by knocking down LGR6, we determined the b-catenin level of differentiated cells via WB. The results showed that the b-catenin protein level in total cells remarkably decreased (Fig. 4K), and the phosphorylation level of bcatenin in the cytoplasm remarkably increased (Fig. 4L). Meanwhile, the amount of b-catenin in the nucleus was lower in LGR6 knockdown cells than in the control (Fig. 4M), and LGR6 knockdown did not reduce the mRNA level of b-catenin (Fig. 4N). Thus, LGR6 knockdown promotes b-catenin degradation to suppress the Wnt/b-catenin signaling pathway, and LGR6 is essential for maintaining the Wnt/b-catenin signaling pathway.
Fig. 3. LGR6 activates the Wnt signaling pathway by stabilizing b-catenin A. WB analysis of b-catenin protein level in the total cells of lysates after induction for 7 days. B. WB analysis of b-catenin and p-b-catenin protein level in the cytoplasm. C. WB analysis of b-catenin protein level in the nucleus. D. mRNA level of b-catenin after induction for 7 days.
6
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
Fig. 4. LGR6 knockdown inhibits osteogenic differentiation and mineralization via degrading b-catenin and suppressing the Wnt signaling pathway A. IF images showed GFPþ cells transfected by lentiviruses after 72 h (100 ). B and C. The cell transfected with interference sequence 3 had the highest knockdown efficiency at the mRNA and protein levels. D. mRNA levels of ALP, Cola1, OCN after induced for 7 days. E and F. mRNA and protein levels of OSX and RUNX2 after induced for 7 days. G. ALP staining after induction for 7 days. H and I. Extracellular and intracellular ALP activity after induction for 7 days. J. Alizarin red staining after 14 days of induction. K. WB analysis of b-catenin protein level in the total cells of lysates after induction for 7 days. L. WB analysis of b-catenin and p-b-catenin protein level in the cytoplasm. M. WB analysis of b-catenin protein level in the nucleus. N. mRNA level of b-catenin after induction for 7 days. **P < 0.01 vs. Lv-con, ##P < 0.01 vs. Lv-con þ AAþb-GP. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
4. Discussion LGR6 is a stem cell marker in numerous organs, such as skin, taste buds, and lungs [6e8]. Jessica found that LGR6-expressing stem cells contribute to the osteoblastic lineage in the regenerating mouse digit tip bone, and LGR6 is genetically essential for bone regeneration following amputation [12]. Thus, this molecule might have a key role in regulating osteogenic differentiation. In our study, we found that LGR6 was expressed in preosteoblast cell line
MC3T3-E1 by using MSC as a positive control, and this finding is consistent with the LGR6 expression detected in the osteoblastic progenitors of mice [14]. We found that the LGR6 expression significantly increased during osteoblast differentiation and mineralization, suggesting that LGR6 may play a crucial role in these processes. LGR6 belongs to the leucine-rich repeat containing subgroup of the G-protein-coupled 7-transmembrane protein superfamily, which is categorized into type B of LGR protein family, including the
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
other two members, namely LGR4 and LGR5 [5]. LGR4 participates in bone remodeling, including bone formation and bone resorption. LGR4 competes with RANK to bind RANKL, and suppresses the canonical RANK signaling during osteoclast differentiation [26]. LGR4 also acts as receptor for RSPO2 or RSPO3 to promote osteoblast differentiation and maturation [27,28]. Given its homology with LGR4, LGR6 may have a key role in osteogenesis. In this study, we found that LGR6 overexpression in MC3T3-E1 accelerated osteoblastic differentiation as confirmed by the expression of early differentiation markers and late differentiation markers, this function is similar to that of LGR4 in osteoblasts [27]. Deletion of LGR6 in MC3T3-E1 leads to impaired osteogenesis, and this finding coincides with the blockade of LGR4 in the mouse model [29]. Collectively, LGR6 positively regulates osteogenesis during osteoblastic differentiation. LGR4 and LGR5 function as receptors of the R-spondin family to potentiate Wnt/b-catenin signaling [30,31]. The Wnt/b-catenin signaling pathway has a critical role in regulating bone metabolism [20e25]. Mice lacking b-catenin in osteoblasts postnatally exhibit decreased bone mass [24]. LGR6 could rescue the effect of Rspondins on the Wnt/b-catenin signaling in HEK293T cells when endogenously expressed LGR4 was inhibited [26], suggesting that LGR6 compensates for the loss function of LGR4. We found that LGR6 overexpression did not alter the transcriptional level of bcatenin but significantly elevated the protein level of b-catenin in total cell. In addition, LGR6 overexpression remarkably reduced the b-catenin phosphorylation level in the cytoplasm, decreased the degradation of b-catenin and then increased the b-catenin protein level in the nucleus. These results suggested that LGR6 overexpression activates the Wnt/b-catenin signaling pathway by increasing the cytoplasmic stabilization and nuclear accumulation of b-catenin to trigger the expression of osteoblast differentiation target genes. When LGR6 was deleted with a lentivirus, the Wnt/bcatenin signaling pathway was suppressed in MC3T3-E1, suggesting that LGR6 is essential for maintaining the Wnt/b-catenin signaling pathway. Therefore, LGR6 exerts an indispensable positive role in osteogenesis regulation by potentiating the Wnt/bcatenin signaling pathways. Through LGR6 overexpression and ablation in MC3T3-E1, we revealed that LGR6 promotes osteogenic differentiation, suggesting that LGR6 exerts an indispensable role in controlling osteogenic differentiation. We also found that LGR6 enhances the Wnt/b-catenin signaling pathway by stabilizing b-catenin in cytoplasm during osteogenesis. Our discovery unravels the cellular bases of the regulation and function of LGR6 in osteoblasts and provides an important reference into the exact mechanisms of osteogenic differentiation. Thus, targeting of the LGR6/Wnt/b-catenin signaling pathway may serve as a therapeutic strategy for OP. Acknowledgements This work is supported by the National Key R&D Program of China, Stem Cell and Translation Research (No. 2016YFA0102000), and the National Natural Science Foundation of China (No. 81570121; 81870082; 81970114), and the Science and Technology Commission of Pudong District, Shanghai Municipality (No. PKJ2015-Y04), and Innovation Program of Shanghai Municipal Education Commission (No. 15ZZ052), and the Hospital-Public CrossLink Project of Shanghai Jiao Tong University (No. YG2017MS31). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.08.122.
