Lineage specification of olfactory neural precursor cells depends on continuous cell interactions

DEVELOPMENTAL BRAIN RESEARCH

ELSEVIER

Developmental Brain Research 96 (1996) 11-27

Research report

Lineage specification of olfactory neural precursor cells depends on continuous cell interactions Lorenzo Magrassi *, Pasquale P.C. Graziadei Department of Biological Science, Florida State University, Tallahassee, FL 32306-4075, USA Accepted 19 March 1996

Abstract

We transplanted, as a single cell suspension, cells dissociated from the mature and immature olfactory epithelium of rats or TgR(ROSA26)26Sor mice expressing constitutively the LacZ gene into the developing brain (cerebellum, striatum, inferior colliculus, lateral ventricles) of El5 rat fi~tuses. Grafted cells or their descendants were still present in the central nervous system more than a month after transplantation. Transplanted cells either integrated as isolated cells or, during the first day after transplantation, reaggregated into clusters. Scattered cells, despite their placodal origin, differentiated into neuron or glial cells with a central phenotype. This was demonstrated by anatomical methods and selective amplification of cDNA encoding for neuronal specific transcripts (microtubule-associated protein 2 and middle-molecular-mass neurofilament protein) expressed by the engrafted cells. Cells in large clusters generated an epithelium containing mature olfactory neurons. Some of them were immunoreactive for the olfactory marker protein. Our findings show that cells dissociated from the developing and adult olfactory organs when transplanted into the rat fetal brain can either completely change their fate and differentiate according to their final position or generate an olfactory epithelium if they reaggregate into large clusters. Keywords: Olfactory neurons; Central nervous system; Intra-uterus transplantation; Differentiation; Cell reaggregation

1. Introduction

The influence of the environment on the differentiation of neural precursors has been demonstrated by heterotopic transplantation of neural crest cells [17], genetically modified neural precursors [68,75], and neuroblasts [22,46,62]. However, it is still unclear if neural precursors will differentiate only according to the new environment and if neural precursors present in specialized locations of the adult nervous system will also change their differentiative potential after transplantation. A major site of neuronal renewal in the adult nervous system is the olfactory epithelium [32,33,66,93]. The olfactory neuron precursors originate from the olfactory placodes, structures whose developmental history is distinct from that of the neural plate [30,48]. In amphibians, when

* Corresponding author. Clinic~ Neurochirurgica, IRCCS Policlinico S. Matteo, P.le Golgi 2, Pavia 27100, Italy. Fax: (39) (382) 422231 or 527097; E-mail: gruppo300@ipv~be.igbe.pv.cnr.it 0165-3806/96/$15.00 Copyright © 1996 Elsevier Science B.V. PII S01 6 5 - 3 8 0 6 ( 9 6 ) 0 0 0 6 8 - 5

olfactory placodes are transplanted to an ectopic position along the neural axis, they differentiate into olfactory organs [56,92]. In mammals, transplantation of olfactory pits or fragments of olfactory mucosa either to the anterior chamber of the eye of adult rats [37] or the neonatal brain [34,65] demonstrates that these structures are able to differentiate into an olfactory epithelium even in the absence of their appropriate target. However, cells that become separated from the olfactory epithelium and migrate along the olfactory nerves may contribute to the regeneration of the telencephalon after its experimental ablation in anuran larvae [44,47,50]. The cerebral protrusion induced by ectopic transplantation of the olfactory placode [56] has also been shown to be partially supported by cells migrating from the transplanted placode [49]. Finally cells derived from the developing olfactory organ may participate under normal conditions in the formation of non-olfactory nervous structures in amphibians [16]. Cells migrating out from the olfactory mucosa in situ or after transplantation into the CNS have

12

L. Magrassi, P.P.C. Graziadei / Det'elopmental Brain Research 96 (1996) 11-27

been repeatedly described also in adult mammals [34]. Although the fate of these cells is unclear, their destiny is obviously different from that of the cells that remain in the epithelial compartments [64]. In vitro attempts to permanently reconstitute the olfactory epithelium dynamics from cells dissociated from the olfactory mucosa have met with limited success [11,15,59,71,72,78]. In addition, expression of neurofilament [95] or glial fibrillar acidic protein [83,95] has repeatedly been described in cell cultures derived from the olfactory epithelium, whereas these proteins are not, or only at a very low level, expressed in vivo [21]. These observations suggest that local intra-epithelial conditions strongly influence the olfactory neuron precursor's differentiative ability. We were interested to test whether cells dissociated from the olfactory epithelium are able to change their differentiative program and acquire a central phenotype once integrated into the brain. In this work we show that cells dissociated from the developing or adult olfactory organ of rats and mice, when transplanted into the developing brain give rise to neurons and glia with phenotypes determined by their final location. However, if these cells reaggregate and form large clusters after grafting, they generate an epithelium with mature olfactory neurons inside the brain of the host. A preliminary account of these results has been presented in abstract form [57,58].

Donor embryos (El3) were derived from four pregnant R26 mice; two adult (3-4 months) R26 females were used as donors of adult olfactory mucosa. Care of the animals and experiments were performed according to the principles expressed in The Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, revised 1985). 2.2. Tissue dissection

Grafted cells were obtained from the posterior two-thirds of the olfactory pit (E12-E13) or later (E14-EI8) from the posterior third of the developing olfactory mucosa. This was done in order to minimize the number of respiratory mucosa precursors in the final cell suspension. The epithelium in the olfactory pits and in the developing olfactory organs was always dissected as free as possible from the surrounding mesenchymal tissue. Cells collected from adult animals were only obtained from the olfactory mucosa covering the posterior third of the septum. No respiratory elements are present in this area of the mucosa. The mucosa and the lamina propria were not separated before cell dissociation. For each transplantation experiment we pooled on average 12-14 posterior two-thirds of olfactory pits, derived from 6-7 donor rat embryos, or 6-8 posterior thirds of developing olfactory mucosae, derived from 2-3 rats or R26 mice fetuses, or two posterior thirds of adult septal olfactory mucosa, derived from one rat or R26 mouse.

2. Materials and methods 2.3. Dissociation 2.1. Animals

All the rats employed were Sprague-Dawley (Charles River). Thirty-two timed-pregnant Sprague-Dawley rats were used as a source of host embryos aged El5. Embryonic and fetal olfactory organs were derived from 10 timed-pregnant rats at the age appropriate for the experiment (from El0 to E15). Six female adult rats (2-3 months of age) were used as a source of mature olfactory mucosa. Tissue for xenograft experiments was derived from the developing and adult olfactory organs of TgR(ROSA26)26Sor transgenic mice (R26) (Jackson Laboratory, Bar Harbor, ME); the R26 mice used for breeding were homozygous for the transgene. R26 is a transgenic mice obtained by infecting embryonic stem cells with a retroviral vector carrying a promoter trap allowing the expression of E. coli LacZ gene from an endogenous promoter in the mouse genome. The integration event peculiar to R26 led to the expression of [3-galactosidase at levels detectable by histochemistry in all tissues of the developing mice [23]. Expression of the transgene is also maintained in the cells of the adult central nervous system and olfactory mucosa (Magrassi and Graziadei, unpublished observations), however the levels of expression vary according to the location and the histotype of the cells.

Once the epithelia were dissected as described, the olfactory tissue was kept in Ca 2+- and MgZ+-free Dulbecco balanced salt solution supplemented with 15 mM of HEPES (DBSS) at 4°C, until the appropriate amount of material for the planned grafts was obtained (no more than 1 h). The tissues were then incubated for 30 min at 37°C in DBSS with the addition of 3.3 m g / m l of collagenase (Worthington, Worcester, MA), 1.2 m g / m l byaluronidase (Sigma, St. Louis, MO), 30 m g / m l bovine serum albumin (Sigma) and 40 txg/ml of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI) (Molecular Probes, Eugene, OR) [40]. This solution was filtered through a 0.2 Ixm filter immediately before use [70] to remove dye precipitates. After 30 min the tissues were dissociated to a single cell suspension by pipetting, macroscopic debris mechanically removed, and the cells washed several times in DBSS. In some experiments DiI was omitted from the dissociating solution and the cells were labeled before transplantation with PKH26 (Sigma) according to the protocol described by Gao and Hatten [25]. The final concentration of the cells was adjusted to 2 X 10 4 cells/ixl, viability as assessed by trypan blue exclusion was always over 90%. The volume of the transplants was approximately 1 Ixl.

