Lily ASR protein-conferred cold and freezing resistance in Arabidopsis

Plant Physiology and Biochemistry 49 (2011) 937e945

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Lily ASR protein-conferred cold and freezing resistance in Arabidopsis Yi-Feng Hsu, Shu-Chuan Yu, Chin-Ying Yang 1, Co-Shine Wang* Graduate Institute of Biotechnology, National Chung Hsing University, Taichung 40227, Taiwan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 January 2010 Accepted 2 July 2011 Available online 14 July 2011

The lily LLA23 protein is a member of the abscisic acid, stress and ripening-induced (ASR) protein family. Constitutive overexpression of LLA23 under the cauliflower mosaic virus 35S promoter confers cold and freezing tolerance in Arabidopsis. The phenotypical growth and survival percentage of the two transgenic 35S::LLA23 plants showed higher resistance to cold and freezing conditions than those of wild-type (WT) plants. The electrolyte leakage in WT leaves increased by approximately fourfold at
2  C relative to that at 22  C whereas both transgenic leaves showed little ion leakage under the same conditions. A microarray analysis of LLA23-overexpressing transgenic line, 35S::LLA23E, under normal growing conditions was previously conducted by Yang et al. (Protoplasma, 2008, 233:241e254). Microarray analysis showed that 12 cold-responsive genes are upregulated and 25 cold-responsive genes are downregulated by lily ASR. Many ASR-regulated genes encode proteins involved in the classes of defense/ stress-related, transcription, and metabolism. Quantitative polymerase chain reaction analysis confirms the changes in mRNA levels observed in the microarray analysis. Thus, our results provide in vivo evidence implying that LLA23 mediates cold/freezing stress-responsive signaling. To gain further insight into the functions of LLA23 protein, an in vitro enzyme protection assay was used in which lactate dehydrogenase and malate dehydrogenase were subjected to unfavorable conditions. The assay revealed that both enzyme activities were significantly retained with the addition of LLA23, which was superior to either trehalose or BSA, suggesting that the LLA23 protein can protect enzymatic activities against freezeethaw cycles. The 35S::LLA23 seedlings also exhibited enzyme activity superior to WT at
4  C. These results suggest that LLA23 may act as an osmoprotectant as well as a transcription factor to confer 35S::LLA23 plants enhanced cold and freezing resistance. Ó 2011 Elsevier Masson SAS. All rights reserved.

Keywords: ASR Cold-responsive genes Enzyme protection Lilium longiflorum Transgenic plants

1. Introduction The proteins encoded by Asr (named after abscisic acid, stress and ripening) genes were first reported in cultivated tomato plants [1]. Since then, they have been identified in various species of dicotyledonous and monocotyledonous plants [2,3]. ASR proteins are not only involved in plant development processes such as fruit ripening [1], pollen maturation [4] and glucose metabolism [3,5] but also respond to abiotic stresses [6e8]. Ectopic expression of Asr genes in plants confers tolerance to water-deficit and osmotic stress [9,10]. Recently, ectopic expression of an OsAsr1 cDNA was reported to

Abbreviations: BSA, bovine serum albumin; LDH, lactate dehydrogenase; LEA, late embryogenesis abundant; LLA, Lilium longiflorum anther; MDH, malate dehydrogenase; PCR, polymerase chain reaction; SDS-PAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; WT, wild-type. * Corresponding author. Tel.: þ886 4 2284 0328x771; fax: þ886 4 2285 3527. E-mail address: [email protected] (C.-S. Wang). 1 Current address: Agricultural Biotechnology Research Center, Academia Sinica, Nankang, Taipei 11529, Taiwan. 0981-9428/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2011.07.002

enhance cold tolerance in transgenic rice plants [11]. Since Asr gene encodes a transcription factor [12], it is important to analyze its expression and regulation. This analysis is crucial not only in understanding the molecular mechanisms of stress resistance and the responses of higher plants, but also in improving the stress tolerance of crops by gene manipulation. Using genome-wide microarray analysis, Yang et al. [13] have shown that the lily ASR modulates expression of hundreds of genes in the 35S::LLA23 transgenic plants. Despite the fact that many cold-responsive genes have been identified [14,15], to date, no data on these ASR-regulated genes responsive to cold stress have been documented. ASRs are members of the widespread class of hydrophilins which include the well-known late embryogenesis abundant (LEA) proteins [16]. The LEA protein was shown to be an osmoprotectant possessing chaperone-like property to protect enzymatic activities and prevent protein aggregation resulting from water deficiency [17e19]. Compatible solutes such as glycine betaine, proline and trehalose are other types of osmoprotectants that also increase the stability of native proteins and assist in the refolding of unfolded polypeptides [20]. The lily ASR in the 35S::LLA23 leaves exhibits