7
References [1] M. Jiang, T. Wang, X. Yan, et al., A novel rhein derivative modulates bone formation and resorption and ameliorates estrogen-dependent bone loss, J. Bone Miner. Res. 34 (2019) 361e374. [2] E. Hernlund, A. Svedbom, M. Ivergard, et al., Osteoporosis in the European Union: medical management, epidemiology and economic burden. A report prepared in collaboration with the international osteoporosis foundation (iof) and the european federation of pharmaceutical industry associations (efpia), Arch. Osteoporos. 8 (2013) 136. [3] T.D. Rachner, S. Khosla, L.C. Hofbauer, Osteoporosis: now and the future, Lancet 377 (2011) 1276e1287. [4] D.M. Black, C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N. Engl. J. Med. 374 (2016) 254e262. [5] S.Y. Hsu, M. Kudo, T. Chen, et al., The three subfamilies of leucine-rich repeatcontaining G protein-coupled receptors (lgr): identification of Lgr6 and Lgr7 and the signaling mechanism for Lgr7, Mol. Endocrinol. 14 (2000) 1257e1271. [6] N. Barker, H. Clevers, Leucine-rich repeat-containing G-protein-coupled receptors as markers of adult stem cells, Gastroenterology 138 (2010) 1681e1696. [7] H.J. Snippert, A. Haegebarth, M. Kasper, et al., Lgr6 marks stem cells in the hair follicle that generate all cell lineages of the skin, Science 327 (2010) 1385e1389. [8] F. Oeztuerk-Winder, A. Guinot, A. Ochalek, et al., Regulation of human lung alveolar multipotent cells by a novel P38alpha mapk/mir-17-92 Axis, EMBO J. 31 (2012) 3431e3441. [9] D.M. Lough, N. Wetter, C. Madsen, et al., Transplantation of an Lgr6þ epithelial stem cell-enriched scaffold for repair of full-thickness soft-tissue defects: the in vitro development of polarized hair-bearing skin, Plast. Reconstr. Surg. 137 (2016) 495e507. [10] J.H. Lee, T. Tammela, M. Hofree, et al., Anatomically and functionally distinct lung mesenchymal populations marked by Lgr5 and Lgr6, Cell 170 (2017) 1149e1163, e12. [11] X. Gong, K.S. Carmon, Q. Lin, et al., Lgr6 is a high affinity receptor of R-spondins and potentially functions as a tumor suppressor, PLoS One 7 (2012), e37137. [12] J.A. Lehoczky, C.J. Tabin, Lgr6 marks nail stem cells and is required for digit tip regeneration, Proc. Natl. Acad. Sci. U. S. A. 112 (2015) 13249e13254. [13] Y. Cui, R. Huang, Y. Wang, et al., Down-regulation of Lgr6 promotes bone fracture recovery using bone marrow stromal cells, Biomed. Pharmacother. 99 (2018) 629e637. [14] V. Khedgikar, J.A. Lehoczky, Evidence for Lgr6 as a novel marker of osteoblastic progenitors in mice, JBMR Plus 3 (2019), e10075. [15] C. Nusslein-Volhard, E. Wieschaus, Mutations affecting segment number and polarity in Drosophila, Nature 287 (1980) 795e801. [16] C.V. Cabrera, M.C. Alonso, P. Johnston, et al., Phenocopies induced with antisense rna identify the wingless gene, Cell 50 (1987) 659e663. [17] R. Nusse, H.E. Varmus, Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome, Cell 31 (1982) 99e109. [18] K.W. Kinzler, M.C. Nilbert, B. Vogelstein, et al., Identification of a gene located at chromosome 5q21 that is mutated in colorectal cancers, Science 251 (1991) 1366e1370. [19] R. Baron, M. Kneissel, Wnt signaling in bone homeostasis and disease: from human mutations to treatments, Nat. Med. 19 (2013) 179e192. [20] L.M. Boyden, J. Mao, J. Belsky, L. Mitzner, et al., High bone density due to a mutation in ldl-receptor-related protein 5, N. Engl. J. Med. 346 (2002) 1513e1521. [21] Y. Gong, R.B. Slee, N. Fukai, et al., Ldl receptor-related protein 5 (Lrp5) affects bone accrual and eye development, Cell 107 (2001) 513e523. [22] E. Hay, T. Buczkowski, C. Marty, et al., Peptide-based mediated disruption of N-Cadherin-Lrp5/6 interaction promotes Wnt signaling and bone formation, J. Bone Miner. Res. 27 (2012) 1852e1863. [23] P. Clement-Lacroix, M. Ai, F. Morvan, et al., Lrp5-Independent activation of Wnt signaling by lithium chloride increases bone formation and bone mass in mice, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 17406e17411. [24] Q. Yao, C. Yu, X. Zhang, et al., Wnt/beta-catenin signaling in osteoblasts regulates global energy metabolism, Bone 97 (2017) 175e183. [25] H. Hu, M.J. Hilton, X. Tu, K. Yu, et al., Sequential roles of hedgehog and Wnt signaling in osteoblast development, Development 132 (2005) 49e60. [26] J. Luo, Z. Yang, Lgr4 is a receptor for rankl and negatively regulates Osteoclast, Different. Bone Resorp. 22 (2016) 539e546. [27] C. Zhu, X.F. Zheng, Y.H. Yang, et al., Lgr4 acts as a key receptor for R-spondin 2 to promote osteogenesis through Wnt signaling pathway, Cell. Signal. 28 (2016) 989e1000. [28] M. Zhang, P. Zhang, Y. Liu, et al., Rspo3-Lgr4 regulates osteogenic differentiation of human adipose-derived stem cells via erk/fgf signalling, Sci. Rep. 7 (2017) 42841. [29] M. Zhou, S. Guo, L. Yuan, et al., Blockade of Lgr4 inhibits proliferation and odonto/osteogenic differentiation of stem cells from, Apical Papillae 48 (2017) 389e401. [30] H. van Andel, Z. Ren, I. Koopmans, et al., Aberrantly expressed Lgr4 empowers Wnt signaling in multiple myeloma by hijacking osteoblast-derived R-spondins, Proc. Natl. Acad. Sci. U. S. A. 114 (2017) 376e381. [31] W. de Lau, N. Barker, T.Y. Low, et al., Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling, Nature 476 (2011) 293e297.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