L. Magrassi, P.P.C. Graziadei / Developmental Brain Research 96 (1996) 11-27

2.4. Surgery In utero surgical manipulations on rat fetuses were performed according to a previously described technique [12,13]. Briefly, after anesthesia (ketamine HC1 50 m g / k g supplemented by acetylpromazine 2.5 mg/kg) we exposed the uterine horns by a midline incision of the abdomen of a pregnant (15 days of gestation) rat. Fetuses and their principal anatomic landmarks were located by transillumination of the uterine horns by a fiberoptic light source. Cells were grafted into the CNS at the desired position by injecting them with a glass microelectrode whose tip was broken to obtain an approximate internal diameter of 25-30 ixm. The injection targets were the developing cerebellum, the brain hemispheres, the colliculi, and the ventricles. The correct location of the transplant was checked immediately by visual inspection made possible by adding trypan blue (0.1%) to the donor cell suspension. Immediately after the transplant some leakage into the ventricular cavities was often visible.

2.5. Processing of the tissues Host animals were fixed at various times after transplantation. E21 rat fetuses were obtained by cesarean section, immediately decapitated and their heads immersed in 4% paraformaldehyde in DBSS after opening of the skull. All the other animals were fixed by transcardiac perfusion with the same fixative, with the exception of rats that were implanted with R26 mouse cells. The heads of these animals were fixed by immersion in a solution containing 2% formaldehyde and 0.2% glutaraldehyde [82]. Postnatal animals were obtained by natural delivery at the end of pregnancy. They were left with the mother for lactation until weaning or death. Serial 100 Ixm vibratome sections (coronal, sagittal, or horizontal) were cut and inspected under an epifluorescent microscope for the presence of fluorescently labeled cells. The sections obtained from animals transplanted with cells derived from R26 mice were stained for the presence of [3-galactosidase activity as described by Sanes et al. [82]. In some experiments alternate sections were collected and only one set was stained for ~-galactosidase histochemistry. After inspection for transplanted cell location, adjacent unstained sections were recovered ~Lnd total RNA extracted from them with a guanidinium-based technique [14]. Genomic DNA was also recovered from the organic phase and interface after washing and salt precipitation.

2.6. Photoconversion and electron microscopy DiI or PKH26 labeled cells, previously located in vibratome sections of the host tissue by fluorescence microscopy, were photoconw;rted [60] and studied by electron microscopy. Vibratome sections containing the region

13

of interest were incubated overnight in 3,3'-diaminobenzidine (1 m g / m l ) (DAB). After this preliminary incubation in DAB, one section, under a fresh drop of DAB, was illuminated with the filter setting appropriate for the excitation maxima of the labeling dye until photoconversion of the dye to the brown pigment derived from DAB was obtained [6,24,80]. After photoconversion the section was postfixed in a fixative containing 2% glutaraldehyde and 4% paraformaldehyde for 2 h, osmicated and processed for electron microscopy according to standard techniques. Some sections containing [3-galactosidase positive cells were stained by the ethanolic phosphotungstic acid method [9] to selectively identify synaptic contacts and processed for transmission electron microscopy.

2.7. BrdU labeling Labeling of the donor embryos by BrdU was obtained by intraperitoneal injection of 5-bromodeoxyuridine (BrdU) (200 m g / k g body weight) in the mother 4 h before collection of the embryos for dissection [27]. Adult animals were injected (BrdU 100 mg/kg) four times at 6-h intervals and killed 1 h after the last injection.

2.8. Immunocytochemistry BrdU labeling was demonstrated after paraffin embedding and sectioning with an anti-BrdU monoclonal antibody (Sigma) [29], after denaturation with 2 N HC1 and digestion with 0.05% pepsin (Sigma) [13,85]. The BrdU antibody was revealed with a secondary biotinylated antibody and an avidin-biotinylated peroxidase complex (Vector Laboratories). Double staining for synaptophysin and BrdU was done first by reacting the tissue with a monoclonal antibody against synaptophysin (Sigma). This was revealed as we did for the BrdU antibody but using DAB as substrate of the peroxidase (brown color). After washing in DBBS the sections were treated according to the usual protocol for BrdU. However, we now used 3-amino-9ethylcarbazole as the peroxidase substrate (mauve color). A rabbit polyclonal antibody against the olfactory marker protein (OMP) was used (1:100 dilution) on vibratome sections.

2.9. Controls Eight fetuses were transplanted with cells fixed for 15 min in 4% paraformaldehyde in DBBS after dissociation and labeling by fluorescent dyes (DiI or PKH26); the cells were washed three times in DBBS before transplantation. The cell derived from El5 rat olfactory mucosae were labeled by BrdU injection to the mother as described. The concentration of the 'engrafted cells and the volume of the transplant were the same as in experimental animals. All the control animals were killed at E21.

14

L. Mag rassi, P.P. C. Graziadei / Developmental Brain Research 96 (1996) 11-27

2.10. Nucleic acid analysis

i~iiii: i~!ii L

!~!iiiii!~iii~iiiili:ii¸ i

i!~!i::~!i!!iii?iii ii!i:~!ii:!~i~i!¸!!!i!i~ ! i: All genomic DNA obtained from a single section was resuspended directly in the amplification mixture and amplified with primers IMR039 and IMR040. These primers, whose sequence was suggested to us by Ms. Valerie E. Scott of Jackson Laboratory, make it possible to amplify a fragment of 315 base pairs of the E. coli LacZ gene, contained in the construct used to generate R26. Total RNA (totRNA) recovered from a single section was treated with RNase-free DNase (Boehringer-Mannheim, Indianapolis, IN), to remove possible contaminating genomic DNA. After digestion totRNA was retrotranscribed using M-MLV reverse transcriptase (Gibco BRL, Gaithersburg, MD) and random hexamers as primers (Boehringer-Mannheim). Nucleotide concentrations and salt conditions for retrotranscription and amplification were as described by Kawasaki and Wang [45]. After retrotranscription cDNA was spliced into two amplification reactions. Amplifications were obtained using Taq polymerase (Perkin-Elmer, Foster City, CA). Specific amplification of a 494-bp fragment (nucleotides 2769-3262) of the mouse microtubuleassociated protein 2 (MAP2) cDNA [54] was obtained with primers Mpl (CGCTGATGAAAGCCCAGTC) and Mp2 (TTTTCTCAGGCGATGTATCC). Amplification with primers Nfl (GGAAGAGAAGAAGGAAGTCA) and Nf2 (TTGGACTCCTGCGGGCTACG) generates a fragment of 280-bp (nucleotides 4647-4926) of the sequence of the mouse middle molecular weight neurofilament gene (NFM) [53]. Selectivity of the amplification was maintained even in the presence of a large excess of rat cDNAs encoding for homologous proteins, and no amplification was obtained from cDNA prepared from adult rat cDNA (Fig. 10). Amplification products were analyzed by agarose gel electrophoresis. The correctness of the amplification products was confirmed by direct sequencing of the band

•

~ ~

17!ii! iiii~i!?i~

~ ~i~L ~??~ ~ i i ~ L ¸

i ¸¸

~

,~

Fig. 1. A low power view of a vibratome section (200 Ixm) stained for [~-galactosidase, superior colliculus. A large cluster and several scattered labeled cells are visible. This is one of those sections we chose to collect adjacent sections for nucleic acid extraction. Scale bar: 60 Ixm. The inset in the lower right corner shows at high magnification the profile of the nucleus and cell body of a scattered cell also contained in the superior colliculus. The image was taken with difference interferential contrast optics (DIC). The neuronal nature of the cell containing the [3-galactosidase reaction product is indicated by its large dimensions, its shape, and the prominent nucleolus. The cell was located in the deep gray layer of the superior colliculus. Scale bar = 5 Ixm.