938

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

water-retaining ability [9]. Since LLA23 exists in abundance in the cytoplasm of dried pollen grains [4], it is possible that the protein plays an additional role in addition to being a transcription factor. The tomato ASR1 was recently reported to function as a chaperonelike protein, with possible synergism with glycine betaine [21]. To gain further insight into the function of the monocot ASR protein, we tested the activity of lactate dehydrogenase (LDH) and malate dehydrogenase (MDH) in vitro in the presence or absence of LLA23 and in the transgenic plants overexpressing LLA23. In previous works, the two enzymes have been chosen in the examination of enzyme inactivation because of their sensitivity to various stress conditions such as heat, freezeethaw cycles and lyophilization [22e24] and because it is easy to measure their enzymatic activities. Our results show that, under unfavorable conditions, the monocot ASR exhibits enzyme protection ability in vitro and in the 35S::LLA23 transgenic plants. The protection of protein denaturation is most likely general to all ASR proteins, from monocot, dicot, and probably gymnosperm species. We conclude that LLA23 acts as an osmoprotectant and as a transcription factor in the 35S::LLA23 transgenic plants, and that, both together contribute enhanced resistance to cold and freezing stresses. 2. Results 2.1. Cold and freezing resistances of 35S::LLA23 plants We have previously demonstrated that the 35S::LLA23 plants exhibit drought and salt resistance [9]. The two T3 homozygous lines with high LLA23 expression levels were further tested with cold/freezing stress. Three-week-old 35S::LLA23C, 35S::LLA23E and wild-type (WT) plants were examined in the growth chamber for resistance to cold/ freezing stress. When treated at various low temperatures (1e5  C) for 5 d, the growth of the two transgenic and WT plants was retarded; however, the two transgenic lines grew better than the WT plants: the leaf size of the transgenic lines were relatively larger than that of the WT (Fig. 1A), and the shoot length, which is essentially length of the flower stem, and weight of both transgenic lines were longer and heavier than those of WT plants (Fig. 1B). In addition, both transgenic lines showed early flowering property under low-temperature conditions. The 35S::LLA23C and 35S::LLA23E plants grew to flowering approximately 3 d and 5 d earlier than the WT plants although both transgenic lines exhibited no phenotypical alteration under normal growing conditions (Fig. 1A). Thus, these results suggest that the 35S::LLA23 lines exhibit better resistance to cold stress than the WT plants. Electrolyte leakage was also used to estimate cell damage at low temperatures. Increments in tissue electric conductivity were employed to indicate the degree of membrane injury in plants exposed to various low temperatures. When the transgenic and WT plants were incubated at different low temperatures (1e5  C) for 5 d, no significant ion leakage of transgenic and WT leaves was observed when compared with the unstressed conditions (data not shown). Three-week-old 35S::LLA23 and WT plants were grown at various freezing temperatures (
2 to
8  C) for 15 h. The temperature was then normalized to 22  C for a recovery period of 14 d. Phenotypically, the growth of the two transgenic lines at the freezing temperature was superior to that of the WT (Fig. 2A). The survival percentage under different freezing temperatures showed dramatic difference between the transgenic and WT plants (Fig. 2B). At
6 and
8  C, the proportion of surviving transgenic plants increased to 60 and 34%, which is at least threefold higher than that of the surviving WT plants (18 and 9%). Thus, both 35S::LLA23 lines showed better freezing tolerance than the WT. To minimize variation, the transgenic and WT plants were grown on soil in the same

Fig. 1. Cold tolerance of transgenic 35S::LLA23 plants. (A) Three-week-old 35S::LLA23C, 35S::LLA23E and WT plants were cold treated at 1, 3, and 5  C for 5 d and then transferred back to normal temperature (22  C) for recovery. A photograph of representative WT and 35S::LLA23 lines at 5  C was taken after 6 d of recovery. Sizes of WT and 35S::LLA23 leaves are shown at the bottom. (B) Shoot weight and length and leaf weight were measured at the end of cold treatment and recovery. Thirty plants of each genotype were used for each experiment and three independent trials were carried out. Asterisks indicate the significance of the difference from the corresponding WT values determined by Student’s t test (* 0.01  P < 0.05, **P < 0.01). Error bars represent SD.

container. The 35S::LLA23 transgenic lines also survived the freezing stress better than the WT plants (data not shown). Electrolyte leakage was also used to provide an estimate of membrane injury at freezing temperature conditions. When transgenic and WT plants were incubated at different freezing temperatures for 15 h, ion leakage in the WT leaves increased by approximately fourfold at
2  C, relative to that at 22  C, whereas both transgenic leaves showed little ion leakage under the same conditions (Fig. 2C). At
4  C, the transgenic leaves continued to exhibit less electrolyte leakage than the WT leaves. As the temperature decreased to
6  C and below, the electrolyte leakage in the transgenic leaves rapidly increased to a level similar to that in the WT leaves. Thus, these results also suggest that both transgenic lines exhibit higher resistance to freezing stress in comparison to WT plants. 2.2. Altered expression of cold-responsive genes in 35S::LLA23 plants To gain a more comprehensive view of gene expression regulated by LLA23, a microarray analysis of LLA23-overexpressing transgenic line, 35S::LLA23E, under normal growing conditions

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

939

Fig. 2. Freezing tolerance of transgenic 35S::LLA23 plants. (A) Three-week-old 35S::LLA23C, 35S::LLA23E and WT plants were frozen at
2,
4,
6 and
8  C for 15 h and then brought back to normal temperature (22  C) for recovery. Photographs of representative WT and 35S::LLA23 lines at
4, and
6  C were taken after 14 d of recovery. (B) Survival percentage of WT and 35S::LLA23 lines was quantitated 14 d after the freezing treatment. (C) Ion leakage of WT and 35S::LLA23 leaf was measured right after the freezing treatment for 15 h. Thirty plants of each genotype were used for each experiment and three independent trials were carried out. Asterisks indicate the significance of the difference from the corresponding WT values determined by Student’s t test (* 0.01  P < 0.05, **P < 0.01). Error bars represent SD.