LGR6 promotes osteogenesis by activating the Wnt/b-catenin signaling pathway Sheng-Li Liu a, 1, Yan-Man Zhou b, 1, Da-Bin Tang a, Neng Zhou a, Wei-Wei Zheng a, Zhong-Hua Tang a, Cai-Wen Duan a, Liang Zheng a, **, Jing Chen a, * a Key Laboratory of Pediatric Hematology and Oncology Ministry of Health and Pediatric Translational Medicine Institute, Department of Hematology and Oncology, Shanghai Children's Medical Center, Shanghai Collaborative Innovation Center for Translational Medicine and Department of Pharmacology and Chemical Biology, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai, 200025, China b Department of Endocrinology, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine (SJTU-SM), Shanghai, 200025, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 July 2019 Accepted 23 August 2019 Available online 6 September 2019
Leucine-rich repeat containing G-protein-coupled receptor 6 (LGR6) is a member of the rhodopsin-like 7transmembrane domain receptor superfamily and has high homology to LGR4 and LGR5. LGR6 is highly expressed in osteoblastic progenitors, and LGR6-deficient mice show nail and bone regeneration defect. However, the effect of LGR6 on the osteogenic differentiation of osteoblastic progenitors and its underlying mechanisms are largely unknown. In this study, we overexpressed and knockdown LGR6 with lentivirus in the preosteoblastic cell MC3T3-E1 to observe the effect of LGR6 on osteogenic differentiation and explore its possible molecular mechanism. LGR6 overexpression promoted osteogenic differentiation and mineralization by stabilizing b-catenin to potentiate the Wnt/b-catenin signaling pathway in MC3T3-E1 cells. Conversely, LGR6 knockdown inhibited osteogenic differentiation and mineralization by enhancing b-catenin degradation to inactivate the Wnt/b-catenin signaling pathway. These results reveal that LGR6 is highly expressed in osteoblastic progenitors, and promotes osteogenesis by enhancing bcatenin stability to strengthen the Wnt signaling pathway. This study provides an important reference into the exact mechanisms of osteogenic differentiation. © 2019 Published by Elsevier Inc.
Keywords: LGR6 Osteoblast Osteogenesis b-catenin Osteoporosis
1. Introduction Skeletal remodeling is a physiological process involving osteoblast-regulated bone formation and osteoclast-regulated bone resorption, and bone homeostasis is typically orchestrated coordinately by these two phenomena [1]. Disruption of bone homeostasis contributes to bone disease, especially osteoporosis (OP), a metabolic bone disease that poses a considerable threat to human health [2]. The incidence of OP to the aging people, particularly for postmenopausal group, are expected to continuously increase [3]. Two key strategies for the current treatment of OP are promotion of bone formation or inhibition of bone resorption [4]. However, antiresorptive drugs only alleviate the development of bone loss in OP
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (L. Zheng), [email protected] (J. Chen). 1 Sheng-Li Liu and Yan-Man Zhou contribute equally to this work. https://doi.org/10.1016/j.bbrc.2019.08.122 0006-291X/© 2019 Published by Elsevier Inc.
rather than increase the bone mass, and drugs that promote bone formation, which is mainly regulated and determined by osteoblasts, are rarely developed. Therefore, a deep understanding of the potential and exact mechanisms in osteoblastic differentiation may provide an opportunity to establish therapeutic strategies for OP. Leucine-rich repeat containing G-protein-coupled receptor 6 (LGR6) belongs to the leucine-rich repeat containing subgroup of the G-protein-coupled 7-transmembrane protein superfamily [5]. LGR6 is a recently discovered molecule acting as a marker of stem cells in taste buds, lung, and skin [6e8], and participates in multiple pathological and physiological processes [9e12]. For instance, LGR6 promotes wound healing, angiogenesis, and nascent hair follicle development in damaged epithelial tissues [9]. LGR6þ mesenchymal cells may also be a specific target for airway disease [10]. A recent study reported that LGR6 could be a contributor to digit tip regeneration, and bone reconstruction defects are observed in LGR6-deficient mice [12]. Thus, this molecule has a key role in bone metabolism. Furthermore, LGR6 protein expression was detected in mesenchymal stem cells (MSCs) that give rise to osteoblasts [13],
2
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
and this molecule was identified as a novel marker of osteoprogenitor cells in bone marrow [14]. However, the effect of LGR6 on the osteogenic differentiation of osteoblastic progenitors and its underlying mechanisms are largely unknown. The Wnt signaling pathway is a key regulator of developmental processes and postnatal health and disease [15e18], and its major branch is the canonical Wnt/b-catenin pathway. In essence, this signaling is initiated by the binding of Wnt ligands to the dual receptor complex comprising frizzled (Fzd) and either LRP5 or LRP6. Thus, the multiprotein b-catenin “destruction complex” is inactivated to prevent b-catenin phosphorylation and its proteasomal degradation. b-catenin subsequently accumulates in the cytoplasm and translocates into the nucleus where it associates with transcription factors to regulate target gene transcription [19]. Numerous studies highlighted the importance of the canonical Wnt signaling in regulating bone homeostasis [20e22], the activation of this pathway leads to increased bone mass and strength of the osteoblast-mediated bone formation [23e25]. Therefore, the canonical Wnt signaling is essential for osteoblast proliferation and differentiation. However, whether LGR6 promotes osteogenic differentiation via the activation of the Wnt/b-catenin signaling pathway remains unclear. In this study, we evaluated the effect and potential mechanisms of LGR6 on osteoblastic differentiation in MC3T3-E1 cells.