Fig. 2. Three-dimensional computer reconstruction of the cerebral hemispheres of a E21 animal transplanted with cells derived from adult olfactory mucosa into the right basal ganglia to demonstrate the location of the DiI labeled cells in the parenchyma. 3D reconstruction and visualization were obtained using the SciAn visualization package. Cells in the ventricular cavities and on the surface of the brain ( = 7 x 103) are not shown. The view is from the occipital poles. Yellow: neurons (n. 35), red: glia (n. 22), blue: labeled cells whose morphology was insufficiently visible to allow classification (n. 231). Ventricular cavities are shown in green, brain parenchyma is dark blue, corpus callosum magenta. Ceils appearing behind the ventricular structures from this point of view change their color accordingly. Fig. 3. Paraffin section (8 txm). Double immunocytochemical staining for synaptophysin, revealed with 3,3'-diaminobenzidine (brown pigment) and BrdU revealed with 3-amino-9-ethylcarbazole (mauve color). The asterisk indicates the BrdU positive nucleus. Following treatment with protease and hydrochloric acid the chromatin in the vesicular nucleus of the Purkinje cell is collapsed into big clumps. A BrdU positive mauve chromatin clump is visible immediately above the asterisk. The arrow points to synaptophysin immunoreactivity on the initial segment of the dendrite. Change from a more punctuate to a more diffuse and weaker staining of synaptophysin immunoreactivity was an unavoidable artefact that followed the partial dissolution of the synaptic structures by the action of pepsin and hydrochloric acid, necessary for successful BrdU immunostalning. The rat was transplanted with adult derived cells. Scale bar: 10 ixm. Fig. 4. Vibratome section (150 txm) of a large cluster formed after transplantation of cells dissociated from the rat adult olfactory mucosa. OMP positive cells were revealed by immunohistochemistry with a rabbit polyclonal antibody. The cluster contained a vesicle with a lumen and walls covered by an irregularly thick epithelium. In the upper right comer is visible a portion of the lumen of the vesicle. Several OMP positive olfactory neurons are visible in the epithelium. The arrow indicates an olfactory knob with cilia protruding into the vesicular lumen; another focal plane contained the dendrite and cell body of the corresponding neuron. Scale bar: 10 txm.

L. Magrassi, P.P.C. Graziadei / Developmental Brain Research 96 (1996) 11-27

Fig. 2

Fig. 3

Fig. 4

15

16

L. Magrassi, P.P. C. Graziadei / Developmental Brain Research 96 (1996) 11-27

recovered from the agarose [5] using Mp2 or Nf2 as sequencing primers.

3. Results Observation of the cells immediately before transplantation showed that they were all labeled by the fluorescent dyes (DiI, PKH26) although intensity varied greatly. BrdU labeling of the same ceils varied widely depending on the age of the donor: over 80% of the cells were labeled in the preparations from the E l 2 fetuses while only about 20% of the cells derived from the adult mucosa were labeled. Variability in the intensity of the [3-galactosidase reaction was also seen in cell suspensions of the developing and adult olfactory mucosa obtained from the R26 mice and reacted before grafting. Strong staining was present in 30-40% of these cells, while the remaining cells showed a variably weaker staining; in about 10% of the cells no staining was detectable. Brains of control animals transplanted with fluorescently and BrDu labeled cells after paraformaldehyde fixation showed very few fluorescent cells (less than 200 in an animal where they were counted). These labeled cells,

which, when inside brain parenchyma, were often located in the spaces of Virchow-Robin, had a microglial-macrophage morphology. No fluorescently labeled cells with neuronal morphology were seen in control animals. Furtbermore, no BrDU labeled cells were seen after transplantation of fixed cells. When viable cells derived from either the developing or the adult olfactory mucosa were transplanted, labeled cells were visible in the host brain both by observation of the fluorescent markers a n d / o r by immunostaining for BrdU. No substantial differences were seen between cells labeled by DiI or PKH26 in the completeness of staining and the number of positive cells. In xenograft [3-galactosidase positive cells were present, but [3-galactosidase stained processes were rare and in all cases the staining was incomplete. Labeled cells were visible in the host brain and liquoral spaces (ventricles, subarachnoid cisterns, etc.) at all survival times after transplant. Although the majority of the cells inside the brain parenchyma were not sufficiently labeled by fluorescent dyes to show their complete morphology, in those that were, phenotypic specialization (dendritic arbors, axons, glial expansions or none of these) was appropriate to categorize the cells as neurons or glia. Labeled cells with a neuronal or glial morphology were

Fig. 5. Paraffin section (8 p,m), phase contrast image. The animal was injected into the ventricular zone at the caudal edge of the developing cerebellum; some leakage of cells into the fourth ventricle was apparent at the moment of the injection. The animal was transplanted with adult derived cells. (Left) Paraffin section (8 p~m), phase contrast image. Horizontal section of a P11 rat cerebellum. Letters: f: cerebellar fissure, eg: external granular layer, ml: molecular layer, p: Purkinje cell layer, ig: inner granular layer. Scale bar: 50 Ixm. (Right) Same microscopical field as in the left panel, bright field image. Only the nuclei containing BrdU are now visible. Lettering as in the left panel. Labeled nuclei are visible in all layers, most of them are located in the superficial external granular layer (arrowheads); some labeled nuclei are also visible in the Purkinje cell layer (large arrow) and in the inner granular layer (arrow). The large arrow indicates the same labeled cell in the Purkinje cell layer as in the left panel. Scale bar: 50 p~m.

L. Magrassi, P.P.C. Graziadei / Deuelopmental Brain Research 96 (1996) 11-27

17

seen after grafting of cells derived from both the developing and adult olfactory organ. The distribution of moJphologically characterized fluorescently or [3-galactosidase labeled cells was reconstructed in serial coronal sections of the brain of E21 embryos transplanted into the developing hemisphere with olfactory mucosa cells derived from all stages of development and from adults. When data from different animals grafted at different transplant sites were pooled, it was found that essentially all the regions in the brain contained fluorescently labeled cells showing neuronal or glial morphologies. The distribution and location of BrdU labeled cells was similar to that of fluorescently labeled cells. BrdU labeled nuclei were also seen in 40-day-old rats, the longest survival time we studied. [3-Galactosidase positive cells that could be identified by location and nuclear dimension as neurons or glia were found in xenografts as widespread in the brain as in the allograft experiments. A remarkable difference between xenograft and allograft was that in xenograf~Ied animals, large aggregates of donor cells with a maximum dimension of 100-200 txm were often (on average two per transplanted rat) found inside the brain of the hos~: together with widely dispersed and isolated cells (Fig. 1). Similar clusters of graft derived

Fig. 7. Vibratome section (100 ~m). The figure shows a fluorescent picture of an immature Purkinje cell (the picture is a montage of two different optical sections) in the cerebellum of an E21 animal. The animal was transplanted at the posterior edge of the developing cerebellum with cells dissociated from El6 developing olfactory mucosa. The neuron is already polarized and a thick dendritic process emerges from the soma opposite to the axon (arrow). However, as described for the normal cerebellum of comparable age (see for example: Berry and Bradley [8] Fig. 2, Hendelman and Aggerwal [39] Fig. ld, Sotelo et al. [91] Fig. 2), the dendritic arbor is still very incomplete, it lacks dendritic terminals and shows bulbous endings (arrowhead). Scale bar: 15 ~m.

Fig. 6. Detail of the section shown in Fig. 5b. Several BrdU labeled cells are contained in the superficial external granular layer (seg) of two adjacent cerebellar folia. Scale b~r: 10 I~m.

cells were also seen in allograft experiments but they were about one order of magnitude less frequent. No consistent differences in the distribution of the cells or in the presence of cells with glial or neuronal phenotypes were seen among brains of hosts transplanted with cells derived from donors of different ages. However, since intensity of LacZ expression is variable inside the CNS and both BrDU and fluorescent labels are subject to dilution, some of the graft derived cells could be missed in our reconstructions. This hampers quantitation of possible differences in the number of the cells derived either from the adult or the developing olfactory epithelium capable of integration after transplantation. In Figs. 2 - 4 we present a reconstruction of the distribution of the DiI labeled cells in the brain of a representative E21 host transplanted with cells derived from the adult olfactory mucosa. The reconstruction shows only the cells

18

L. Magrassi, P.P.C. Graziadei / DeL,elopmental Brain Research 96 (1996) 11-27

Fig. 8. Electron micrograph: section counterstained by uranyl acetate and lead citrate. Detail of of a DiI labeled dendrite. The neuron carrying this photoconverted dendrite was located in the hypothalamus of a P20 rat injected with cells dissociated from El6 developing olfactory mucosa. Six synapses may be counted on this labeled dendrite. The arrow points to a clearly visible postsynaptic thickening. Scale bar: l Ixm.

located in the parenchyma which are the minority of the labeled cells (less than 3%). The majority of the cells in this, as in many other animals studied, was dispersed in the liquoral spaces (ventricles and subarachnoid spaces) or was located at the surface of the brain. They were also associated with the choroid plexus, arachnoid membrane or ventricular wall. Although isolated labeled cells or cell clusters were always seen in the region of the presumptive transplant, they were also very often found in other regions that are not developmentally related to the site of injection (as recorded at the time of the transplant by the position of the trypan blue spot). Not uncommonly, labeled cells with neuronal or glial morphologies were seen in the hemisphere contralateral to the transplant. When transplants were made close to the rhombic lip (the ventricular zone of the caudal edge of the developing cerebellum) BrdU labeled cells were found in all layers of the cerebellum (Fig. 5). Most of the cells, however, were limited to the superficial external granular layer (Fig. 6). Labeled nuclei were also seen, albeit far less frequently, in the Purkinje (P) cell layer (Fig. 5). Preparations double stained for synaptophysin and BrdU showed that some Purkinje cells had labeled nuclei (Fig. 3). Immature Purkinje cells labeled by fluorescent dyes (Fig. 7) were also seen in the cerebellum of P1 animals after grafting in the posterior fossa. They displayed a developing dendritic arbor comparable to that described for the appropriate developmental stage [8,39,91]. Electron microscopic studies confirmed that some of the scattered cells labeled by fluorescent dyes after photocon-

version with DAB or by [~-galactosidase differentiated into neurons with a central nervous system phenotype receiving synaptic innervation (Fig. 8 and Fig. 9). Immature synaptic profiles labeled by crystals of the [3-galactosidase reaction product were seen after ethanolic phosphotungstic acid staining (Fig. 9). They were similar to those described by

Fig. 9. Electron micrograph: ethanolic phosphotungstic acid staining of an immature synaptic contact in the superior colliculus of a P1 rat transplanted with cells derived from the adult olfactory mucosa of R26 mice. Arrowhead: crystalline product of the histochemical reaction for 13galactosidase in the presynaptic terminal. Arrow: immature presynaptic dense projection as normally seen in maturing synapses [43]. Asterisk: postsynaptic band, Scale bar: 90 nm.

