Ligand-Independent Oncogenic Transformation by the EGF Receptor Requires Kinase Domain Catalytic Activity

Experimental Cell Research 275, 9 –16 (2002) doi:10.1006/excr.2002.5494, available online at http://www.idealibrary.com on

Ligand-Independent Oncogenic Transformation by the EGF Receptor Requires Kinase Domain Catalytic Activity 1 Andrew J. Danielsen and Nita J. Maihle 2 Tumor Biology Program, Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota 55905

Key Words: EGFR; v-ErbB; ErbB receptors; kinase domain; transformation.

The retroviral oncogene S3-v-erbB is a transduced, truncated form of the avian EGF (ErbB-1) receptor. Infection of avian fibroblasts with a retroviral vector expressing S3-v-ErbB results in ligand-independent cell transformation, which is accompanied by the assembly of a transformation-specific phosphoprotein signaling complex and anchorage-independent cell growth. It previously had been reported, using lysine721 mutants (K721), that kinase domain function was required for ErbB-mediated cell transformation. However, since these initial reports, several studies using aspartate-813 mutants (D813) have demonstrated the ability of kinase-impaired ErbB receptors to induce mitogenic signal transduction pathways and cell transformation in a ligand-dependent manner. To determine the necessity of ErbB receptor kinase domain catalytic activity in ligand-independent cell transformation, we created S3-v-ErbB-K ⴚ, a kinase-impaired oncoprotein constructed by replacing aspartate-813 with alanine (D813A). Subcellular routing as well as cell surface membrane and nuclear localization of the S3-v-ErbB-K ⴚ mutant receptor were unaffected by impairment of kinase activity. In contrast, avian fibroblasts expressing S3-v-ErbB-K ⴚ do not form the characteristic transformation-specific phosphoprotein complex, or induce soft agar colony growth in vitro. These results suggest that in contrast to ligand-dependent oncogenic signaling, ligand-independent cell transformation by a constitutively activated mutant form of the EGF receptor requires receptor kinase catalytic activity. In addition, these results demonstrate that phosphorylation and assembly of downstream signaling complexes require tyrosine phosphorylation events that are directly mediated by oncogenic forms of the EGF receptor. © 2002 Elsevier

INTRODUCTION

The involvement of the EGF/ErbB-1 receptor family in the regulation of cell growth and cell transformation is well documented [1– 4]. ErbB receptors regulate these processes through the initiation of multiple signal transduction pathways via the phosphorylation of signaling intermediates [5–7]. Initially, it was established that activation of ErbB receptor kinase activity required ligand-induced homo- or heterodimerization between ErbB receptor family members [8 –10]. Several reports, however, have demonstrated the ability of ErbB receptors to initiate signal transduction events in a ligand-independent manner [11, 12]. These ligandindependent signals can be generated by interactions between ErbB receptors and other kinase enzymes such as G protein-coupled receptors [13–15] or cytokine receptors [16]. In addition, oncogenic mutations have been shown to release ErbB receptor kinase activity from ligand regulatory constraints [12]. The avian receptor has been the primary model for the study of ligand-independent signaling by oncogenic EGF/ErbB receptors during cell transformation [17]. The avian ErbB-1 gene product encodes a transmembrane glycoprotein that has been shown to share structural and functional homology with the human epidermal growth factor receptor (hEGFR/h-ErbB-1) [18, 19]. The retroviral oncogene S3-v-erbB is a transduced, truncated version of ErbB-1, which is capable of transforming fibroblasts in vitro and inducing fibrosarcomas in vivo [20 –22]. In recent years, the truncations which confer transformation potential to S3-v-ErbB have been shown to share structural homology with mutations found within the EGFR in human gliomas [23]. We have demonstrated that expression of S3-v-ErbB in primary fibroblasts results in the formation of a transformation-specific phosphoprotein signaling complex and anchorage-independent growth; these downstream signaling events occur in a ligand-independent manner [20, 24 –27]. To date, we have identified sev-

Science (USA)

1

Supported by the National Institutes of Health (CA79808). To whom reprint requests should be addressed at Mayo Clinic, Tumor Biology Program, 200 First St. SW, Rochester, MN 55905. Fax: 507-284-1767. E-mail: [email protected]. 3 Abbreviations used: EGF, epidermal growth factor; Pak, p21activated kinase; MAPK, mitogen-activated protein kinase; CEF, chick embryo fibroblasts; EGFR, epidermal growth factor receptor. 2