sequences: CCGAATCCT GGAGCTGTCTCATAAT, shRNA2 sequences: top strand: GATCCGCCGAATCCTG GAGCTGTCTCATAATTTCAAGAGAATTATGAGACAGCTCCAGGATTCGGTTTTTTG, bottom strand: AATTCAAAAAACCGAATCCTG GAGCTGTCTCATAATTC TCTTGAAATTATGAGACAGCTCCAGGATTCGGCG. SiRNA3 sequences: GACC TATGGTCAGTTCGCTGAGTAT, shRNA3 sequences: top strand: GATCCGACCTAT GGTCAGTTCGCTGAGTATTTCAAGAGAATAC, bottom strand: AATTCAAA AAAGACCTATGGTCAGTTCGCTGAGTATTCTCTTG AAATACTCAGCGAACT GACCATAGGTCG. A negative shRNA (TTCTCCGAACGTGTCACGTAA), which has no complementary sequences in the murine genome, was used as the control. MC3T3-E1 cells were plated in a 6-well plate (1 104 cells/cm2) and cultured in complete growth medium. On the next day, transfection experiments were performed using the experimental lentivirus or negative control lentivirus at the MOI of 20 in 1 ml of transfection medium containing 6 mg/ml polybrene, and the culture medium was added up to 2 ml after 4 h. The medium was discarded and replaced by a fresh complete medium after 24 h of transfection. The efficiency of infection was assessed on the basis of the fluorescence intensity of green fluorescent protein (GFP)-positive cells, and the knockdown efficiency of LGR6 gene was verified via real-time PCR and Western blot analysis (WB). The stable transfected cells were obtained after treatment with 2 mg/ml puromycin (Yeasen Biotech) for 14 days.
2. Materials and methods 2.1. MC3T3-E1 culture and osteogenic induction Murine osteoblastic MC3T3-E1 cells (American Type Culture Collection, ATCC CRL-2594) were incubated at 37 C and 5% CO2 in a-MEM medium (GIBCO BRL) supplemented with 10% fetal bovine serum (FBS, GIBCO BRL) and 1% antibiotic (streptomycin and penicillin, GIBCO BRL). The culture medium was replaced every 2 days. Upon cell growth up to 80% confluence, the media were replaced by an osteogenic medium containing 10 mmoL/l b-glycerophosphate disodium salt hydrate (Sigma-Aldrich) and 50 mmoL/l L-ascorbic acid (Sigma-Aldrich) for osteogenic induction. 2.2. Extraction and culture of bone marrow MSCs The bones of 6e8 week-old mice were crushed and placed into the digestive juice (1 mg/ml type IV collagenase, 2 mg/ml dispase II, and 1% BSA in PBS) and shaken on a shaker with 140e220 rpm at 37 C for 1 h. Digestion was terminated by PBS, and the erythrocytes were lysed by ACK buffer at room temperature for 5 min. The supernatant was discarded, and the remaining cells were resuspended in a-MEM containing 10% FBS and 1% antibiotics and cultured in 10 cm culture flasks at 37 C of 5% CO2. After 24 h, the culture was washed with PBS to remove non-adherent cells. The cells were passaged at 80% confluence and at passage 3 were used for the experiments. 2.3. Lentiviral transfection of MC3T3-E1 cell and stable strain screening The lentivirus-based LGR6 overexpression-GFP-PURO and shRNA-GFP-PURO were purchased from Shanghai Hanbio Biotechnology Co., Ltd. (Shanghai, China). The sequences of murine LGR6, which is the target of short hairpin RNA, were listed as follows: siRNA1 sequences: TGGAGACACTAGACCTG AACTATAA, shRNA1 sequences: top strand: GATCCGTGGAGACACTAGACC TGAACTATAATTCAAGAGATTATAGTTCAGGTCTAGTGTCTCCATTTTT TG, bottom strand: AATTCAAAAAATGGAGACACTAGACCTGAACTATAATCTCTT GAATTATAGTTCAGGTCTAGTGTCTCCACG. SiRNA2
2.4. Western blot (WB) analysis MC3T3-E1 cells were plated in a 6-well plate at 1 104 cells/ cm . Total cellular protein and nuclear/plasma protein were collected at 7 or 14 days after osteogenic induction. Nuclear and cytoplasmic protein extractions were conducted by using a nuclear protein extraction kit (ComWin Biotech Co. Ltd.). Protein concentration was determined using a Pierce BCA protein assay kit (Thermo Fisher Scientific). WB was performed via a conventional method, and the antibodies involved in this experiment include LGR6 (1:200, Santa Cruz Biotechnology), RUNX2 (1:1000, CST), OSX (1:1000, CST), b-catenin (1:1000, CST), p-b-catenin (1:1000, CST), GAPDH (1:5000, CST), and HistoneH3 (1:5000, CST). Images were acquired by using a chemiluminescent detection kit (Merck Millipore). 2