L. Magrassi, P.P. C. Graziadei / Developmental Brain Research 96 (1996) 11-27

19

Jones and Revell [43]. W e noticed an increase in the electron density of the cell structures compared to the usual P T A preparations. This may be due to the effect of the prolonged permanence of the sections in the Fe containing buffer used for B-galactosidase histochemistry. Differentiation into neurons with a central phenotype of some of the mouse cells grafted into rat brain was also demonstrated by reverse transcription and amplification of mouse specific c D N A encoding for M A P 2 and N F - M proteins (Fig. 10). 1 4 / 2 0 (70%) amplifications of c D N A derived from sections adjztcent to other sections containing transplanted cells, resulted positive for M A P 2 and 1 2 / 2 0 (60%) for NF-M. No specific amplification o f cDNA, derived from sections o f the brain of control animals or adult rat brain was ever c,btained with our mouse specific primers. Labeled cells with a morphology that suggested the generation of different classes of glia were also seen at all ages; electron microscopy confirmed their glial nature (Fig. 11).

Fig. 11. Electron micrograph of a PKH26 labeled satellite glial cell in the dentate girus of a P20 rat after photoconversion. The animal was injected with cells derived from the adult olfactory mucosa. Arrowheads indicate the labeled extensions of the cytoplasm of the glial cell embracing a presumptive neuron. Scale bar: 1 i~m.

Fig. 10. Agarose gel electrophoresis showing the products of the amplifications of genomic DNA and cDNA derived from vibratome sections (thickness 200 txm) of rat brains transplanted with cells dissociated from the olfactory mucosa of R26 tran:~genicmice (lanes a, b, e, f, i, 1), or from vibratome sections of the brain of a control rat (lanes d, h, m), or from vibratome section of the brain of a normal mouse (lanes c, g). Lanes a, b, c, d: amplification of retrotrascribed totRNA with Mpl-Mp2 primers generating a mouse specific DNA fragment of 494 bp of the cDNA encoding the MAP2 protein, as expected no amplification was obtained from retrotranscribed totRNA from the control rat (lane d). Lanes e, f, g, h: amplification of retrotranscribed totRNA with Nfl-Nf2 primers generating a mouse specific DNA fragment of 280 bp of cDNA encoding the NF-M, as expected no amplification was obtained from retrotranscribed totRNA of the control rat (lane h). Lanes i, 1, m: amplification of genomic DNA with IMRO39-1MRO40 primers generating a DNA fragment of 315 bp of the E. coli I/,acZ gene contained in the construct used to obtain the R26 transgenic mouse. As expected no amplification was obtained from control rat brain genomic DNA (lane m). w: molecular weights: pBR322 cleaved with HaelII: first band fi-omtop 587 bp.

Small clusters of 13-galactosidase positive cells containing elements with various nuclear dimensions that suggested the presence o f glia and neurons (Fig. 12 and Fig. 13) were also present. Some of these small aggregates, formed by less than 10 cells, were separated by more than 400 txm from other labeled cells. Cells contained in the liquoral spaces presented an undifferentiated morphology; they were often well separated and did not aggregate into large clusters. These cells failed to show electron microscopical or immunocytochemical signs of olfactory neuron differentiation. Some o f the cells adhering to the ventricular walls were seen with processes between ependymal cells (Fig. 14) suggestive of an active migratory behavior. Larger clusters (over 50 txm in their major diameter) present in the brain of xenografted (Fig. 1) and allografted rats (Fig. 15) contained irregular vesicles lined by an epithelium of variable thickness (Fig. 16). OMP positive cells with the morphology of bipolar olfactory neurons were present (see Fig. 4) in the epithelium. Less than 1% of the cells contained in the patches of reconstituted epithelia inside the cluster were O M P positive. Electron microscopy of the cells in the epithelium confirmed the presence of olfactory neurons, with an olfactory knob and cilia (Fig. 17). Typical unmyelinated olfactory axons enclosed in the cytoplasm of sheath cell were also seen at the base of the epithelium (Fig. 18). However, we failed to

20

L. Magrassi, P.P.C. Graziadei / Developmental Brain Research 96 (1996) 11 27

Fig. 12. 13-Galactosidasestaining, DIC image: vibratome section 100 ixm of tickness from an E21 host striatum, the animal was transplanted with cells dissociated from the developing (El3) olfactory mucosa and vomeronasal organs of R26 mice embryos. A small, isolated, cluster of 10 labeled cells is located in the striatum, two cells are contained in different focal planes. The variations in size of the nuclei are clearly visible, the large arrowhead indicates a large neuron-like nucleus, the small arrowhead a smaller glia-like nucleus. Both nuclei were contained entirely in the plane of section although in slightly different optical planes; this rules out difference in diameter due to sectioning artefacts. This cluster was isolated from other [3-galactosidase positive cells by more than 400 p~m. Scale bar: 9 txm.

demonstrate glomerular formation and the axons derived from the olfactory vesicle(s) in the cluster become dispersed in the host brain at short distances. A reconstituted lamina propria surrounded the vesicles in large clusters (Fig. 16). In xenograft experiments essentially all the cells in the large clusters were 13-galactosidase positive, indicating their origin from the transplanted cells.

4. Discussion Our data show that cells derived from the olfactory mucosa of rats and mice at various stages of development, when transplanted as a single cell suspension into the brain of E l 5 rat fetuses, can differentiate and survive in the CNS of the host after birth. Nuclei labeled by BrdU were found in the cortex and cerebellum more than a month after the birth of the animal, thus indicating that at least some of the engrafted and integrated cells were not preferentially eliminated during the period of developmentally regulated neuronal death, a period that is already completed at that time [41]. We chose to perform our transplantation experiments in E l 5 embryos because at this stage of prenatal life most of the neurogenesis in the CNS is still under way [41] and visibility of the fetuses through the uterine walls is greatly enhanced by stretching of the yolk sac parietal wall and the decidua capsularis [7]. Despite targeting our injection into different regions

(developing cerebellum, brain hemispheres, colliculi and ventricles) of the developing brain we found a widespread dispersion of the engrafted cells even into regions that are not normally developmentally related to the site of the transplant. This may be due to mechanical displacement of cells that leaked immediately after the transplant into the cerebrospinal fluid a n d / o r their migration along the surface of the brain. Active migration along abnormal pathways has often been described in transplantation experiments in adult or neonatal animals. Fetal cerebellar cell suspensions containing immature Purkinje cells, when transplanted into the cerebellum of adult Purkinje cell degeneration (PCD) mice, migrate to their final positions in the host molecular layer through the folial surface between the subpial basal lamina and the molecular layer [90]. Conditionally immortalized cells expressing 13glucuronidase, when transplanted into the lateral ventricles of newborn mice affected by mucopolysaccharidosis VII, were also found dispersed throughout the recipient brains [891. In xenograft and allograft experiments, the majority of the labeled cells remained in the liquoral spaces, superficial fiber tracts (e.g. stratum oriens) and Virchow-Robin spaces, often showing an undifferentiated phenotype. In all our experiments only a minority (about 2 0 - 3 0 % ) of the transplanted cells comes from the basal compartment of the olfactory epithelium, where multipotent neural precursor are most likely to reside after initial mucosal development. This may partially explain the inability of many cell