9

0014-4827/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

10

DANIELSEN AND MAIHLE

eral of the proteins that comprise the transformationspecific phosphoprotein signaling complex [20, 25, 26]. Among these proteins are the signaling adapters, Shc and Grb2, as well as tyrosine phosphorylated forms of the cytoskeletal regulatory proteins Pak and caldesmon [20, 25, 26]. The events leading to the formation of this complex, and the downstream signals emanating from this complex, may represent unique signaling events utilized during ligand-independent ErbB-mediated oncogenic transformation. Previously, we have used an S3-v-ErbB receptor mutated at the ATP binding site (amino acid lysine-721 (K721)) of the kinase domain to demonstrate a requirement for kinase activity during S3-v-ErbB-mediated transformation of primary fibroblasts [28, 29]. Since this report, however, several studies have demonstrated a surprising level of signaling activity in cells which express kinase-impaired ErbB receptors mutated at amino acid aspartate-813 (D813), a residue which forms the catalytic base during ␥-phosphate transfer to substrate proteins [29 –31]. Through dimerization with other ErbB family members, D813 ErbB mutants have been shown to initiate the activation of mitogenic proteins such as Ras, Shc, c-fos, and MAPK as well as to stimulate DNA synthesis in a liganddependent manner [31–34]. In addition, the ErbB-3 receptor, a protein with naturally impaired kinase function resulting from an amino acid substitution at D813, has been demonstrated to transform cells in a ligand-dependent manner through heterodimerization with either ErbB-1 or ErbB-2 [33–38]. In this regard, we previously have reported the ability of both S3-vErbB and kinase-deficient mutants of this receptor to heterodimerize with endogenous c-ErbB-1 in chick embryo fibroblasts (CEF) [39]. Finally, several reports, using closely related receptor tyrosine kinases, have documented the ability of kinase-impaired receptor mutants to activate signal transduction pathways which result in angiogenesis (flt-1) or cell transformation (c-kit) [40 – 43]. Therefore, it is possible that a ligand-independent, kinase-impaired (via a D813 mutation) ErbB receptor mutant might also retain oncogenic signaling potential. In this study, we sought to determine if ligand-independent transformation of CEF could occur through expression of a D813 kinase-impaired S3-v-ErbB mutant. To this end we used site-directed mutagenesis to construct S3-v-ErbB-K ⫺, a kinase-impaired receptor in which aspartate-813 was substituted with alanine (D813A). We then investigated the stability and cellular localization of S3-v-ErbB-K ⫺ relative to S3-v-ErbB. Despite similar expression, cellular routing, and localization of both receptors, S3-v-ErbB-K ⫺ infected fibroblasts failed to form soft agar colonies in vitro, or to assemble the transformation-specific phosphoprotein signaling complex previously shown to be characteris-

tic of ligand-independent oncogenic signaling. Interestingly, lack of intrinsic kinase activity does not appear to affect cell surface routing, or receptor localization to the nucleus. Our results indicate that tyrosine kinase catalytic activity is essential for ligand-independent transformation, and that impairment of receptor kinase activity does not appear to alter the subcellular routing or nuclear localization of oncogenic ErbB receptor mutants. MATERIALS AND METHODS Cells and viruses. Primary chicken embryo fibroblasts (CEF; line ␾) were cultured in Dulbeco’s modified Eagle’s medium (DMEM), with 10% fetal bovine serum and 2% chick serum at 37°C. RCANbased retroviral vectors were used for infections [44]. Construction of S3-v-ErbB-K ⫺ mutant. The S3-v-ErbB-K ⫺ mutant was constructed using the Stratagene Quik Change kit. Briefly, S3-v-erbB cDNA was cloned into pBluescript at the Cla I site, the plasmid was denatured, and the mutagenic primers 5⬘ CCTGGTGCACCGTGCGCTAGCTGCCAGGAACGTC 3⬘ 5⬘ GACGTTCCTGGCAGCTAGCGCACGGTGCACCAGG 3⬘ were annealed and extended with Pfu polymerase. The methylation-specific restriction enzyme Dpn I was then added to remove the parental plasmid strand. The newly mutagenized plasmid strands were used to transform bacteria and isolate colonies. Colonies were screened for the presence of a unique Nhe I site which is created by the oligo during the mutation process. Cell lysis, immunoblotting, and immunoprecipitation. Cell lysis was performed as previously described [25, 27]. Briefly, cells were harvested in a lysis buffer containing 1% Triton X-100, 50 mM Hepes, pH 7.5, 1% Nonidet P-40, 5 mM EDTA, 50 mM NaCl, 10 mM NaPP 1, 0.5% deoxycholate, 100 mM vanadate, 4 mM DFP, 1 mM PMSF, 10 ␮g/ml pepstatin A, and 10 ␮g/ml leupeptin. Protein concentration was determined by the Lowry method using the DC Protein Assay Kit from BioRad (Richmond, CA). Aliquots of lysate containing equal amounts of protein were subjected to 10% SDS-PAGE. Immunoblotting was carried out as described previously [25, 27]. For immunoprecipitation assays, 500 ␮g of cell lysate was incubated with the appropriate antibody overnight at 4°C with gentle rocking. Thirty-five microliters of Protein A/G beads (Pierce, Rockford, IL) was then added, and the samples rocked for 30 min at 4°C. The immune complexes were washed three times in immunoprecipitation buffer B (150 mM NaCl, 10 mM Tris-HCl (pH 9.0), 5 mM EDTA, 0.1% Triton X-100), and three times in Tris-buffered saline (10 mM TrisHCl (pH 7.4), 150 mM NaCl), followed by SDS-PAGE. Proteins were transferred to PVDF membrane followed by immunoblot analysis. In vitro kinase assays. A 500 ␮g sample of cell lysate was immunoprecipitated with the T2 anti-v-ErbB antibody as described previously [17]. Immune complexes were resuspended in 200 ␮l of assay buffer (20 mM Hepes, 10% glycerol, 1% Triton X-100, 5 mM MNCl 2), [ 32P-␥]ATP was added, and the mixture incubated on ice for 10 min. The reaction was terminated by adding 200 ␮l of 2X sample buffer, and the samples were resolved by 10% PAGE. Gels were dried and exposed to film for autoradiography. In vitro kinase assays were performed in triplicate. Soft agar colony assays. Chick embryo fibroblasts (line ␾) were plated as previously described [28]. Plates were supplemented with a few drops of medium every 3 days, for a total of 3 weeks. Colonies (⬎50 cells/colony) were counted by light microscopy. Assays were done in triplicate, and standard errors were calculated.