[13] was previously conducted. For each of the 22,810 genes in the arrays, only those genes with high significance (P < 0.05) and highfold (2) change were selected. A total of 410 (206 upregulated and 204 downregulated) genes were revealed to have altered expression in LLA23-overexpressing plants. Of those 410 genes, 37 genes (12 upregulated and 25 downregulated) are related to cold response (Table 1), based on earlier reports of known coldresponsive genes [14,15]. Many of these ASR-regulated genes encode proteins involved in the classes of defense/stress-related, transcription, and metabolism. Therefore, gene members among these classes were selected for the analysis of quantitative polymerase chain reaction (Q-PCR). Q-PCR analysis confirmed the changes in mRNA levels observed in our microarray analysis. Without cold treatment (2  C), the transcript levels of several cold-regulated genes were enhanced in 35S::LLA23E as well as in 35S::LLA23C transgenic lines compared to the WT plants, implying gene upregulation mediated by LLA23 (Fig. 3). These include RD29b [25], KIN2 [26], ADH1 [27], and At2g33830 encoding a dormancy/auxin associated family protein. Meanwhile, the RNA levels of the cold-responsive genes including PR-5 [28], and At2g38470 encoding a WRKY family transcription factor were downregulated in 35S::LLA23 plants, also suggesting LLA23 mediated stress-responsive signaling. It is interesting that a 4-a-glucanotransferase gene (At5g64860) was upregulated under the normal growing conditions while it was downregulated upon cold treatments. On the contrary, a zinc finger family protein (At1g27730) was downregulated under the normal growing conditions while it was upregulated upon cold treatments. The expression patterns of the representative genes upon cold treatment were all in agreement with previously recorded gene expression patterns [14,15], with the exception of the two genes, PR-5 and At2g38470, as

their expression in transgenic lines remained the same level as WT upon cold treatment. Nevertheless, the RNA level of d (1)-pyrroline5-carboxylate synthetase 1 (P5CS1) did not appreciably change in 35S::LLA23 plants, suggesting that proline in transgenic lines remained the same as in WT plants (Fig. 3). P5CS1 is the ratelimiting enzyme in the biosynthesis of proline [29]. 2.3. The protective effect of purified LLA23 on enzymes upon cold and freezing treatments To evaluate the effect of enzyme protection by LLA23 during cycles of freezeethaw treatment, enzymes were mixed with purified E. coli expressed recombinant His-tagged LLA23. Trehalose (100 mM) and BSA (100 mM) were used as controls. As shown in Fig. 4, LDH and MDH significantly lost their activities when subjected to cycles of freezing in liquid nitrogen followed by thawing at ambient temperature. After more than four cycles of freezeethaw, both enzyme activities were significantly retained with the addition of 1 LLA23 (47 mM), superior to trehalose and BSA (Fig. 4). Further protection of enzyme activity was observed when 4 LLA23 was applied to either LDH or MDH (Fig. 4). It is worth noting that BSA, a cryoprotectant, showed partial protection of both enzymes after the treatments of freezeethaw cycles. 2.4. The 35S::LLA23 seedlings retained enzyme activity superior to WT seedlings The enzymatic activity of MDH in WT and transgenic seedlings was examined. The crude cell lysates were extracted from the WT and transgenic seedlings. Since 1 extract of cell lysates did not reveal detectable enzyme activity, 4 extract for MDH were thus

940

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

Table 1 ASR-regulated cold-responsive genes in unstressed 35S::LLA23 plants. Groupa

Gene identification

I

Cell wall biogenesis Expansin family protein (EXPL1) Expansin family protein (EXPL2) Defense/Stress-related Phosphate-responsive 1 family protein Dormancy/auxin associated family protein Putative/low temperature and salt responsive protein Desiccation-responsive protein 29B (RD29B)c Stress-responsive protein (KIN2)c Transcription TAZ zinc finger family protein Metabolism Thioredoxin family protein Isoflavone reductase, putative 4-alpha-glucanotransferase Asparagine synthetase 1 (glutamine-hydrolyzing) Alcohol dehydrogenase (ADH1)c Matel ion/Nucleic acid binding Heavy-metal-associated domain-containing protein Unknown Expressed protein Defense/Stress-related Heat shock cognate 70 kDa protein 3 (HSC70-3) Ethylene-responsive element-binding factor 5 (ERF5) Heat shock protein, putative Jasmonate insensitive1 (JIN1) Pathogenesis-related protein 5 (PR-5) Glycine-rich protein Transcription Zinc finger (CCCH-type) family protein Zinc finger (C2H2 type) family protein (ZAT10) Zinc finger (C2H2 type) family protein (ZAT12) WRKY family transcription factor Zinc finger (C2H2 type) family protein Zinc finger (CCCH-type) family protein Metabolism MutT/nudix family protein Glutaredoxin family protein 50 -adenylylsulfate reductase (APR1) Transporter Mitochondrial substrate carrier family protein Blue copper binding protein Matel ion/Nucleic acid binding Calcium-binding EF hand family protein Glycine-rich RNA-binding protein (GRP7) Suppressor of variegation related 1 (SUVR1) Others Male sterility MS5 family protein Male sterility MS5 family protein Regulator of chromosome condensation (RCC1) family protein Unknown Expressed protein Expressed protein

II

a b c

AGI code

Affymetrix number

Regulatedb under cold acclimation

At3g45970 At4g38400

252563_at 252997_at

[ [

At2g17230 At2g33830 At4g30660

263421_at 267461_at 253581_at

[ Y Y

At5g52300

248352_at

[

At5g15970

246481s_at

[

At5g67480

247013_at

[

At5g06690 At1g19540 At5g64860 At3g47340

250649_at 260662_at 247216_at 252415_at

Y Y Y Y

At1g77120

264953_at

[

At1g51090

245749_at

[

At4g16146

245319_at

Y

At3g09440

258979_at

[

At5g47230

248799_at

[

At2g04030 At1g32640 At1g75040 At3g04640

263483_at 261713_at 259925_at 258792_at

[ Y [ [

At2g40140 At1g27730 At5g59820 At2g38470 At5g04340 At3g55980

263379_at 261648_at 247655_at 267028_at 245711_at 251745_at

[ [ [ [ [ [

At1g73540 At1g64500 At4g04610

245777_at 261958_at 255284_at

[ [ Y

At4g24570

254120_at

[

At5g20230

246099_at

[

At1g76650 At2g21660 At1g04050

259879_at 263548_at 257404_at

[ [ [

At5g48850 At1g04770 At5g16040

248676_at 261177_at 246484_at

Y Y [

At1g19180 At5g65300

256017_at 247177_at

[ [

ASR-regulated genes are categorized into two groups. Group I/II genes are induced/repressed more than two-fold in 35S::LLA23 plants. Up- or down-regulation upon cold stress is marked as [/Y reported from a cold-regulated microarray database [14]. Gene is induced less than two-fold in 35S::LLA23 plants.