L. Magrassi, P.P. C. Graziadei / Developmental Brain Research 96 (1996) 11-27

Fig. 13. Ethanolic phosphotungstic acid staining of a small cluster similar to that described in Fig. 14 and previously stained for 13-galactosidase. Cells labeled by the electron-dense reaction product of the 13-galactosidase reaction are visible. The reaction product is almost continuous in the perinuclear region. Asterisk: a cell dysplaing features (e.g. large nucleus with uniform chromatin) of an immature neuron. Arrow: a cell with glial characteristics (e.g. small indented nucleus, prominent chromatin clumps). Scale bar: 2 p,m.

to penetrate into the brain and differentiate. However integration of only a limited number of cells has also been described in experiments where pure undifferentiated neuronal populations were transplanted [61] into the developing CNS. Heterochronic transplantation in the developing visual cortex of the ferret of neuronal precursors and newly generated cortical nLeurons also resulted in the failure of more than 80% of the transplanted cells to integrate into the cortical layers [61]. The transplanted cells and their descendants that we found inside the nervous tissue could either become dispersed into the brain parenchyma and integrated as single cells and little groups (less than 50 Izm in diameter) or reaggregate forming large clusters. We believe that some of the integrated cells showed unequivocal light and electron microscopical signs of differentiation into central nervous system neurons. (;ells with a neuronal phenotype were usually single or a.ssociated in little groups. An additional proof of their neuronal differentiation is represented by the amplificatio3a of cDNA encoding for NF-M

21

and MAP2 with mouse specific primers starting from totRNA extracted from brains of xenograft recipients. Positive amplifications were obtained from more than half of the 20 sections adjacent to sections containing 13-galactosidase positive cells processed for nucleic acid extraction. While MAP2 is also expressed by neurons in the adult rodent olfactory epithelium, NF-M is not [10]. This indicates that at least some of the transplanted cells express mRNAs appropriate for CNS neuron. Finally, judging by their anatomical localization, and the presence of synaptic contacts, some of the donor derived cells with a neuronal phenotype seem correctly integrated among the neurons of the host brain. Both the developing and adult olfactory epithelium contain cells able to generate neuron and glia with a central phenotype after transplantation into the developing brain. In adult animals the existence of cells that after prolonged stimulation with growth factors give rise in vitro to neurons and glia has also been demonstrated in the CNS [76,77]. In the olfactory mucosa, according to our present result; however, some cells are already capable to differentiate into neuron and glia without in vitro manipulation. Our data also suggest that engrafted cells that remain dispersed into the host parenchyma do not necessarily differentiate immediately after transplantation according to the fate of the population generated at that particular time at their new position. Some may enter the pool of proliferating neuroepithelial cells and generate terminally differentiated cells only much later. An example of this is represented by our findings in the cerebellum where BrdU labeled (and thus derived from the engrafted olfactory cells) Purkinje cells were found together with BrdU labeled granule cells. We suggest that some of the engrafted cell enter the large pool of neuroepithelial precursors that undergo their last division at El5 [3] and start to differentiate as Purkinje cells. Others remain in the ventricular zone and later they share the fate of the sagittally migrating granular precursors. Label dilution due to the high mitotic activity of the granule cell precursors before their passage into the deep external granular layer (EGL), explains why most of the BrdU labeled donor derived cells are limited to the superficial EGL. Similar results are obtained when granule cell precursors are labeled by [3H]thymidine in vivo. A significant number of labeled granules is seen in the inner granular layer (IGL) only if [3H]thymidine is administered after or at the end of the first postnatal week in the rat [2]. Those few cells labeled in the IGL may represent early differentiating granules that start their maturative inward migration while most of the other cells in the EGL are still proliferating a n d / o r migrating in the other dimensions [79]. Grafted cells and their descendants that reaggregated into large clusters inside the brain of the host, organized themselves in epithelial vesicles. These epithelia contain morphologically identifiable olfactory receptors, some of them OMP positive. The epithelia inside the cluster are

22

L. Magrassi, P.P.C. Graziadei / De~'elopmental Brain Research 96 (1996) 11-27

Fig. 14. Electron micrograph of a labeled cell with undifferentiated characteristics lining the lateral ventricle of a E21 rat. The rat was transplanted with cells dissociated from the adult olfactory epithelium. The arrowhead points to the cilium of an ependymal cell that is contained in the collapsed ventricle. The arrow indicates a process extended by the labeled cell between the lateral membrane of two ependymal cells. Scale bar: 1 ~m.

i ¸~

Fig. 15. Vibratome section of a large cluster in the striatum of a rat 40 days after transplantation with cell derived from the developing olfactory mucosa of El5 rat embryos. Arrowhead indicates one of the fasicles of the internal capsule, arrow indicate one of the two small epithelial vesicles contained inside the cluster. Scale bar: 10 Ixm.

Fig. 16. Higher magnification of the region indicated by the arrow in Fig. 15. Two epitelial vesicle are clearly visible. Arrow: basal cells in the epithelium lining the tangentially cut lumen of one of the vesicles. A layer of fusate and polymorphic cells separates the epithelial vesicles from the brain parenchyma (B). Scale bar: l0 p.m.

L. Magrassi, P.P.C. Graziadei // Developmental Brain Research 96 (1996) 11-27

Fig. 17. Electron micrograph of an olfactory knob with cilia protruding in the lumen of an epithelial vesicle contained in the large cluster shown in Fig. 15 and Fig. 16. Scale bar: 1 ~m.

thinner and contain very fi~w OMP positive neurons compared to the normal olfactory epithelium. Similar epithelia are common after transplantation of fragments of olfactory

Fig. 18. Electron micrograph of a bundle of unmyelinated axons ensheathed in the cytoplasm of a cell contained immediately under the epithelium of a vesicle formed inside a cluster. The cluster was located in the cortex of an E21 rat transplanted at E15 with R26 mouse cells derived from the developing mucosa. Arrowheads indicate the cytoplasm of the ensheating cell. Arrow indicates a 13-galactosidase reaction crystal in one of the axons. Scale bar: 1 txm.

23

mucosa inside the brain or the anterior chamber of the eye [37,38,65]. Generation of olfactory neurons in epithelia formed by cells reaggregated in clusters several hours after dissociation suggests that transient exposure to the foreign environment of the host CNS does not permanently change the differentiative program of the transplanted cells. Cluster formation even in the absence of mechanical constraints has been described after heterochronic transplantation in utero of primary striatal precursors in rats [13]. In our experiment, clusters may be found in allografts and xenografts but large clusters are more common in xenografts. Selective adhesion between mouse cells or active sorting processes may enhance the formation of large clusters in xenografts compared to allografts. In interspecific mouse chimeras, neurons and glial cells have an increased tendency to form large clusters of cells of the same genotype [28]. A tendency to selective adhesion between quail cells has also been described in quail-chick embryonic transplants [81]. Our findings suggest that a population effect or ordered local interactions allow the differentiation of the olfactory neurons. Reaggregation of the transplanted cells into large clusters allows local interactions between cells derived from the olfactory epithelium to take place and makes the instructive signal coming from the surrounding host environment ineffective. Small clusters do not contain epithelial vesicles and differentiate according to the host environment. We think it to be unlikely that only cells committed to reconstitute an olfactory mucosa tend to reaggregate. The results of the xenograft experiment support this interpretation. In xenograft the number of clusters containing olfactory neurons is increased compared to the allograft although the number and degree of commitment of the olfactory precursors should be similar for animals of comparable age both during development and adulthood. Our interpretation is that the species difference increases segregation of the transplanted cells thus increasing the probability of formation of large clusters where the olfactory cells may implement their differentiative program. As expected we were unable to find olfactory receptors differentiating outside the epithelia present in the large clusters. Transplantation of olfactory placodes or fragments of olfactory epithelium into different regions of the brain [56,65,92], or even into the anterior chamber of the eye [37,38] where any possible target is absent, also indicates that only cells remaining inside an olfactory epithelium differentiate along the olfactory lineage. By contrast, cells migrating away from the grafted olfactory structures do not differentiate into olfactory neurons [34] and may participate in the development and remodeling of the host brain [49]. Finally the reaggregation first hypothesis is also supported by the results of in vitro experiments where the differentiation of the olfactory neurons is associated to the formation of complex multicellular clumps [72]. Under our experimental conditions the ability to regen-