KINASE DOMAIN ACTIVITY AND v-ErbB-MEDIATED TRANSFORMATION

11

RESULTS AND DISCUSSION

Expression of Helper-Independent Retroviral Vectors Carrying Mutant S3-v-ErbB Proteins in Chick Embryo Fibroblasts

FIG. 1. Schematic diagram of mutant v-erbB constructs. The S3-v-ErbB mutant contains an amino-terminal truncation that deletes all but 40 amino acids of the ligand-binding domain. In addition to this amino-terminal truncation, S3-v-ErbB contains a 139 amino acid in-frame deletion within the carboxy-terminal regulatory domain [21, 22]. The S3-v-erbB-K ⫺ mutant contains a point mutation in the tyrosine kinase domain that converts the catalytic aspartate813 residue to alanine. This mutation has been shown to inhibit the transfer of the ␥-phosphate of ATP to protein substrates.

Immunofluorescence. Cells (5 ⫻ 10 3) were plated on 12-mm glass coverslips in regular growth media (DMEM ⫹ 10% FBS/2% CS) and grown overnight at 37°C. The cells were then fixed in methanol for 10 min at ⫺20°C, rehydrated on PBS for 10 min at room temperature, and put on blocking buffer (5% goat serum, 1% glycerol, 0.1% bovine serum albumin, and 0.1% gelatin in PBS) for 30 min at room temperature. Cells were then incubated with the rabbit polyclonal antibody T2 [17] for 1 h at room temperature. Cells were washed three times with PBS, and incubated with FITC-conjugated anti-rabbit antibodies (Caltag) for 1 h at room temperature. Cells were washed three times with PBS, and mounted on glass slides with VectaSheild (Vector Labs) with 0.1 ␮g/ml DAPI. Images were captured using confocal microscopy with an 100X objective (Carl Zeiss, Model 5100). Immunofluorescence assays were performed in triplicate.

To investigate the catalytic kinase domain requirement for S3-v-ErbB mediated transformation of CEF, we constructed a mutant version of the receptor encoded by this oncogene. The S3-v-ErbB-K ⫺ protein was created by replacing aspartic acid residue 813 with alanine. This mutation will allow ATP to bind within the kinase domain binding pocket, but will prevent the transfer of the gamma phosphate of ATP to substrate proteins. The wild-type and mutant S3-v-erbB constructs were cloned into the replication competent avian leukosis virus-no splice acceptor (RCAN) vector to facilitate viral production [44]. This vector allows for helper-independent production of infectious virus particles. Harvested virus can be used to infect CEF cells, which then uniformly express the wild-type or mutant S3-v-ErbB proteins. Figure 1 illustrates a diagram of the mutations within each S3-verbB construct used in this study relative to the c-erbB-1 protooncogene. Figure 2A demonstrates protein expression of each S3-v-ErbB construct following infection of CEF. The S3-v-ErbB and S3-v-ErbB-K ⫺ proteins migrate as bands ranging from 60 to 68 kDa; we previously have shown this migration pattern to be the result of extensive N-linked glycosylation during receptor maturation [17]. Aspartic Acid Residue 813 Is Required for Kinase Domain Catalytic Activity Mutation of the aspartic acid residue at position 813, which was changed to alanine in the S3-v-ErbB-K ⫺