utilized. At normal temperature conditions (22  C), both 35S::LLA23C and 35S::LLA23E seedlings displayed MDH activity similar to that in the WT seedlings (Fig. 5). However, when plants were treated at freezing temperature (
4  C) for 24 h after which the crude cell lysates were immediately extracted for enzymatic assay. It revealed that both 35S::LLA23C and 35S::LLA23E seedlings

displayed MDH activity 26 and 33% higher than the WT, respectively when the activity was monitored at 2 min of the enzyme reaction (Fig. 5). The result was carried out in both biological repeats and sample repeats at least three times. Thus, both transgenic seedlings exhibited better MDH activity than WT seedlings. The enzymatic activity of LDH in WT and transgenic seedlings was

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

941

Fig. 3. Quantitative PCR analysis of selected cold-responsive genes regulated by ASR in 35S::LLA23 plants. RNA levels of cold-responsive genes were determined by Q-PCR using total RNAs isolated from ten three-week-old 35S::LLA23C, 35S::LLA23E and WT seedlings grown on MS plates either at normal temperature (22  C) or at 2  C for 3 d. The data were obtained from three biologically independent experiments. Asterisks indicate the significance of the difference from the corresponding WT values determined by Student’s t test (* 0.01  P < 0.05, **P < 0.01). The error bars represent SD. Detector probes: RD29b, ADH1, KIN2, At2g33830, At5g64860, At2g38470, At1g27730, PR-5, and P5CS1.

also examined. However, the LDH activity in 35S::LLA23 seedlings did not appreciably increase compared to that in WT seedlings, even at temperatures down to
8  C (data not shown). 3. Discussion This study demonstrates that the LLA23 protein confers 35S::LLA23 transgenic plants with enhanced cold and freezing

resistances. The transgenic plants exhibit enzyme activity superior to WT plants under freezing temperature treatments. This correlates with an enzyme protection assay where the enzyme activities of LDH and MDH are significantly retained by the addition of purified LLA23. This suggests that LLA23 may act as an osmoprotective molecule to protect protein from denaturation. Recently, Konrad and Bar-Zvi [21] also reported that the tomato ASR1 protein exhibits a synergistic enzyme protection with glycine betaine. Thus,

942

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

Fig. 4. Protective effect of LLA23 on enzymes subjected to freezeethaw cycles in vitro. The LDH (A) or MDH (B) activity was determined at 60 s after the enzyme was frozen alone in liquid nitrogen and thawed at room temperature for 2, 4, or 6 cycles or in the presence of 1 LLA23 (47 mM), 4 LLA23, trehalose (100 mM), or BSA (100 mM) in a total volume of 50 ml. Enzyme activity is expressed as percentage of control activity. The values were obtained from three independent experiments. Asterisks indicate the significance of the difference from the corresponding WT values determined by Student’s t test (* 0.01  P < 0.05, **P < 0.01). Error bars represent SD (n ¼ 5).

this study demonstrates the first monocot ASR exhibiting the function of enzyme protection against cold and freezing conditions. We conclude that the protection of protein denaturation is most likely general to all ASR proteins, from monocot, dicot, and probably gymnosperm species.

0.8 0.7 0.6

OD340

0.5

w/o extract addition WT, -4

0.4

-4 C 35S::LLA23C, -4

0.3

-4 C 35S::LLA23E, -4

WT, 22

0.2

22 C 35S::LLA23C, 22

0.1

35S::LLA23E, 22 22 C MDH

0 0

8

16 24 32 40 48 56 64 72 80 88 96 104 112 120

Reaction time (s) Fig. 5. Protective effect on enzyme activity in 35S::LLA23 plants. The crude cell lysates were extracted from 35S::LLA23C, 35S::LLA23E and WT seedlings subjected to freezing (
4  C) and normal temperature (22  C) conditions for 24 h after which the crude cell lysates were immediately extracted. According to the decrease at 340 nm absorbance, the kinetics of MDH activity was measured in individual reaction set for 2 min with the enzyme alone (5 mM) or with or without 4 extract. An amount of 1 extract corresponds to 10 mg of total protein. The values were obtained from three independent experiments.