24

L. Magrassi, P.P.C. Graziadei / Developmental Brain Research 96 (1996) 11-27

erate an olfactory epithelium after reaggregation clearly depends on the presence of a critical mass of cells. A similar mass effects was also described in transplantation experiments involving adjacent rhombomers where the expected morphological boundary did not develop unless a critical mass of grafted tissue was present [36]. Small clusters (less than 50 Ixm in their major diameter) did not show morphological or immunochemical signs of olfactory neuron differentiation. Both the number of cells and the ability to reconstitute a normal complement of the different cell populations present in the olfactory mucosa (basal cells, supporting cells, mesodermal derived cells of the lamina propria) may play a role in allowing differentiation of olfactory structures inside the large clusters. In all our transplantation experiments mesodermal derived cells are transplanted together with the epithelial cells. Classic [97] and more recent work [51] stresses the importance of the mesoderm immediately beneath the olfactory placode for the differentiation and development of this structure. This may suggest that non-epithelial cells may also be important in allowing olfactory and supporting cell precursors to differentiate into an olfactory epithelium. We believe that the cells contained in the reconstituted olfactory epithelia, and the integrated cells with neural or glial characteristics originating from the dissociation and grafting of the olfactory mucosa into the developing rat CNS, represent the descendants of the immature neuroepithelial cells present in the olfactory epithelium. This idea is based on the observation that mature olfactory neurons degenerate completely in vivo [63] and in vitro [72] after axotomy and that mesodermal cells, supporting cells and cells of Bowman's glands have been repeatedly shown not to give rise to neurons in the olfactory mucosa under either normal or experimental conditions [30,31,33]. Furthermore, at least in normal adults, the number of dividing supporting cells in the olfactory mucosa is very low compared to that of the cells in the basal (neuronal) compartment of the epithelium. Thus most of the transplanted BrdU labeled cells should be of olfactory neuron lineage. On the contrary, non-epithelial cells transplanted along with the olfactory cells may be the origin of at least some of the microglia-macrophage cells labeled by fluorescent dyes and BrdU and of the cells in the lamina propria surrounding the epithelial vesicles in the large clusters. In the olfactory mucosa other possible precursors of the cells that differentiated and integrated after transplantation are those cells that during normal development migrate from the olfactory organ, enter the brain, and give rise to neurons or glia [18,84,96]. Some of these cells are neural precursors expressing gonadotropin-releasing hormone (GnRH). Their cell bodies at the end of their complex migratory behavior are limited to the diencephalon [84,96]. Interestingly, these cells, at least in chicken embryos, do not seem to derive from the olfactory placodes, but merely travel through the developing olfactory organ en route to the diencephalon [4]. The glia (ensheathing cells of the

olfactory bulb plexiform layer) supposedly derived from the olfactory placode, presents substantial differences from the glia derived from precursors in the neural plate [18,67] and apparently it is able to retain its characteristics when heterotopically transplanted [74]. These considerations, together with our findings of similar migratory and differentiative ability for engrafted cells derived either from the developing or mature olfactory organ, and thus well after the completion of the GnRH neuron and ensheathing cell precursor migrations, seem to rule out the possibility that only precursors of GnRH neurons or ensheathing glial cells could be at the origin of our present results. Whether in the olfactory mucosa are present cells with the ability to give rise to both neurons and glia when transplanted into the developing CNS, or whether only separated neuronal and glial progenitors are present, is still an open question. However, the existence of small clusters formed by less than 10 cells, located at more than 400 Ixm from other labeled cells, containing both glial and neuronal cells, is compatible, in our opinion, with a clonal origin of the cells in the cluster. This, if confirmed, suggests the existence of a multipotent progenitor in the olfactory mucosa. In Drosophila single cell heterotopic transplantation experiments have shown that the fate of neuroectodermal precursors is already committed at onset of gastrulation [73]. In vertebrates, however, the differentiative program of neural crest cells [17] and their derivatives [1,19,42,69,94], cortical neuroepithelial precursors [22,46,61], spinal motor neuron precursors [20] and immortalized cell lines obtained from the embryonic CNS [68,75] may be changed by altering the environment. However, the changes described are limited to phenotypes common to the same subdivision of the peripheral or central nervous system originally containing the neural precursors. Furthermore conditionally immortalized cell lines derived from neuronal precursors by transfection with oncogenes may show a less restricted differentiative potential compared to their normal counterpart [26] and an anomalous ability to integrate into undamaged adult [68] and neonatal [75,88] brains compared to freshly dissociated embryonic cells that under normal circumstances fail to integrate [55]. In our experiments cells of placodal origin, in the absence of genomic manipulations, generate cells with CNS phenotype. Interestingly, although the olfactory epithelium is characterized since the beginning of its differentiation by the expression of specific combinations of developmentally regulated transcription factors compared to the CNS [35,86,87], maturing olfactory neurons share with neurons in the CNS common molecular mechanisms that allow the expression of the terminally differentiated phenotype [52]. The remarkable differential behavior of isolated olfactory neuron precursors versus those remaining in an organized tissue or anlage and those able to reaggregate after transplantation into large clusters suggests that olfactory

L. Magrassi, P.P.C. Graziadei / Developmental Brain Research 96 (1996) 11-27

neuron precursors can not differentiate in isolation into olfactory neurons but are induced to do so by local interactions. Whatever interactions are responsible for the differentiation of olfactory neurons from uncommitted precursors, our data show that tiffs mechanism must be present, although it is not necessarily the same, throughout the life of the animal since cells dissociated from the olfactory mucosa of all ages becorae neurons and glia with nonolfactory characteristics after transplantation. Furthermore these interactions seem to start again after reaggregation and even this is true independendy of the age of the donor.

Acknowledgements L.M. was the recipient of a Borsa di Perfezionamento all'Estero from the University of Pavia (Italy). This work was supported by NIH Grant NS20699 to P.P.C.G. Part of this work was performed in Prof. G. Milanesi's Laboratory IGBE CNR, Pavia (Italy). We wish to thank Prof. G. Milanesi for this opportunity. We also thank Dr. E. Cattaneo, Dr. A. Moro and Dr. G. Biella for discussion, and Tzong-Yow Hwu and Eric Pepke of the Supercomputer Computations Research In,;titute, Florida State University, for help with the 3D reconstruction and visualization package SciAn. Mr. C. Badland provided excellent photographic work. The antibody against OMP was a generous gift of Dr. F. Margolis.

References [1] Aloe, L. and Levi-Montalcini, R., Nerve growth factor in vivo induced transformation of irfmaature chromaffin cells in sympathetic neurons: effect of antiserum to the nerve growth factor, Proc. Natl. Acad. Sci. USA, 76 (1979) 1246-1250. [2] Altman, J., Postnatal development of the cerebellar cortex in the rat. I. The external germinal layer and the transitional molecular layer, J. Comp. Neurol., 145 (1972) 465-513. [3] Altman, J. and Bayer, S.A., Prenatal development of the cerebellar system in the rat. II. Cytogenesis and hystogenesis of the deep nuclei and the cortex of the cerebellum, J. Comp. Neurol., 179 (1978) 23-48. [4] Amraoui, A.E. and Dubois, P.M., Experimental evidence for an early commitment of gonadotropin-releasing hormone neurons, with special regard to their origin from the ectoderm of nasal cavity presumptive territory, Neuroendocrinology, 57 (1993) 991-1002. [5] Bandi, C., Damiani, G., Magrassi, L., Grigolo, A., Fani, R. and Sacchi, L., Flavobacteria as intracellular symbionts in cockroaches, Proc. R. Soc. Lond. B, 257 (1994) 43-48. [6] von Bartheld, C.S., Cunningham, D.E. and Rubel, E.W., Neuronal tracing with DiI: decalcification, cryosectioning, and photoconversion for light and electron microscopic analysis, J. Histochem. Cytochem., 38 (1990) 725-733. [7] Beaudoin, A.R., Embryology and teratology. In: H.J. Baker, J.R. Lindsey and S.H. Weisbroth (Eds.), The Laboratory Rat, Academic Press, New York, 1980. [8] Berry, M. and Bradley, P., The growth of the dendritic trees of purkinje cells in the cerebellum of the rat, Brain Res., 112 (1976) 1-35.