2.5. Quantitative real-time PCR (qRT-PCR) analysis MC3T3-E1 cells were plated in a 12-well plate at 1 104 cells/ cm . Total cellular RNA was isolated using a TRIzol reagent (SigmaAldrich) and collected at 7 or 14 days after osteogenic induction. Reverse transcription and Real-time PCR were performed using a GoScript™ Reverse Transcription System (Takara) and Maxima SYBR Green qPCR Master Mix (2 ) kit (Takara), respectively. The PCR primers were designed as follows: alkaline phosphatase (ALP): forward (F): 50 -TGATCACTCCCACGTTTTCA-30 and reverse (R): 50 GCTGTGAAGGGCTTCTTGTC-30 ; collagenI1 (Cola1): F: 50 -TCCTGCC GATGTCGCTATC-30 and R: 50 -CAAGTTCCGGTGTGACTCGT-30 ; osteocalcin (OCN): F: 50 -CAGGAGGGCAGTAAGGTGG-30 and R: 50 CAGGGGATCTGGGTAGGG-30 ; RUNX2: F: 50 -GCACCGACAGCCCC AACTT-30 and R: 50 -CCACGGGCAGGGTCTTGTT-30 ; OSX: F: 50 GATGGCGTCCTCTCTGCTT-30 and R: 50 -TATGGCTTCTTTGTGCCTCC30 ; b-catenin: F: 50 -ACGCTGCTCATCCCACTAAT-30 and R: 50 AGTTCCGCGTCATCCTGATA-30 ; LGR6: F: 50 -GAGGACGGCAT0 0 CATGCTGTC-3 and R: 5 -GCTCCGTGAGGTTGTTCATACT-30 ; and bactin: F: 50 -GGCTGTATTCCCCTCCATCG-30 and R: 50 -CCAGTTGGTAACAATGCCATGT-30 . 2
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
2.6. Immunofluorescence (IF) MC3T3-E1 and MSCs were cultured into a 24-well plate containing cell slide (1 104 cells/cm2) for 2 days and fixed with 4% paraformaldehyde. The slides were subsequently incubated with primary antibody against LGR6 (1:50, Santa Cruz Biotechnology) overnight at 4 C. On the next day, the cells were incubated with Alexa Fluor 488 secondary antibody (1:200, CST) for 90 min at room temperature, stained with DAPI (1:1000, Beyotime), and mounted with sealing liquid (Beyotime). Images were acquired using a Leica SP8 confocal microscope.
3
culture medium and cell lysate were measured using an ALP assay kit (Nanjing Jiancheng Bioengineering Institute) following the manufacturer's protocols. The protein concentration of the cell homogenate was determined using the BCA assay. Finally, the ALP activity of the cell lysate was normalized to the total cellular protein content. For ALP staining, MC3T3-E1 cells were fixed with 4% paraformaldehyde for 15 min after 7 days of osteoclastic induction. ALP staining was performed using a ALP staining Kit (Beyotime) following the manufacturer's instructions. The cells were washed three times with PBS and observed under a light microscope (Leica).
2.7. ALP activity and ALP staining assay 2.8. Alizarin red staining For ALP activity assay, MC3T3-E1 cells were cultured into a 96well plate with osteogenic medium for 7 days at 37 C of 5% CO2. Then the medium was collected, and 50 ml of RIPA buffer was added into each well to lyse the cells on ice for 30 min. The ALP activity of
After 14 days of osteoclastic induction, MC3T3-E1 cells were fixed with 95% ethanol for 10 min. The mineralized nodules of late osteogenic differentiation were stained with 0.1% alizarin red and
Fig. 1. LGR6 expression was increased during osteogenic differentiation and mineralization in MC3T3-E1 A. mRNA level of LGR6 in MC3T3-E1 by using MSC as a positive control. B. IF analysis of LGR6 protein level in MC3T3-E1 (630 ). CeF. mRNA levels of osteoblast differentiation markers ALP, Cola1, OCN, OSX, and RUNX2 after induced for 7 or 14 days in MC3T3-E1. G. ALP staining after induction for 7 days. H. Alizarin red staining after induction for 14 days. I and J. mRNA and protein level of LGR6 after induced for 7 or 14 days. Data were presented as the mean ± SD, and at least three independent experiments were conducted. **P < 0.01. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
4
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
washed three times with ddH2O. Images were acquired under a light microscope.
3. Results 3.1. LGR6 expression is increased during osteogenic differentiation and mineralization in MC3T3-E1
2.9. Statistical analysis Data are presented as the mean ± SD of at least three separate experiments. Statistical differences between two groups were determined by Student's t-test, and one-way ANOVA was used when more than two groups were compared. P < 0.05 was considered significant.