Phenotypically, the 35S::LLA23 plants grow differently from the WT plants under cold and freezing conditions. Both transgenic lines exhibit early flowering property under low-temperature conditions. Although all plants survived at cold temperature conditions and at
2  C, the WT leaves grew smaller than the transgenic leaves (Fig. 1). This is also reflected by the fact that the electrolyte leakage in WT leaves at
2  C showed an approximately fourfold increase in comparison with that at 22  C, whereas both transgenic leaves showed little electrolyte leakage under the same conditions (Fig. 2C). As the freezing temperature decreases to
6  C or below, the proportion of surviving transgenic plants is at least threefold more than that of surviving WT plants. We have hypothesized that the 35S::LLA23 plants plays a dual role, acting as a regulator as well as a protective molecule upon water-deficit [8]. The ground level of protection results from the high hydrophilicity of the LLA23 protein, which may display enhanced water-retaining ability and retain other proteins’ function against unfavorable stresses. This hypothesis is supported by an in vitro enzyme protection assay where LDH and MDH activities are significantly retained when purified LLA23 is added. The concept of LLA23 acting as an osmoprotective molecule to protect protein from denaturation is further reinforced by the fact that the transgenic seedlings exhibit enzyme activity superior to WT seedlings under freezing treatments. The secondary level of protection results from the regulatory properties of LLA23 proteins in the transgenic plants where other osmoprotective molecules may be induced by LLA23, which, accordingly, enhances stress tolerance. This is evidenced by the fact that, in the presence of LLA23, the unstressed transgenic plants alter transcript levels of 410 genes in Arabidopsis [13]. Of those, many are related to cold response (Table 1). Therefore, LLA23 in 35S::LLA23 lines mediates cold-responsive signaling. The 37 coldresponsive genes regulated by ASR encode proteins involved in defense/stress-related, transcription, and metabolism. Quantitative PCR analysis confirms the changes in mRNA levels observed in the microarray analysis. However, those genes whose expression is changed at least two-fold in the microarray analysis do not exhibit an equivalent level of change shown in the Q-PCR analysis. This inconsistency may be due to difference in sensitivity of the instrument used. The expression patterns of the representative genes upon cold treatments are consistent with gene expression patterns previously documented [14,15], with an exception of two genes, PR-5 and At2g38470, where their expression in transgenic lines remain the same level as WT upon cold treatment. Transcripts of P5CS1, however, do not increase their levels of accumulation in 35S::LLA23 plants, although proline is generally found in abundance in stressed plants. This is contradictory to a previous report that proline accumulates in tobacco plants overexpressing tomato ASR1 under salt stress [8]. The sensitivity of LDH and MDH activities upon cold and freezing stresses allows us to investigate the protective effect of LLA23. Results show that under cycles of freezeethaw conditions, the LLA23 protein provides a level of enzyme protection superior to BSA or trehalose, two well-known stabilizers. The amount of purified 1 LLA23 protein needed to exhibit protective effects on MDH activity is only half the needed amount of trehalose on a molar basis. Therefore, the protective effect of LLA23 on MDH is superior to either trehalose or BSA. However, the protective effect of LLA23 on LDH is less strong than MDH (Fig. 4). It may be reflected by the fact that the biological activity site of MDH from pig heart is much more conserved with Arabidopsis MDH than that of LDH from rabbit muscle with Arabidopsis LDH although the two animal enzymes share similar level of similarity (72e75%) with Arabidopsis enzymes. In addition, the in vitro enzyme protection assay correlates with the assay observed in the seedlings of 35S::LLA23 and WT seedlings where two times as much as extract of cell lysates and

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

943

4. Materials and methods

by NdeI, and another is LLA23-rev. (50 -CCGCTCGAGACCGAAGAAGTGGTGCTTCT-30 ) containing XhoI. Thus, the fragment of 444 bp containing the coding region of LLA23 was therefore cloned into the NdeI/XhoI-cut pET32a expression vector (Novagen, Darmstadt, Germany) to generate an expression plasmid designated pET32aLLA23. The resultant construct was transformed into E. coli strain DH10B and plasmid DNA was isolated by Plasmid Miniprep Purification Kit (GeneMark Technology Co. Ltd., Tainan, Taiwan). After confirmation of sequencing, the purified plasmid was then transformed into E. coli strain BL21 (DE3). The bacterial cells were grown on LB medium (1% Bacto tryptone, 0.5% Bacto yeast extract, and 170 mM NaCl, pH 7.0) containing ampicillin (50 mg ml
1) at 37  C until an OD600 between 0.6 and 0.8 was reached. At this point, isopropyl-Dthiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM and cells were incubated for additional 4 h. After harvest, the cell pellet was resuspended in 200 ml of resolubilization solution (100 mM NaCl, 1 mM DTT, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride and 10 mM TriseHCl, pH 7.4), sonicated and centrifuged at 16,000  g for 5 min. The overexpressed LLA23 protein which is Histagged in the supernatant was centrifuged, precipitated by acetone, resuspended in the resolubilization solution and purified by Ni-NTA agarose (Qiagen, Hilden, Germany). The purified His-tagged LLA23 protein was dialyzed against dialysis buffer (300 mM NaCl, 50 mM Tris-HCl, pH 7.5, 10 mM b-mercaptoethanol) overnight with one change of the buffer.

4.1. Plant material and other chemicals

4.4. In vitro and in vivo freezing protection assays

Arabidopsis thaliana plants (Col ecotype) were used in this study. The two T3 homozygous lines of 35S::LLA23 [9] and WT seeds (at least 30 seeds each) were sterilized and kept for 4 d at 4  C in the dark to break dormancy. Seeds were grown at 22  C under long day conditions (16-h-light/8-h-dark cycle) aseptically or on soil. For soil growth, seed were sown on a 1:1:8 mixture of vermiculite, perlite, and peat moss irrigated with water, and transferred to normal growth conditions. Unless stated otherwise, the plants were watered every other day. BSA and trehalose were purchased from Sigma (St. Louis, USA). LDH (EC 1.1.1.27) from rabbit muscle and MDH (EC 1.1.1.37) from pig heart were obtained from Roche (Penzberg, Germany).