25

[9] Bloom, F.E. and Aghajanian, G.K., Cytochemistry of synapse: selective staining for electron microscopy, Science, 154 (1964) 15751577. [10] Bruch, R.C. and Carr, V.M., Rat olfactory neurons express a 200 kD neurofilament, Brain Res., 550 (1991) 133-136. [11] Calof, A.L. and Chikaraishi, D.M., Analysis of neurogenesis in a mammalian neuroepithelium: proliferation and differentiation of an olfactory neuron precursor in vitro, Neuron, 3 (1989) 115-127. [12] Cattaneo, E., Magrassi, L., Santi, L., Butti, G., McKay, R.D.G. and Pezzotta, S. (1993) Transplanting embryonic striatal cell lines into the embryonic rat brain, Soc. Neurosci. Abstr., 107.6. [13] Cattaneo, E., Magrassi, L., Butti, G., Santi, L., Giavazzi, A. and Pezzotta, S., A short term analysis of the behaviour of conditionally immortalized neuronal progenitors and primary neuroepithelial cells implanted into the fetal rat brain, Dev. Brain Res., 83 (1994) 197-208. [14] Chomczynski, P. and Sacchi, N., Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem., 162 (1987) 156-159. [15] Chuah, M.I., David, S. and Blaschuk, O., Differentiation and survival of rat olfactory epithelial neurons in dissociated cell culture, Dev. Brain Res., 60 (1991) 123-. [16] Clairambault, P., Development of the prosencephalon. In: R. Llinas and W. Precht (Eds.), Frog Neurobiology, Springer-Vedag, Berlin, 1976, pp. 924-944. [17] Coulombe, J.N. and Bronner-Fraser, M., Cholinergic neurones acquire adrenergic neurotransmitters when transplanted into an embryo, Nature, 324 (1986) 569-572. [18] Doucette, R., Glial progenitor cells of the nerve-fiber layer of the olfactory-bulb. Effect of astrocyte growth media, J. Neurosci. Res., 35 (1993) 274-287. [19] Doupe, A.J., Landis, S.C. and Patterson, P.H., Environmental influences in the development of neural crest derivatives: glucocorticoids, growth factors, and chromaffin cell plasticity, J. Neurosci., 5 (1985) 2119-2142. [20] Eisen, J., Determination of primary motoneuron identity in developing zebrafish embryos, Science, 252 (1991) 569-572. [21] Farbman, A.I. (1992) Cell Biology of Olfaction, Cambridge University Press, Cambridge. [22] Fishell, G., Striatal precursors adopt cortical identities in response to local cues, Development, 121 (1995) 803-804. [23] Friedrich, G. and Soriano, P., Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice, Genes Dev., 5 (1991) 1513-1523. [24] Gansmuller, A., Kruger, F., Gumpel, M. and Baron-Van Evercooren, A., Photoconverted carbocyanine DiI allows direct visualization of transplanted glial cells at the ultrastructural level, Neurosci. Lett., 147 (1992) 151-154. [25] Gao, W.Q. and Hatten, M.E., Neuronal differentiation rescued by implantation of Weaver granule cell precursors into wild-type cerebellar cortex, Science, 260 (1993) 367-369. [26] Gao, W.Q. and Hatten, M.E., Immortalizing oncogenes subvert the establishment of granule cell identity in developing cerebellum, Development, 120 (1994) 1059-1070. [27] Gotz, M. and Boltz, J.J., Formation and preservation of cortical layers in slice cultures, J. Neurobiol., 23 (1992) 783-802. [28] Goldowitz, D., Cell allocation in mammalian CNS formation: evidence from murine interspecies aggregation chimeras, Neuron, 2 (1989) 1565-1575. [29] Gratzner, H.G., Monoclonal antibody to 5'-bromo- and 5'iododeoxyuridine: a new reagent for detection of DNA replication, Science, 21 (1982) 474-475. [30] Graziadei, P.P.C., Olfactory development. In: J.R. Coleman (Ed.), Development of Sensory Systems in Mammals, Wiley, New York, 1990, pp. 519-566. [31] Graziadei, P.P.C. and Delian, R.S., Neuronal regeneration in frog olfactory system, J. Cell Biol., 59 (1973) 525-530.

26

L. Magrassi, P.P.C. Graziadei / Developmental Brain Research 96 (1996) 11-27

[32] Graziadei, P.P.C. and Metcalf, J.F., Autoradiographic study of frog's olfactory mucosa, Am. Zool., 10 (1970) 716. [33] Graziadei, P.P.C. and Metcalf, J.F.Z., Autoradiographic and ultrastructural observations on the frog olfactory mucosa, Z. Zellforsch., 116 (1971) 305-318. [34] Graziadei, P.P.C. and Monti-Graziadei, G.A., Neurogenesis and plasticity of the olfactory sensory neurons, Ann. NY Acad. Sci., 457 (1985) 127-142. [35] Guillemot, F., Lo, L.C., Johnson, J.E., Auerbach, A., Anderson, D.J. and Joyner, A.L., Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons, Cell, 75 (1993) 463-476. [36] Guthrie, S., Prince, V. and Lumsden, A., Selective dispersal of avian rhombomere cells in orthotopic and heterotopic grafts, Development, 118 (1993) 527-538. [37] Heckroth, J.A., Monti Graziadei, G.A. and Graziadei, P.P.C., Intraocular transplants of olfactory neuroepithelium in rat, Int. J. Dev. Neurosci., 1 (1983) 273-287. [38] Heckroth, J.A., Differentiation of Olfactory Neurons Transplanted to the Anterior Chamber of the Eye, PhD Dissertation, Florida State University, Tallahassee, FL, 1986. [39] Hendelman, W.J. and Aggerwal, A.S., The Purkinje neuron: I. A Golgi study of its development in the mouse and in culture, J. Comp. Neurot., 193 (1980) 1063-1079. [40] Honig, M.G. and Hume, R.I., Fluorescent carbocyanine dyes allow living neurons of identified origin to be studied in long term cultures, J. Cell Biol., 103 (1986) 171-187. [41] Jacobson, M., Developmental Biology, Plenum Press, New York, 1991: [42] Jousselin-Hosaja, M., Mailly, P. and Tsuji, S., Mouse adrenal chromaffin cells can transform to neuron-like cholinergic phenotypes after being grafted to the brain, Cell Tissue Res., 274 (1993) 199-205. [43] Jones, D.G. and Revell, E., The postnatal development of the synapse: a morphological approach utilizing synaptosomes. II paramembranous densities, Z Zellforsch., 111 (1970) 195-208. [44] Jordan, M., Regeneration of the endbrain in postmetamorphic Xenopus laevis, Folia Biol. (Praha), 6 (1958) 103-116. [45] Kawasaki, E.S. and Wang, A.M., Detection of gene expression. In: A. Erlich (Ed.), PCR Technology: Principles and Applications for DNA Amplification, Freeman, New York, 1992. [46] Kilpatrick, T.J., Cheema, S.S., Koblar, S.A., Tan, S.S. and Bartlet, P.F., The engraftment of transplanted primary neuroepithelial cells within the postnatal mouse brain, Neurosci. Lett., 181 (1994) 129133. [47] Kirsche, W., The significance of the matrix zones for brain regeneration and brain transplantation with special consideration of lower vertebrates. In: R.B. Wallace and G.D. Das (Eds.), Neurological Tissue Transplantation Research, Springer-Verlag, Berlin, 1983, pp. 65-104. [48] Klein, S.L. and Graziadei, P.P.C., The differentiation of the olfactory placode in Xenopus laevis: a light and electron microscope study, J. Comp. Neurol., 217 (1983) 17-20. [49] Koo, E.Y. and Graziadei, P.P.C., Cell migration from the transplanted olfactory placode in Xenopus, Anat. Embryol., 191 (1995) 171-181.. [50] Kosciuszko, H., The influence of the olfactory nerves on the regeneration of the endbrain in Xenopus tadpoles, Folia Biol. (Praha), 6 (1958) 117-130. [51] La Mantia, A.S., Colbert, M.C. and Linney, E., Retinoic acid induction and regional differentiation prefigure olfactory pathway formation in the mammalian forebrain, Neuron, 10 (1993) 10351048. [52] Lee, J.E., Hollenberg, S.M., Snider, L., Turner, D.L., Lipnick, N. and Weintraub, H., Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein, Science, 268 (1995) 836-844.