To determine the role of LGR6 in the osteogenic differentiation of osteoblastic progenitors, we detected its expression level in the preosteoblast cell line MC3T3-E1 via qRT-PCR and IF. As shown in Fig. 1A and B, LGR6 had a relatively lower expression in MC3T3-E1 than in bone marrow MSCs. Osteogenic differentiation was then induced by culturing with conditional medium for 7 or 14 days. The
Fig. 2. LGR6 promotes the osteogenic differentiation and mineralization of MC3T3-E1 A. IF images showed GFPþ cells transfected by lentiviruses after 72 h (100 ). B and C. qRT-PCR and WB confirmed the successful overexpression of LGR6 in stable LGR6 overexpressing cell line compared to control. D. mRNA levels of ALP, Cola1, OCN were determined after induced for 7 days. E and F. Extracellular and intracellular ALP activity after induction for 7 days. G. ALP staining after induction for 7 days. H. Alizarin red staining after 14 days of induction. I and J. mRNA and protein levels of OSX and RUNX2 after induced for 7 days. **P < 0.01 vs. Lv-con, ##P < 0.01 vs. Lv-con þ AAþb-GP. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
expression levels of osteoblast differentiation markers ALP, Cola1, OCN, OSX, and RUNX2 were determined via qRT-PCR, and the results showed that their mRNA expression levels were significantly increased after induction for 7 and 14 days (Fig. 1CeF). Furthermore, osteoblastic differentiation was also identified via ALP staining (indicator of early osteogenic differentiation) after induction for 7 days and alizarin red staining (indicator of late osteogenic differentiation) after induction for 14 days (Fig. 1G and H). Successful osteogenic differentiation was observed. The mRNA and protein expression levels of LGR6 were dramatically upregulated during osteoblast differentiation (Fig. 1I and J), indicating that LGR6 might exert an important function in regulating osteogenic differentiation in MC3T3-E1. 3.2. LGR6 promotes the osteogenic differentiation and mineralization of MC3T3-E1 To investigate the effect of LGR6 on the regulation of osteogenic differentiation in MC3T3-E1, we overexpressed LGR6 via transfection with a LGR6 lentivirus (Fig. 2A). The successful overexpression of LGR6 in MC3T3-E1 was confirmed by qRT-PCR and WB (Fig. 2B and C), and the stable LGR6 overexpressed cell line was used in subsequent experiments. After osteogenic induction for 7 or 14 days, the detection of osteogenic gene expression, ALP staining, and alizarin red staining in MC3T3-E1 were performed. We found that the LGR6 overexpression remarkably increased the expression level of osteogenic differentiation markers ALP, Cola1, and OCN (Fig. 2D) after 7 days of induction. Meanwhile, ALP staining and activity after 7 days of induction showed that the LGR6 overexpression enhanced the early osteoblastic differentiation of MC3T3-E1 cells (Fig. 2EeG). Alizarin red staining after 14 days of induction revealed that the LGR6 overexpression accelerated the mineralization of differentiated cells (Fig. 2H). Moreover, OSX and RUNX2, which are key transcription factors that mediate osteoblast differentiation, were also noticeably upregulated in the LGR6 overexpression group than in the control (Fig. 2I and J). These results showed that LGR6 overexpression promotes osteogenic differentiation and mineralization. 3.3. LGR6 activates the Wnt signaling pathway by stabilizing bcatenin Upon the activation of the Wnt signaling pathway, the dephosphorylation level of b-catenin is increased to prevent bcatenin degradation, hence, the amount of b-catenin that enters the nucleus is increased, and the expression level of the osteogenicpromoting gene is regulated [15]. To determine whether LGR6 promotes the osteogenic differentiation of osteoblastic progenitors by triggering the Wnt/b-catenin signaling pathway, we measured
5
the total and phosphorylation levels of b-catenin via WB. LGR6 overexpression substantially increased the b-catenin level in the total cells (Fig. 3A), and the phosphorylation level of b-catenin in the cytoplasm was evidently decreased (Fig. 3B). Meanwhile, the bcatenin content in the nucleus was considerably elevated (Fig. 3C) compared with that of the control. However, we found no evidence that LGR6 overexpression improved the mRNA level of b-catenin (Fig. 3D), suggesting that LGR6 overexpression increases b-catenin stabilization to potentiate the Wnt signaling pathway.
3.4. LGR6 knockdown inhibits osteogenic differentiation and mineralization via degrading b-catenin and suppressing the Wnt signaling pathway To further determine whether LGR6 promotes osteogenic differentiation in MC3T3-E1 via activating the Wnt/b-catenin signaling pathway, we transfected MC3T3-E1 with three lentiviruses that carry three different interference sequences (Fig. 4A). We screened the stability of LGR6 knockdown cell lines. Among them, the stable cell line transfected with interference sequence 3 had the highest knockdown efficiency at the mRNA and protein levels (Fig. 4B and C) and thus was selected for subsequent experiments. After osteogenic induction for 7 or 14 days, we performed osteogenic gene expression, ALP staining, ALP activity, and alizarin red staining in MC3T3-E1. We found that the osteogenic differentiation markers (ALP, Cola1, and OCN) (Fig. 4D) and osteogenic differentiation transcription factors (OSX and RUNX2) (Fig. 4E and F) were downregulated in LGR6 knockdown cells compared with those in the control after 7 days of induction. Meanwhile, the ALP staining, ALP activity, and the mineralization of differentiated cells were reduced in LGR6 knockdown cells compared with those in the control (Fig. 4GeJ). These results revealed that LGR6 knockdown inhibits osteogenic differentiation, and LGR6 is indispensable for osteogenesis. To investigate whether the enhanced Wnt signaling pathway via LGR6 overexpression is eliminated by knocking down LGR6, we determined the b-catenin level of differentiated cells via WB. The results showed that the b-catenin protein level in total cells remarkably decreased (Fig. 4K), and the phosphorylation level of bcatenin in the cytoplasm remarkably increased (Fig. 4L). Meanwhile, the amount of b-catenin in the nucleus was lower in LGR6 knockdown cells than in the control (Fig. 4M), and LGR6 knockdown did not reduce the mRNA level of b-catenin (Fig. 4N). Thus, LGR6 knockdown promotes b-catenin degradation to suppress the Wnt/b-catenin signaling pathway, and LGR6 is essential for maintaining the Wnt/b-catenin signaling pathway.
Fig. 3. LGR6 activates the Wnt signaling pathway by stabilizing b-catenin A. WB analysis of b-catenin protein level in the total cells of lysates after induction for 7 days. B. WB analysis of b-catenin and p-b-catenin protein level in the cytoplasm. C. WB analysis of b-catenin protein level in the nucleus. D. mRNA level of b-catenin after induction for 7 days.