For the in vitro enzyme protection assay, 200 mM LDH or MDH in a final volume of 50 ml of buffer (25 mM Tris-HCl, pH 7.0) was added with or without additives. The additives were used including 100 mM BSA, 100 mM trehalose or 1 (47 mM) or 4 (188 mM) concentrations of LLA23. For MDH, a buffer of 150 mM potassium phosphate, pH 7.5 was used instead. The mixture in a microfuge tube was frozen in liquid nitrogen for 10 s and thawed at room temperature for various cycles. To determine LDH or MDH activity, 2 ml out of 50 ml of a mixture treated with various freezeethaw cycles was taken into a 1 ml of solution [100 mM sodium phosphate, pH 6.0, 100 mM NADH (Sigma, St. Louis, USA) and 2 mM pyruvate] in which the concentration of LDH for activity assay is 0.4 mM. That the rate of decrease in absorbance at 340 nm is monitored every 2 s for 2 min is a measure of LDH activity due to the conversion of NADH into NAD at 25  C in a JASCO V-550 spectrophotometer (JASCO, Tokyo, Japan). To measure MDH activity, the solution of 150 mM potassium phosphate, pH 7.5, 100 mM NADH and 200 mM oxaloacetate was used instead and the concentration of MDH for activity assay remained 0.4 mM. Three independent experiments were performed and all samples were assayed in triplicate. For the in vivo enzyme assay, about 100 transgenic and WT seeds were sterilized and planted individually in agar plates containing Murashige-Skoog (MS) salts (Duchefa, Haarlem, The Netherlands). Three-week-old 35S::LLA23 and WT plants were frozen at
4  C for 24 h after which the crude cell lysates were extracted from transgenic and WT seedlings according to the method described by Maldonado et al. [33] with some modifications. One gram of seedlings from 35S::LLA23 and WT plants at
4  C and normal temperature (22  C) conditions was extracted with 2 ml of extraction buffer (50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2% PVP40, 1 mM PMSF, 2 mM EDTA, 10 mM b-mercaptoethanol). After two runs of centrifugation with 13,600  g, the supernatant of cell lysates was used for the assay of enzyme activity. The measurement of LDH and MDH activity in vivo is as same as described above. Immediately before the analysis of LDH activity, the control set without any addition, 5 mM LDH, or 8 extract of cell

longer reaction time were used in the analysis of LDH activity. Thus, we demonstrate the first monocot ASR exhibiting the function of enzyme protection against cold and freezing conditions. The LLA23 protein at the molecular level may stabilize cellular structures and macromolecules. The protective property of lily ASR in this sense is similar to dehydrins [18], another class of hydrophilins has been proposed. The highly hydrophilic segments of LLA23 proteins may hold water molecules around macromolecules; evidence for the water-retaining ability of LLA23 has been proven by ectopic expression of the LLA23 gene in Arabidopsis [9]. Alternatively, the ASR protein may use its own polar residues residing in the intrinsically unfolded structure to interact with other proteins, effectively replacing water under various stress conditions. The last possibility is most likely to occur in dried pollen as the ASR protein accumulates in abundance in the pollen grains [30]. Along the same line, the protective effect may also contribute cold/freezing tolerance of pollen. Owing to the physicochemical properties of LLA23, we suggest that, in addition to acting as a transcription factor as confirmed by DNA binding analysis [31,32], the protein protects enzyme activities upon cold and freezing stresses by a mechanism involving both retention of water molecules and a proteineprotein interaction that may help to prevent enzyme changes in the tertiary structure.

4.2. Bioassay for cold and freezing tolerance Three-week-old 35S::LLA23 and WT plants were cold treated at 1, 3, and 5  C for 5 d and then transferred back to normal temperature conditions for recovery. On the 6th day after transfer, shoot weight and length and leaf weight were measured. Threeweek-old 35S::LLA23 and WT plants were frozen at
2,
4,
6 and
8  C for 15 h and then transferred back to normal temperature conditions for recovery. On the 14th day after transfer, survival of plants was recorded. Ion leakage of 35S::LLA23 and WT leaves was measured right after either the cold treatment for 5 d or the freezing treatment for 15 h. The 35S::LLA23 and WT leaves with similar sizes were collected. The leaf samples were placed in 10-ml of deionized water and kept in the dark for 24 h at room temperature. The electrical conductance of the leachate was measured using a conductivity meter (SUNTEX, SC-170). The relative amount of leakage is expressed as a percentage of the maximum conductance measured after boiling the same leaf samples for 10 min. 4.3. Overexpression and purification of the LLA23 protein in E. coli PCR was used to amplify LLA23 cDNA. This was carried out with two gene-specific primers, one of which is LLA23-for. (50 -CCGGAATTC CATATGGCCGAGGAGCACCACAA-30 ) containing an EcoRI site followed

944

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945

Table 2 Primers used for Q-PCR analyses of selected cold-responsive genes in transgenic 35S::LLA23 Arabidopsis. F, forward primer; R, reverse primer. Gene Name

Sequence (50 to 30 )

RD29b

F: GTGAAGATGACTATCTCGGTGGTC R: GCCTAACTCTCCGGTGTAACCTAG F: TCCACGTATCTTCGGCCATG R: TAGCACCTTCTGCAGCGCC F: GAGACCAACAAGAATGCC R: TCGGATCGCTACTTGTTC F: AGTAAGTACTTCACACTTGACACA R: TCCTGGATGAAACACACTTCTCCA F: GCAGCTGTCCTCAGGAACAG R: CTCCGAGATCACCAATGCCA F: TCTTACAATGGACAATAGCAGA R: AGAAGCTAGAACGTTAGCAGA F: TTCCATGGAGTCGAGCACTG R: CTTACGGTGGCTTGCCTTGT F: TGTTATGGCCACAGACTTCA R: GTCTCCGGTTACACATCTAC F: GTGGCTCGCTTAGTTATG R: GGAATGTCCTGATGGGTG F: CATCAGGAAGGACTTGTACGG R: GATGGACCTGACTCGTCATAC