FIG. 2. Analysis of S3-v-ErbB and S3-v-ErbB-K ⫺ protein expression and kinase activity. (A) Western blot analysis of cell lysates from infected CEF. Lysates were separated by SDS-PAGE and then transferred to PVDF membrane. Membranes were blotted with a polyclonal v-ErbB specific antibody [17]. The S3 v-ErbB and S3 v-ErbB-K ⫺ proteins migrate as broad bands in the 60 – 68 kDa range as a result of extensive N-linked glycosylation. (B) In vitro kinase activity of v-ErbB products. Kinase activity was assayed by immunoprecipitating S3-v-ErbB proteins using a polyclonal antibody specific to the carboxy terminus of v-ErbB [17]. Immune complexes were incubated with ATP␥ 32, and phosphorylated proteins were separated by SDS-PAGE as described previously [28]. Autoradiographic analysis demonstrated that 32P-labeled proteins are present in the S3-v-ErbB lane, consistent with receptor autophosphorylation. No detectable kinase activity was present in cells expressing S3-v-ErbB-K ⫺. In vitro kinase assays were performed in triplicate.

12

DANIELSEN AND MAIHLE

FIG. 3. Determination of S3-v-ErbB and S3-v-ErbB-K ⫺ protein localization by indirect immunofluorescence. CEF infected with S3-vErbB or S3-v-ErbB-K ⫺ were fixed onto glass coverslips and permeabilized with methanol as described in the “Materials and Methods” section. S3-v-ErbB protein products were localized using a v-ErbB specific polyclonal antibody generated to the carboxy-terminus of the protein [17]. S3-v-ErbB (B) and S3-v-ErbB-K ⫺ (C) appear to localize both to perinuclear and cell surface membranes as well as to the nucleus. Uninfected CEF (A) were treated with primary and secondary antibodies in the same manner as S3-v-ErbB expressing CEF, revealing the pattern of endogenous ErbB-1 expression in these cells. The immunofluorescence assays were performed in triplicate, with secondary-only controls for all samples being negative (data not shown). Magnification ⫻100.

protein, has been demonstrated by others to eliminate kinase catalytic activity in ErbB receptors [32, 45]. To determine the kinase activity of both S3-v-erbB constructs studied in this report, we infected CEF with viruses expressing S3-v-ErbB or S3-v-ErbB-K ⫺, and performed in vitro kinase assays. Both S3-v-erbB constructs were immunoprecipitated from cell lysate, and incubated with ␥ATP 32 under in vitro kinase reaction conditions [28]. Phosphorylated proteins were visualized on film after separation by SDS-PAGE (Fig. 2B). The wild-type S3-v-ErbB protein migrated as a broad 32 P-labeled band of 60 – 68 kDa, representing autophosphorylation of the receptor, as previously described [28]. In contrast, the S3-v-ErbB-K ⫺ mutant appeared to contain no detectable tyrosine kinase activity (Fig. 2B). Thus, aspartic acid residue 813 is required for S3-v-ErbB receptor kinase function in vitro. Kinase Domain Catalytic Activity of S3-v-ErbB Is Not Required for Cell Surface Membrane or Nuclear Localization To determine the cellular localization of S3-v-ErbB and the S3-v-ErbB-K ⫺ mutant, indirect immunofluorescence was performed. A polyclonal antibody generated to the carboxy-terminus of the v-ErbB protein was utilized [17]. As shown in Fig. 3, both the S3-v-ErbB (3B) and S3-v-ErbB-K ⫺ (3C) proteins are predominantly localized in the cytoplasm during protein maturation and transport, but also show a distinct cell surface membrane pattern of localization. In addition, there appears to be a component of both proteins which is localized in the nucleus and in the perinuclear re-

gion. These observations are in agreement with previous reports describing ErbB protein localization in intracellular membranes during receptor maturation, and within cell surface membranes once fully mature [19, 46]. Our observations also agree with several recent reports which have documented the ability of ErbB proteins to localize to the nucleus, where they can act as transcription factors [47–50]. Interestingly, the inhibition of v-ErbB kinase activity appears to have no observable effect on the intracellular routing or localization of this protein. Thus, our results suggest that the ability of ErbB receptors to be routed to the cell surface membrane or to gain access to the nucleus is not dependent upon intrinsic kinase activity. A Functional Kinase Domain Is Required for Formation of the Transformation-Specific Phosphoprotein Complex To determine the transformation potential of the S3-v-ErbB-K ⫺ mutant, we assayed for the formation of a transformation-specific phosphoprotein complex, as described previously [20, 24 –27]. This complex forms in a ligand-independent fashion only in S3-v-ErbB transformed CEF. The formation of this complex is correlated with the phenotypic changes that occur during cell transformation, i.e., stress fiber disassembly and anchorage-independent growth. We previously have demonstrated that this complex consists of tyrosine phosphorylated forms of the adaptor protein Shc, as well as the cytoskeletal regulatory proteins Pak and caldesmon [25–27]. Interestingly, D813 ErbB receptor mutants have been shown by others to maintain