6
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
Fig. 4. LGR6 knockdown inhibits osteogenic differentiation and mineralization via degrading b-catenin and suppressing the Wnt signaling pathway A. IF images showed GFPþ cells transfected by lentiviruses after 72 h (100 ). B and C. The cell transfected with interference sequence 3 had the highest knockdown efficiency at the mRNA and protein levels. D. mRNA levels of ALP, Cola1, OCN after induced for 7 days. E and F. mRNA and protein levels of OSX and RUNX2 after induced for 7 days. G. ALP staining after induction for 7 days. H and I. Extracellular and intracellular ALP activity after induction for 7 days. J. Alizarin red staining after 14 days of induction. K. WB analysis of b-catenin protein level in the total cells of lysates after induction for 7 days. L. WB analysis of b-catenin and p-b-catenin protein level in the cytoplasm. M. WB analysis of b-catenin protein level in the nucleus. N. mRNA level of b-catenin after induction for 7 days. **P < 0.01 vs. Lv-con, ##P < 0.01 vs. Lv-con þ AAþb-GP. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)
4. Discussion LGR6 is a stem cell marker in numerous organs, such as skin, taste buds, and lungs [6e8]. Jessica found that LGR6-expressing stem cells contribute to the osteoblastic lineage in the regenerating mouse digit tip bone, and LGR6 is genetically essential for bone regeneration following amputation [12]. Thus, this molecule might have a key role in regulating osteogenic differentiation. In our study, we found that LGR6 was expressed in preosteoblast cell line
MC3T3-E1 by using MSC as a positive control, and this finding is consistent with the LGR6 expression detected in the osteoblastic progenitors of mice [14]. We found that the LGR6 expression significantly increased during osteoblast differentiation and mineralization, suggesting that LGR6 may play a crucial role in these processes. LGR6 belongs to the leucine-rich repeat containing subgroup of the G-protein-coupled 7-transmembrane protein superfamily, which is categorized into type B of LGR protein family, including the
S.-L. Liu et al. / Biochemical and Biophysical Research Communications 519 (2019) 1e7
other two members, namely LGR4 and LGR5 [5]. LGR4 participates in bone remodeling, including bone formation and bone resorption. LGR4 competes with RANK to bind RANKL, and suppresses the canonical RANK signaling during osteoclast differentiation [26]. LGR4 also acts as receptor for RSPO2 or RSPO3 to promote osteoblast differentiation and maturation [27,28]. Given its homology with LGR4, LGR6 may have a key role in osteogenesis. In this study, we found that LGR6 overexpression in MC3T3-E1 accelerated osteoblastic differentiation as confirmed by the expression of early differentiation markers and late differentiation markers, this function is similar to that of LGR4 in osteoblasts [27]. Deletion of LGR6 in MC3T3-E1 leads to impaired osteogenesis, and this finding coincides with the blockade of LGR4 in the mouse model [29]. Collectively, LGR6 positively regulates osteogenesis during osteoblastic differentiation. LGR4 and LGR5 function as receptors of the R-spondin family to potentiate Wnt/b-catenin signaling [30,31]. The Wnt/b-catenin signaling pathway has a critical role in regulating bone metabolism [20e25]. Mice lacking b-catenin in osteoblasts postnatally exhibit decreased bone mass [24]. LGR6 could rescue the effect of Rspondins on the Wnt/b-catenin signaling in HEK293T cells when endogenously expressed LGR4 was inhibited [26], suggesting that LGR6 compensates for the loss function of LGR4. We found that LGR6 overexpression did not alter the transcriptional level of bcatenin but significantly elevated the protein level of b-catenin in total cell. In addition, LGR6 overexpression remarkably reduced the b-catenin phosphorylation level in the cytoplasm, decreased the degradation of b-catenin and then increased the b-catenin protein level in the nucleus. These results suggested that LGR6 overexpression activates the Wnt/b-catenin signaling pathway by increasing the cytoplasmic stabilization and nuclear accumulation of b-catenin to trigger the expression of osteoblast differentiation target genes. When LGR6 was deleted with a lentivirus, the Wnt/bcatenin signaling pathway was suppressed in MC3T3-E1, suggesting that LGR6 is essential for maintaining the Wnt/b-catenin signaling pathway. Therefore, LGR6 exerts an indispensable positive role in osteogenesis regulation by potentiating the Wnt/bcatenin signaling pathways. Through LGR6 overexpression and ablation in MC3T3-E1, we revealed that LGR6 promotes osteogenic differentiation, suggesting that LGR6 exerts an indispensable role in controlling osteogenic differentiation. We also found that LGR6 enhances the Wnt/b-catenin signaling pathway by stabilizing b-catenin in cytoplasm during osteogenesis. Our discovery unravels the cellular bases of the regulation and function of LGR6 in osteoblasts and provides an important reference into the exact mechanisms of osteogenic differentiation. Thus, targeting of the LGR6/Wnt/b-catenin signaling pathway may serve as a therapeutic strategy for OP. Acknowledgements This work is supported by the National Key R&D Program of China, Stem Cell and Translation Research (No. 2016YFA0102000), and the National Natural Science Foundation of China (No. 81570121; 81870082; 81970114), and the Science and Technology Commission of Pudong District, Shanghai Municipality (No. PKJ2015-Y04), and Innovation Program of Shanghai Municipal Education Commission (No. 15ZZ052), and the Hospital-Public CrossLink Project of Shanghai Jiao Tong University (No. YG2017MS31). Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.08.122.