ADH1 KIN2 At2g33830 At5g64860 At2g38470 At1g2773 PR-5 P5CS1 ACTIN

lysates (80 mg of total protein) were added into a final volume of 1 ml of reaction solution [100 mM sodium phosphate, pH 6.0, 100 mM NADH and 2 mM pyruvate]. However, the rate of decrease in absorbance at 340 nm is monitored every 4 s for 2 min. For MDH, the control set without any addition, 5 mM MDH, or 4 extract (40 mg of total protein) were added into a final volume of 1 ml of reaction solution [150 mM potassium phosphate, pH 7.5, 100 mM NADH and 200 mM oxaloacetate] before measurement. Three independent experiments were performed and all samples were assayed in triplicate. 4.5. Quantitative-PCR Total RNA was extracted from seedlings of three-week-old 35S::LLA23 and WT plants grown on MS plates using Trizol reagent (Invitrogen). The first-stranded cDNA was synthesized with 3 mg total RNA using oligo(dT) primer according to the manufacturer’s protocol (M-MLV Reverse Transcriptase, Invitrogen Life Technologies, Carlsbad, CA, USA). For real-time Q-PCR, the cDNA was amplified in the presence of SYBR Green I Nucleic Acid Stain (Cambrex 50513) 104 dilution from stock and using a Rotor-Gene 3000 (Corbett, Australia). Amplification of actin cDNA under identical conditions was used as an internal control to normalize the level of cDNA. The data obtained were analyzed with Rotor-Gene 6 software (Corbett). Specific melting temperatures obtained for ACTIN (89  C), KIN2 (91  C), RD29b (88  C), P5CS1 (88  C), ADH1 (88  C), PR-5 (93  C), At2g33830 (80  C), At5g64860 (90  C), At2g38470 (88  C) and At1g27730 (91  C) validated the specific product formation. Primers used in the Q-PCR reactions are listed in Table 2 . Q-PCR experiments were repeated three times independently, and the data were averaged. Acknowledgments This work was supported by National Science Council grant NSC 98-2311- B-005-003-MY3 to Co-Shine Wang. References [1] N.D. Iusem, D.M. Bartholomew, W.D. Hitz, P.A. Scolnik, Tomato (Lycopersicon esculentum) transcript induced by water deficit and ripening, Plant Physiol. 102 (1993) 1353e1354.