KINASE DOMAIN ACTIVITY AND v-ErbB-MEDIATED TRANSFORMATION

13

FIG. 4. Analysis of the ability of S3-v-ErbB and S3-v-ErbB-K ⫺ proteins to induce tyrosine phosphorylation of Pak and caldesmon and form the transformation-specific phosphoprotein complex. (A) Phosphoprotein complex formation in S3-v-ErbB expressing CEF. The ability of S3-v-ErbB products to stimulate formation of the transformation-specific phosphoprotein complex was analyzed by immunoprecipitating lysates with a polyclonal antibody to Shc as described previously [20]. Immunoprecipitates were separated on SDS-PAGE and transferred to membrane. Membranes were blotted with a monoclonal anti-phosphotyrosine antibody. Total cell lysates were blotted with a polyclonal antibody to Shc to verify equal protein levels; the isoforms of Shc are indicated. (B) and (C) Tyrosine phosphorylation of Pak and caldesmon. The ability of S3-v-ErbB products to induce tyrosine phosphorylation of two phosphoprotein complex components, Pak and caldesmon, was analyzed by immunoprecipitating lysates with either a polyclonal antibody to Pak (B) or a monoclonal antibody to caldesmon (C). Immunoprecipitates were treated as in (A). Total cell lysates were blotted with either a polyclonal antibody to Pak (B) or a monoclonal antibody to caldesmon (C) to verify equal protein concentrations. The three isoforms of Pak are indicated.

the ability to activate both Shc and Grb2 in a liganddependent manner [31, 34]. Because we previously have demonstrated that both Shc and Grb2 are necessary for formation of the transformation-specific phosphoprotein complex characteristic of S3-v-ErbB trans-

formed CEF, we sought to determine the ability of an S3-v-ErbB-K ⫺ (D813) mutant to form this complex in a ligand-independent fashion. To assay for complex formation, we immunoprecipitated cell lysates from CEF infected with viruses expressing S3-v-ErbB or S3-v-

14

DANIELSEN AND MAIHLE

FIG. 5. Analysis of soft agar colony formation in S3-v-ErbB and S3-v-ErbB-K ⫺ infected CEF. CEF cells expressing S3-v-ErbB or S3v-ErbB-K ⫺ were plated in agarose, grown for 3 weeks at 37°C, and assayed for colony formation (⬎50 cells/colony). Infection of fibroblasts with virus expressing S3-v-ErbB resulted in the formation of numerous colonies of various sizes, whereas expression of S3-vErbB-K ⫺ in CEF resulted in no significant colony formation above that of uninfected CEF cells. Soft agar colony assays were performed in triplicate.

ErbB-K ⫺ with a polyclonal antibody to Shc. Immunoprecipitates were resolved by SDS-PAGE, transferred to PVDF membrane, and Western blotted with a monoclonal antibody specific for tyrosine phosphoproteins. In addition, we also assayed for tyrosine phosphorylation of two components of the phosphoprotein complex, Pak and caldesmon, by immunoprecipitating cell lysate with either a polyclonal antibody to Pak (Fig. 4B) or a monoclonal antibody to caldesmon (Fig. 4C) and Western blotting with a monoclonal antibody to tyrosine phosphorylated proteins. As predicted, we observed a broad complex of tyrosine phosphorylated proteins (Fig. 4A), as well as tyrosine phosphorylation of both caldesmon and the ␣-isoform of Pak (Figs. 4C and 4B) in cells expressing S3-v-ErbB. In contrast, the S3v-ErbB-K ⫺ expressing cells failed to form this phosphoprotein complex, and also did not display tyrosine phosphorylation of Pak or caldesmon. It, therefore, appears that the intrinsic tyrosine kinase catalytic activity of S3-v-ErbB, is required for the tyrosine phosphorylation and assembly of components of the transformation-specific phosphoprotein complex. A Functional Kinase Domain Is Necessary for S3-vErbB Induction of Anchorage-Independent Growth Growth of colonies in soft agar is the most stringent in vitro criterion available to assess the transformed phenotype. Thus, we infected CEF with viruses expressing S3-v-ErbB or S3-v-ErbB-K ⫺, and placed 5 ⫻ 10 5 cells in soft agar, and assayed for anchorage-independent growth by monitoring for colony formation. Infected CEF were incubated in soft agar for 3 weeks at 37°C. Colonies of greater than 50 cells were scored. Figure 5 shows that CEF expressing S3-v-ErbB formed 500 – 600 colonies per plate. In contrast, S3-v-ErbB-K ⫺