7
References [1] M. Jiang, T. Wang, X. Yan, et al., A novel rhein derivative modulates bone formation and resorption and ameliorates estrogen-dependent bone loss, J. Bone Miner. Res. 34 (2019) 361e374. [2] E. Hernlund, A. Svedbom, M. Ivergard, et al., Osteoporosis in the European Union: medical management, epidemiology and economic burden. A report prepared in collaboration with the international osteoporosis foundation (iof) and the european federation of pharmaceutical industry associations (efpia), Arch. Osteoporos. 8 (2013) 136. [3] T.D. Rachner, S. Khosla, L.C. Hofbauer, Osteoporosis: now and the future, Lancet 377 (2011) 1276e1287. [4] D.M. Black, C.J. Rosen, Clinical practice. Postmenopausal osteoporosis, N. Engl. J. Med. 374 (2016) 254e262. [5] S.Y. Hsu, M. Kudo, T. Chen, et al., The three subfamilies of leucine-rich repeatcontaining G protein-coupled receptors (lgr): identification of Lgr6 and Lgr7 and the signaling mechanism for Lgr7, Mol. Endocrinol. 14 (2000) 1257e1271. [6] N. Barker, H. Clevers, Leucine-rich repeat-containing G-protein-coupled receptors as markers of adult stem cells, Gastroenterology 138 (2010) 1681e1696. [7] H.J. Snippert, A. Haegebarth, M. Kasper, et al., Lgr6 marks stem cells in the hair follicle that generate all cell lineages of the skin, Science 327 (2010) 1385e1389. [8] F. Oeztuerk-Winder, A. Guinot, A. Ochalek, et al., Regulation of human lung alveolar multipotent cells by a novel P38alpha mapk/mir-17-92 Axis, EMBO J. 31 (2012) 3431e3441. [9] D.M. Lough, N. Wetter, C. Madsen, et al., Transplantation of an Lgr6þ epithelial stem cell-enriched scaffold for repair of full-thickness soft-tissue defects: the in vitro development of polarized hair-bearing skin, Plast. Reconstr. Surg. 137 (2016) 495e507. [10] J.H. Lee, T. Tammela, M. Hofree, et al., Anatomically and functionally distinct lung mesenchymal populations marked by Lgr5 and Lgr6, Cell 170 (2017) 1149e1163, e12. [11] X. Gong, K.S. Carmon, Q. Lin, et al., Lgr6 is a high affinity receptor of R-spondins and potentially functions as a tumor suppressor, PLoS One 7 (2012), e37137. [12] J.A. Lehoczky, C.J. Tabin, Lgr6 marks nail stem cells and is required for digit tip regeneration, Proc. Natl. Acad. Sci. U. S. A. 112 (2015) 13249e13254. [13] Y. Cui, R. Huang, Y. Wang, et al., Down-regulation of Lgr6 promotes bone fracture recovery using bone marrow stromal cells, Biomed. Pharmacother. 99 (2018) 629e637. [14] V. Khedgikar, J.A. Lehoczky, Evidence for Lgr6 as a novel marker of osteoblastic progenitors in mice, JBMR Plus 3 (2019), e10075. [15] C. Nusslein-Volhard, E. Wieschaus, Mutations affecting segment number and polarity in Drosophila, Nature 287 (1980) 795e801. [16] C.V. Cabrera, M.C. Alonso, P. Johnston, et al., Phenocopies induced with antisense rna identify the wingless gene, Cell 50 (1987) 659e663. [17] R. Nusse, H.E. Varmus, Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome, Cell 31 (1982) 99e109. [18] K.W. Kinzler, M.C. Nilbert, B. Vogelstein, et al., Identification of a gene located at chromosome 5q21 that is mutated in colorectal cancers, Science 251 (1991) 1366e1370. [19] R. Baron, M. Kneissel, Wnt signaling in bone homeostasis and disease: from human mutations to treatments, Nat. Med. 19 (2013) 179e192. [20] L.M. Boyden, J. Mao, J. Belsky, L. Mitzner, et al., High bone density due to a mutation in ldl-receptor-related protein 5, N. Engl. J. Med. 346 (2002) 1513e1521. [21] Y. Gong, R.B. Slee, N. Fukai, et al., Ldl receptor-related protein 5 (Lrp5) affects bone accrual and eye development, Cell 107 (2001) 513e523. [22] E. Hay, T. Buczkowski, C. Marty, et al., Peptide-based mediated disruption of N-Cadherin-Lrp5/6 interaction promotes Wnt signaling and bone formation, J. Bone Miner. Res. 27 (2012) 1852e1863. [23] P. Clement-Lacroix, M. Ai, F. Morvan, et al., Lrp5-Independent activation of Wnt signaling by lithium chloride increases bone formation and bone mass in mice, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 17406e17411. [24] Q. Yao, C. Yu, X. Zhang, et al., Wnt/beta-catenin signaling in osteoblasts regulates global energy metabolism, Bone 97 (2017) 175e183. [25] H. Hu, M.J. Hilton, X. Tu, K. Yu, et al., Sequential roles of hedgehog and Wnt signaling in osteoblast development, Development 132 (2005) 49e60. [26] J. Luo, Z. Yang, Lgr4 is a receptor for rankl and negatively regulates Osteoclast, Different. Bone Resorp. 22 (2016) 539e546. [27] C. Zhu, X.F. Zheng, Y.H. Yang, et al., Lgr4 acts as a key receptor for R-spondin 2 to promote osteogenesis through Wnt signaling pathway, Cell. Signal. 28 (2016) 989e1000. [28] M. Zhang, P. Zhang, Y. Liu, et al., Rspo3-Lgr4 regulates osteogenic differentiation of human adipose-derived stem cells via erk/fgf signalling, Sci. Rep. 7 (2017) 42841. [29] M. Zhou, S. Guo, L. Yuan, et al., Blockade of Lgr4 inhibits proliferation and odonto/osteogenic differentiation of stem cells from, Apical Papillae 48 (2017) 389e401. [30] H. van Andel, Z. Ren, I. Koopmans, et al., Aberrantly expressed Lgr4 empowers Wnt signaling in multiple myeloma by hijacking osteoblast-derived R-spondins, Proc. Natl. Acad. Sci. U. S. A. 114 (2017) 376e381. [31] W. de Lau, N. Barker, T.Y. Low, et al., Lgr5 homologues associate with Wnt receptors and mediate R-spondin signalling, Nature 476 (2011) 293e297.