[2] N. Frankel, F. Carrari, E. Hasson, N.D. Iusem, Evolutionary history of the Asr gene family, Gene 378 (2006) 74e83. [3] F. Carrari, A.R. Fernie, N.D. Iusem, Heard it through the grapevine? ABA and sugar cross-talk: the ASR story, Trends Plant Sci. 9 (2004) 57e59. [4] C.S. Wang, T.D. Wu, C.K.W. Chung, E.M. Lord, Two classes of pollen-specific, heat-stable proteins in Lilium longiflorum, Physiol. Plant 97 (1996) 643e650. [5] N. Frankel, A. Nunes-Nesi, I. Balbo, J. Mazuch, D. Centeno, N.D. Iusem, A.R. Fernie, F. Carrari, ci21A/Asr1 expression influences glucose metabolism in potato tubers, Plant Mol. Biol. 63 (2007) 719e730. [6] H.Y. Liu, J.R. Dai, D.R. Feng, B. Liu, H.B. Wang, J.F. Wang, Characterization of a novel plantain Asr gene, MpAsr, that is regulated in response to infection of Fusarium oxysporum f. sp. cubense and abiotic stresses, J. Integr. Plant Biol. 52 (2010) 315e323. [7] A. Schneider, F. Salamini, C. Gebhardt, Expression patterns and promoter activity of the cold-regulated gene ci21A of potato, Plant Physiol. 113 (1997) 335e345. [8] Y. Kalifa, E. Perlson, A. Gilad, Z. Konrad, P.A. Scolnik, D. Bar-Zvi, Overexpression of the water and salt stress-regulated Asr1 gene confers an increased salt tolerance, Plant Cell Environ. 27 (2004) 1459e1468. [9] C.Y. Yang, Y.C. Chen, G.Y. Jauh, C.S. Wang, A Lily ASR protein involves abscisic acid signaling and confers drought and salt resistance in Arabidopsis, Plant Physiol. 139 (2005) 836e846. [10] J.R. Dai, B. Liu, D.R. Feng, H.Y. Liu, Y.M. He, K.B. Qi, H.B. Wang, J.F. Wang, MpAsr encodes an intrinsically unstructured protein and enhances osmotic tolerance in transgenic Arabidopsis, Plant Cell Rep. (2011). doi:10.1007/s00299-0111030-1. [11] S.J. Kim, S.C. Lee, S.K. Hong, K. An, G. An, S.R. Kim, Ectopic expression of a coldresponsive OsAsr1 cDNA gives enhanced cold tolerance in transgenic rice plants, Mol. Cell 27 (2009) 449e458. [12] A. Saumonneau, A. Agasse, M.T. Bidoyen, M. Lallemand, A. Cantereau, A. Medici, M. Laloi, R. Atanassova, Interaction of grape ASR proteins with a DREB transcription factor in the nucleus, FEBS Lett. 582 (2008) 3281e3287. [13] C.Y. Yang, C.H. Wu, G.Y. Jauh, J.C. Huang, C.C. Lin, C.S. Wang, The LLA23 protein translocates into nuclei shortly before desiccation in developing pollen grains and regulates gene expression in Arabidopsis, Protoplasma 233 (2008) 241e254. [14] M. Seki, M. Narusaka, J. Ishida, T. Nanjo, M. Fujita, Y. Oono, A. Kamiya, M. Nakajima, A. Enju, T. Sakurai, M. Satou, K. Akiyama, T. Taji, K. YamaguchiShinozaki, P. Carninci, J. Kawai, Y. Hayashizaki, K. Shinozaki, Monitoring the expression profiles of 7000 Arabidopsis genes under drought, cold and highsalinity stresses using a full-length cDNA microarray, Plant J. 31 (2002) 279e292. [15] Y. Oono, M. Seki, M. Satou, K. Iida, K. Akiyama, T. Sakurai, M. Fujita, K. Yamaguchi-Shinozaki, K. Shinozaki, Monitoring expression profiles of Arabidopsis genes during cold acclimation and deacclimation using DNA microarrays, Funct. Integr. Genomics 6 (2006) 212e234. [16] M. Battaglia, Y. Olvera-Carrillo, A. Garciarrubio, F. Campos, A.A. Covarrubias, The enigmatic LEA proteins and other hydrophilins, Plant Physiol. 148 (2008) 6e24. [17] M. Momma, S. Kaneko, K. Haraguchi, U. Matsukura, Peptide mapping and assessment of cryoprotective activity of 26/27-kDa dehydrin from soybean seeds, Biosci. Biotechnol. Biochem. 67 (2003) 1832e1835. [18] K. Goyal, L.J. Walton, A. Tunnacliffe, LEA proteins prevent protein aggregation due to water stress, Biochem. J. 388 (2005) 151e157. [19] J.L. Reyes, M.J. Rodrigo, J.M. Colmenero-Flores, J.V. Gil, A. Garay-Arroyo, F. Campos, F. Salamini, D. Bartels, A.A. Covarrubias, Hydrophilins from distant organisms can protect enzymatic activities from water limitation effects in vitro, Plant Cell Environ. 28 (2005) 709e718. [20] S. Diamant, N. Eliahu, D. Rosenthal, P. Goloubinoff, Chemical chaperones regulate molecular chaperones in vitro and in cells under combined salt and heat stresses, J. Biol. Chem. 276 (2001) 39586e39591. [21] Z. Konrad, D. Bar-Zvi, Synergism between the chaperone-like activity of the stress regulated ASR1 protein and the osmolyte glycine-betaine, Planta 227 (2008) 1213e1219. [22] J.F. Carpenter, S.J. Prestrelski, T. Arakawa, Separation of freezing- and dryinginduced denaturation of lyophilized proteins using stress-specific stabilization, Arch. Biochem. Biophys. 250 (1993) 505e512. [23] A. Dong, S. Prestrelski, S. Allison, J. Carpenter, Infrared spectroscopic studies of lyophilization- and temperature-induced protein aggregation, J. Pharmacol. Sci. 84 (1995) 415e424. [24] T.J. Anchordoquy, J.F. Carpenter, Polymers protect lactate dehydrogenase during freeze-drying by inhibiting dissociation in the frozen state, Arch. Biochem. Biophys. 332 (1996) 231e238. [25] K. Yamaguchi-Shinozaki, K. Shinozaki, A novel cis-acting element in an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress, Plant Cell 6 (1994) 251e264. [26] S. Kurkela, M. Borg-Franck, Structure and expression of kin2, one of two coldand ABA-induced genes of Arabidopsis thaliana, Plant Mol. Biol. 19 (1992) 689e692. [27] G.L. de Bruxelles, W.J. Peacock, E.S. Dennis, R. Dolferus, Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis, Plant Physiol. 111 (1996) 381e391. [28] P. Xu, E.B. Blancaflor, M.J. Roossinck, In spite of induced multiple defense responses, tomato plants infected with Cucumber mosaic virus and D satellite RNA succumb to systemic necrosis, Mol. Plant Microbe. Interact 16 (2003) 467e476. [29] Y. Yoshiba, T. Nanjo, S. Miura, K. Yamaguchi-Shinozaki, K. Shinozaki, Stressresponsive and developmental regulation of d(1)-pyrroline-5-carboxylate

Y.-F. Hsu et al. / Plant Physiology and Biochemistry 49 (2011) 937e945 synthetase 1 (P5CS1) gene expression in Arabidopsis thaliana, Biochem. Biophys. Res. Commun. 261 (1999) 766e772. [30] H.J. Wang, C.M. Hsu, G.Y. Jauh, C.S. Wang, A lily pollen ASR protein localizes to both cytoplasm and nuclei requiring a nuclear localization signal, Physiol. Plant 123 (2005) 314e320. [31] Y. Kalifa, A. Gilad, Z. Konrad, M. Zaccai, P.A. Scolnik, D. Bar-Zvi, The water- and salt-stress-regulated Asr1 (abscisic acid stress ripening) gene encodes a zincdependent DNA-binding protein, Biochem. J. 381 (2004) 373e378.

945

[32] L. Maskin, N. Frankel, G. Gudesblat, M.J. Demergasso, L.I. Pietrasanta, N.D. Iusem, Dimerization and DNA-binding of ASR1, a small hydrophilic protein abundant in plant tissues suffering from water loss, Biochem. Biophys. Res. Commun. 352 (2007) 831e835. [33] R. Maldonado, M.T. Sanchez-Ballesta, R. Alique, M.I. Escribano, C. Merodio, Malate metabolism and adaptation to chilling temperature storage by pretreatment with high CO2 levels in Annona cherimola fruit, J. Agric. Food Chem. 52 (2004) 4758e4763.