infected CEF failed to form colonies at a greater level than uninfected CEF. These results further demonstrate that catalytic kinase activity is essential for S3-v-ErbB to transform avian fibroblasts in a ligandindependent manner, and are in agreement with those presented above regarding the capabilities of S3-vErbB and S3-v-ErbB-K ⫺ to initiate formation of the transformation-specific phosphoprotein complex. Thus, while signaling events similar to those described by others in cells expressing D813 ErbB receptor mutants (i.e., initiation of DNA synthesis, Ras activation, MAPK activation) may be occurring in cells infected with our S3-v-ErbB-K ⫺ (D813) mutant, these events are not sufficient to induce ligand-independent transformation of a primary cell line. The ability to block ErbB kinase activity has been pursued as a possible adjuvant therapy for tumors which express constitutively activated, and often ligand-independent, mutant forms of members of this receptor family. The results presented here demonstrate that inhibition of kinase activity of a ligandindependent oncogenic ErbB-1 mutant, specifically by replacing aspartate residue 813 in the catalytic domain with alanine, disrupts the ability of this receptor to transform primary cells in culture. These results provide support for the notion that targeting the ErbB receptor kinase domain may be an effective means of inhibiting ErbB-mediated oncogenic signaling and cell transformation. We gratefully acknowledge Dr. Stephen Hughes (NCI) for providing the RCAN retroviral vectors used in these studies. We also thank Trace Christensen, Shari Meeker, Laura Sikkink, and Emily Ward for their technical contributions, and Dr. Jill Reiter, for her technical assistance and helpful discussions. This work was supported by the National Institutes of Health (CA79808).

REFERENCES 1.

Jost, M., Kari, C., and Rodeck, U. (2000). The EGF receptor—an essential regulator of multiple epidermal functions. Eur. J. Dermatol. 10(7), 505–510.

2.

Kim, H., and Muller, W. J. (1999). The role of the epidermal growth factor receptor family in mammary tumorigenesis and metastasis. Exp. Cell Res. 253(1), 78 – 87.

3.

Salomon, D. S., Brandt, R., Ciardiello, F. and Normanno, N. (1995). Epidermal growth factor-related peptides and their receptors in human malignancies. Crit. Rev. Oncol. Hematol. 19(3), 183–232.

4.

Wells, A. (1999). EGF receptor. Int. J. Biochem. Cell Biol. 31(6), 637– 643.

5.

Bogdan, S., and Klambt, C. (2001). Epidermal growth factor receptor signaling. Curr. Biol. 11(8), R292–R295.

6.

Gschwind, A., Zwick, E., Prenzel, N., Leserer, M., and Ullrich, A. (2001). Cell communication networks: Epidermal growth factor receptor transactivation as the paradigm for interreceptor signal transmission. Oncogene 20(13), 1594 –1600.

7.

Yarden, Y., and Sliwkowski, M. X. (2001). Untangling the ErbB signalling network. Nat. Rev. Mol. Cell Biol. 2(2), 127–137.

KINASE DOMAIN ACTIVITY AND v-ErbB-MEDIATED TRANSFORMATION 8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

Canals, F. (1992). Signal transmission by epidermal growth factor receptor: Coincidence of activation and dimerization. Biochemistry 31(18), 4493– 4501. Chen, W. S., Lazar, C. S., Poenie, M., Tsien, R. Y., Gill, G. N., and Rosenfeld, M. G. (1987). Requirement for intrinsic protein tyrosine kinase in the immediate and late actions of the EGF receptor. Nature 328(6133), 820 – 823. Yarden, Y., and Schlessinger, J. (1987). Self-phosphorylation of epidermal growth factor receptor: Evidence for a model of intermolecular allosteric activation. Biochemistry 26(5), 1434 – 1442. Carpenter, G. (1999). Employment of the epidermal growth factor receptor in growth factor—independent signaling pathways. J. Cell Biol. 146(4), 697–702. Maihle, N. J., and Kung, H. J. (1989). C-erbB and the epidermal growth-factor receptor: A molecule with dual identity. Biochim. Biophys. Acta 948(3), 287–304. Daub, H., Weiss, F. U., Wallasch, C., and Ullrich, A. (1996). Role of transactivation of the EGF receptor in signalling by G-protein-coupled receptors. Nature 379(6565), 557–560. Luttrell, L. M., Della Rocca, G. J., van Biesen, T., Luttrell, D. K., and Lefkowitz, R. J. (1997). Gbetagamma subunits mediate Src-dependent phosphorylation of the epidermal growth factor receptor. A scaffold for G protein-coupled receptor-mediated Ras activation. J. Biol. Chem. 272(7), 4637– 4644. Zwick, E., Daub, H., Aoki, N., Yamaguchi-Aoki, Y., Tinhofer, I., Maly, K., and Ullrich, A. (1997). Critical role of calcium-dependent epidermal growth factor receptor transactivation in PC12 cell membrane depolarization and bradykinin signaling. J. Biol. Chem. 272(40), 24767–24770. Yamauchi, T., Ueki, K., Tobe, K., Tamemoto, H., Sekine, N., Wada, M., Honjo, M., Takahashi, M., Takahashi, T., Hirai, H., Tushima, T., Akanuma, Y., Fujita, T., Komuro, I., Yazaki, Y., and Kadowaki, T. (1997). Tyrosine phosphorylation of the EGF receptor by the kinase Jak2 is induced by growth hormone. Nature 390(6655), 91–96. Maihle, N. J., Raines, M. A., Flickinger, T. W., and Kung, H. J. (1988). Proviral insertional activation of c-erbB: Differential processing of the protein products arising from two alternate transcripts. Mol. Cell Biol. 8(11), 4868 – 4876. Downward, J., Yarden, Y., Mayes, E., Scrace, G., Totty, N., Stockwell, P., Ullrich, A. J., Schlessinger, J., and Waterfield, M. D. (1984). Close similarity of epidermal growth factor receptor and v-erb-B oncogene protein sequences. Nature 307(5951), 521–527. Privalsky, M. L., Sealy, L., Bishop, J. M., McGrath, J. P., and Levinson, A. D. (1983). The product of the avian erythroblastosis virus erbB locus is a glycoprotein. Cell 32(4), 1257–1267. McManus, M. J., Connolly, D. C., and Maihle, N. J. (1995). Tissue- and transformation-specific phosphotyrosyl proteins in v-erbB- transformed cells. J. Virol. 69(6), 3631–3638. Raines, M. A., Maihle, N. J., Moscovici, C., Crittenden, L., and Kung, H. J. (1988). Mechanism of c-erbB transduction: Newly released transducing viruses retain poly(A) tracts of erbB transcripts and encode C-terminally intact erbB proteins. J. Virol. 62(7), 2437–2443. Raines, M. A., Maihle, N. J., Moscovici, C., Moscovici, M. G., and Kung, H. J. (1988). Molecular characterization of three erbB transducing viruses generated during avian leukosis virus-induced erythroleukemia: Extensive internal deletion near the kinase domain activates the fibrosarcoma- and hemangioma-inducing potentials of erbB. J. Virol. 62(7), 2444 –2452. Frederick, L., Wang, X. Y., Eley, G., and James, C. D. (2000). Diversity and frequency of epidermal growth factor receptor

15

mutations in human glioblastomas. Cancer Res. 60(5), 1383– 1387. 24.

Boerner, J. L., Danielsen, A., McManus, M. J., and Maihle, N. J. (2001). Activation of Rho is required for ligand-independent oncogenic signaling by a mutant epidermal growth factor receptor. J. Biol. Chem. 276(5), 3691–3695.

25.

McManus, M. J., Lingle, W. L., Salisbury, J. L., and Maihle, N. J. (1997). A transformation-associated complex involving tyrosine kinase signal adapter proteins and caldesmon links v-erbB signaling to actin stress fiber disassembly. Proc. Natl. Acad. Sci. USA 94(21), 11351–11356.

26.

McManus, M. J., Boerner, J. L., Danielsen, A. J., Wang, Z., Matsumura, F., and Maihle, N. J. (2000). An oncogenic epidermal growth factor receptor signals via a p21-activated kinasecaldesmon-myosin phosphotyrosine complex. J. Biol. Chem. 275(45), 35328 –35334.

27.

Wang, Z., Danielsen, A. J., Maihle, N. J., and McManus, M. J. (1999). Tyrosine phosphorylation of caldesmon is required for binding to the Shc.Grb2 complex. J. Biol. Chem. 274(47), 33807–33813.

28.

Connolly, D. C., Toutenhoofd, S. L., and Maihle, N. J. (1994). Tyrosine kinase activity may be necessary but is not sufficient for c-erbB1-mediated tissue-specific tumorigenicity. J. Virol. 68(10), 6804 – 6810.

29.

Hanks, S. K., Quinn, A. M., and Hunter, T. (1988). The protein kinase family: Conserved features and deduced phylogeny of the catalytic domains. Science 241(4861), 42–52.

30.

Cheng, K., and Koland, J. G. (1998). Nucleotide-binding properties of kinase-deficient epidermal-growth-factor-receptor mutants. Biochem. J. 330(Pt 1), 353–359.

31.

Ewald, J. A., Coker, K. J., Price, J. O., Staros, J. V., and Guyer, C. A. (2001). Stimulation of mitogenic pathways through kinase-impaired mutants of the epidermal growth factor receptor. Exp. Cell Res. 268(2), 262–273.

32.

Coker, K. J., Staros, J. V., and Guyer, C. A. (1994). A kinasenegative epidermal growth factor receptor that retains the capacity to stimulate DNA synthesis. Proc. Natl. Acad. Sci. USA 91(15), 6967– 6971.

33.

Kroiher, M., Miller, M. A., and Steele, R. E. (2001). Deceiving appearances: Signaling by “dead” and “fractured” receptor protein-tyrosine kinases. Bioessays 23(1), 69 –76.

34.

Waterman, H., Alroy, I., Strano, S., Seger, R., and Yarden, Y. (1999). The C-terminus of the kinase-defective neuregulin receptor ErbB-3 confers mitogenic superiority and dictates endocytic routing. Embo J. 18(12), 3348 –3358.

35.

Cohen, B. D., Kiener, P. A., Green, J. M., Foy, L., Fell, H. P., and Zhang, K. (1996). The relationship between human epidermal growth-like factor receptor expression and cellular transformation in NIH3T3 cells. J. Biol. Chem. 271(48), 30897–30903.

36.

Kim, H. H., Vijapurkar, U., Hellyer, N. J., Bravo, D., and Koland, J. G. (1998). Signal transduction by epidermal growth factor and heregulin via the kinase-deficient ErbB3 protein. Biochem. J. 334(Pt 1), 189 –195.

37.

Kraus, M. H., Fedi, P., Starks, V., Muraro, R., and Aaronson, S. A. (1993). Demonstration of ligand-dependent signaling by the erbB-3 tyrosine kinase and its constitutive activation in human breast tumor cells. Proc. Natl. Acad. Sci. USA 90(7), 2900 –2904.

38.

Zhang, K., Sun, J., Liu, N., Wen, D., Chang, D., Thomason, A., and Yoshinaga, S. K. (1996). Transformation of NIH 3T3 cells by HER3 or HER4 receptors requires the presence of HER1 or HER2. J. Biol. Chem. 271(7), 3884 –3890.

16 39.

DANIELSEN AND MAIHLE

Adelsman, M. A., Huntley, B. K., and Maihle, N. J. (1996). Ligand-independent dimerization of oncogenic v-erbB products involves covalent interactions. J. Virol. 70(4), 2533–2544. 40. Hiratsuka, S., Minowa, O., Kuno, J., Noda, T., and Shibuya, M. (1998). Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice. Proc. Natl. Acad. Sci. USA 95(16), 9349 –9354. 41. Kitayama, H., Tsujimura, T., Matsumura, I., Oritani, K., Ikeda, H., Ishikawa, J., Okabe, M., Suzuki, M., Yamamura, K., Matsuzawa, Y., Kitamura, Y., and Kanakura, Y. (1996). Neoplastic transformation of normal hematopoietic cells by constitutively activating mutations of c-kit receptor tyrosine kinase. Blood 88(3), 995–1004. 42. Lam, L. P., Chow, R. Y., and Berger, S. A. (1999). A transforming mutation enhances the activity of the c-Kit soluble tyrosine kinase domain. Biochem. J. 338(Pt 1), 131–138. 43. Moriyama, Y., Tsujimura, T., Hashimoto, K., Morimoto, M., Kitayama, H., Matsuzawa, Y., Kitamura, Y., and Kanakura, Y. (1996). Role of aspartic acid 814 in the function and expression of c-kit receptor tyrosine kinase. J. Biol. Chem. 271(7), 3347– 3350. 44. Hughes, S., and Kosik, E. (1984). Mutagenesis of the region between env and src of the SR-A strain of Rous sarcoma virus for the purpose of constructing helper-independent vectors. Virology 136(1), 89 –99. Received October 8, 2001 Revised version received January 22, 2002 Published online March 11, 2002

45.

Guy, P. M., Platko, J. V., Cantley, L. C., Cerione, R. A., and Carraway, 3rd, K. L. (1994). Insect cell-expressed p180erbB3 possesses an impaired tyrosine kinase activity. Proc. Natl. Acad. Sci. USA. 91(17), 8132– 8136.

46.

Beug, H., and Hayman, M. J. (1984). Temperature-sensitive mutants of avian erythroblastosis virus: Surface expression of the erbB product correlates with transformation. Cell 36(4), 963–972.

47.

Lin, S. Y., Makino, K., Xia, W., Matin, A., Wen, Y., Kwong, K. Y., Bourguignon, L., and Hung, M. C. (2001). Nuclear localization of EGF receptor and its potential new role as a transcription factor. Nat. Cell Biol. 3(9), 802– 808.

48.

Marti, U., and Wells, A. (2000). The nuclear accumulation of a variant epidermal growth factor receptor (EGFR) lacking the transmembrane domain requires coexpression of a full- length EGFR. Mol. Cell Biol. Res. Commun. 3(1), 8 –14.

49.

Marti, U., Ruchti, C., Kampf, J., Thomas, G. A., Williams, E. D., Peter, H. J., Gerber, H., and Burgi, U. (2001). Nuclear localization of epidermal growth factor and epidermal growth factor receptors in human thyroid tissues. Thyroid 11(2), 137–145.

50.

Ni, C. Y., Murphy, M. P., Golde, T. E., and Carpenter, G. (2001). Gamma-secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science 294(5549), 2179 –2181.