[53] Levy, E., Liem, R.K.M., D'Eustachio, P. and Cowan, N.J., Structure and evolutionary origin of the gene encoding mouse NF-M, the middle-molecular-mass neurofilament protein, Eur. J. Biochem., 166 (1987) 71-77. [54] Lewis, S., Wang, D. and Cowan, N.J., Microtubule associated protein MAP2 shares a microtubule binding motif with tau protein, Science, 242 (1988) 936-939. [55] Macklis, J.D., Transplanted neocortical neurons migrate selectively into regions of neuronal degeneration produced by chromophoretargeted laser photolysis, J. Neurosci., 13 (1993) 3848-3863. [56] Magrassi, L. and Graziadei, P.P.C., Interaction of the transplanted olfactory placode with the optic stalk and dieneephalon of Xenopus laevis embryos, Neuroscience, 15 (1985) 903-921. [57] Magrassi, L. and Graziadei, P.P.C., Phenotypic plasticity of cells dissociated from embryonic olfactory and vomeronasal organs. AChems (Sarasota), 1994, Abstract 180. [58] Magrassi, L. and Graziadei, P.P.C., Developmental potential of cells dissociated from the mature and developing olfactory organ and transplanted into the fetal brain, Soc. Neurosci. Abstr., (1994) 280.18. [59] Mahanthappa, N.K. and Schwarting, G.A., Peptide growth-factor control of olfactory neurogenesis and neuron survival in vitro: roles of ECF and TGFb-S, Neuron, 10 (1993) 293-305. [60] Maranto, A.R., Neuronal mapping: a photooxidation reactions makes Lucifer Yellow useful for electron microscopy, Science, 217 (1982) 953-955. [61] McConnell, S.K., Fates of visual cortical neurons in the ferret after isochronic and heterochronic transplantation, J. Neurosci., 8 (1988) 945 -947. [62] McConnell, S.K. and Kaznowski, C.E., Cell cycle dependence of laminar determination in developing neocortex, Science, 254 (1991) 282-285. [63] Monti Graziadei, G.A. and Graziadei, P.P.C., Neurogenesis and neuron regeneration in the olfactory system of mammals. II. Degeneration and reconstitutiou of the olfactory sensory neurons after axotomy, J. Neurocytol., 8 (1979) 197-213. [64] Monti-Graziadei, G.A., Cell migration from the olfactory neuroepithelium of neonatal and adult rodents, Dev. Brain Res., 70 (1992) 65 -74. [65] Morrison, E.E. and Graziadei, P.P.C., Transplant of olfactory mucosa in the rat brain. I A light microscopic study of transplant organization, Brain Res., 279 (1983) 241-245. [66] Moulton, D.G., Celebi, G. and Fink, R., Olfaction in mammals-two aspects: proliferation of cells in the olfactory epithelium and sensitivity to odors. In: G.E.W. Wolstenholme and J. Knight (Eds.), Ciba Foundation Symposium on Taste and Smell in Vertebrates, Churchill, London, 1970, pp. 227-250. [67] Norgren, R.B., Ratner, N. and Brackenbury, R., Development of olfactory nerve glia defined by a monoclonal antibody specific for Schwann-cells, Dev. Dynamics, 194 (1992) 231-238. [68] Onifer, S.M., Whittemore, S.R. and Holets, V.R., Variable morphological differentiation of a raphe-derived neuronal cell line following transplantation into the adult rat CNS, Exp. Neurol., 122 (1993) 130-142. [69] Patterson, P.H. and Chun, L.L.Y., The influence of non-neuronal cells on catecholamine and acetylcholine synthesis and accumulation in cultures of dissociated sympathetic neurons, Proc Natl. Acad. Sci. USA, 71 (1974) 3607-3610. [70] Paramore, C.G., Turner, D.A. and Madison, R.D.J., Fluorescent labeling of dissociated fetal ceils for tissue culture, Neurosci. Methods, 44 (1992) 7-17. [71] Pixley, S.K. and Pun, R.Y.K., Cultured rat olfactory neurons are excitable and respond to odors, Dev. Brain Res., 53 (1990) 125-130. [72] Pixley, S.K., CNS glial cells support in vitro survival, division, and differentiation of dissociated olfactory neuronal progenitor cells, Neuron, 8 (1992) 1191-1204. [73] Prokop, A. and Technau, G.M., Early tagma-specific commitment of

L. Magrassi, P.P. C. Graziadei / Developmental Brain Research 96 (1996) 11-27 Drosophila CNS progenitor NBI-1, Development, 120 (1994) 2567-2578. [74] Ramoncueto, A. and Nietosampedro, M., Regeneration into the spinal cord of transected dorsal-root axons is promoted by ensheathing glia transplants, Exp. Neurol., 127 (1994) 232-244. [75] Renfrantz, P.J., Cunninghmnm, M.G. and McKay, R.D.G., Regionspecific differentiation of the hippocampal stem cell line HiB5 upon implantation into the developing mammalian brain, Cell, 66 (1991) 713-729. [76] Reynolds, B.A. and Weiss, S., Generation of neurons and astrocytes from isolated cells of the adult mammalian CNS, Science, 255 (1992) 1707-1710. [77] Richards, L.J., Kilpatrick, TJ. adn Bartlet, P.F., De novo generation of neuronal cells from the adult mouse brain, Proc. Natl. Acad. Sci. USA, 89 (1992) 8591-8595. [78] Ronnett, G.V., Hester, L.D. and Snyder, S.H., Primary cultures of neonatal rat olfactory neurons, J. Neurosci., 11 (1991) 1243-1255. [79] Ryder, E.F. and Cepko, C.L., Migration patterns of clonaUy related granule cells and their progenitors in the developing chick cerebellum, Neuron, 12 (1994)1011-1029. [80] Sandell, J.H. and Masland, R.H., Photoconversion of some fluorescent markers to a diaminobenzidine product, J. Histochem. Cytochem., 36 (1988) 555-559. [81] Sanders, E.J., A comparison of the adhesiveness of somitic cells from chick and quail emburos. In: R. Bellairs, D. Ede and J. Lash (Eds.), Somites in Developing Embryos, Plenum Press, New York, 1986, pp. 191-200. [82] Sanes, J.R., Rubenstein, J.R.L. and Nicolas, J.F., Use of a recombinant retrovirus to study post-implantation cell lineage in mouse embryos, EMBO J., 5 (1986) 3133-3142. [83] Schubert, D., Stallcup, W., Lacorbier, M., Kidokoro, Y. and Orgel, L., Ontogeny of electrically excitable cells in cultured olfactory epithelium, Proc. Natl. Acad. Sci. USA, 82 (1985) 7782-7786. [84] Schwanzel-Fukuda, M. and Pfaff, D.W., Luteinizing hormone-releasing hormone (LHRH)-expressing cells do not migrate normally in an inherited hypogonadai (Kallmann) syndrome, Mol. Brain Res. Nature, 338 (1989) 161-164. [85] Shetty, A.K., Madison, R.D., Bradley, J. and Turner, D.A., Quantitative graft integration of fetal hippocampal transplants labeled with 5' bromodeoxyuridine into nolnnal adult hippocampus, Exp. Neurol., 126 (1994) 205-224. [86] Simeone, A., Gulisano, M., Acampora, D., Stornaiuolo, A., Ram-

27

baldi, M. and Boncinelli, E., Two vertebrate homeobox genes related to the Drosophila empty spiracles gene are expressed in the embryonic cerebral cortex, EMBO J., 11 (1992) 2541-2550. [87] Simeone, A., Acampora, D., Gulisano, M., Stornaiuolo, A. and Boncinelli, E., Nested expression domains of four homeobox genes in developing rostral brain, Nature, 358 (1992) 687-690. [88] Snyder, E.Y., Deitcher, D.L., Walsh, C., Arnold-Aldea, S., Hartwieg, E.A. and Cepko, C.L., Multipotent neural cell lines can engraft and participate in development of mouse cerebellum, Cell, 68 (1992) 33-51. [89] Snyder, E.Y., Taylor, R.M. and Wolfe, J.H., Neural progenitor cell engraftment corrects lysosomal storage throughout the MPS VII mouse brain, Nature, 374 (1995) 367-370. [90] Sotelo, C. and Alvarado-Mallart, R.M., Embryonic and adult neurons interact to allow Purkinje cell replacement in mutant cerebellum, Nature, 327 (1987) 421-423. [91] Sotelo, C., Bourrat, F. and Triller, A., Postnatal development of the inferior olivary complex in the rat. II. Topographic organization of the immature olivocerebellar projection, J. Comp. Neurol., 22 (1984) 177-189. [92] Stout, R.P. and Graziadei, P.P.C., Influence of the placode on the development of the brain in Xenopus laevis (Daudin). I. Axonal growth and connections of the transplanted olfactory placode, Neuroscience, 5 (1980) 2175-2186. [93] Thomhill, R.A., Cell division in the olfactory epithelium of the lamprey, Lampetrafluviatilis, Z. Zellforsch., 109 (1970) 147-160. [94] Unsicker, K., Kirsch, B., Otten, U. and Thoenen, H., Nerve growth factor induced fiber outgrowth from isolated rat adrenal chromaffin cells: impairment by glucocorticoids, Proc. Natl. Acad. Sci. USA, 75 (1978) 3489-3502. [95] Wolozin, B., Sunderland, T., Zheng, B., Resau, J., Duly, B., Barker, J., Swerdlow, R., Coon, H. and Continuous culture of neuronal cells from adult human olfactory epithelium, J. Mol. Neurosci., 3 (1992) 137-146. [96] Wray, S., Grant, P. and Gainer, H., Evidence that cells expressing luteinizing hormone-releasing hormone mRNA in the mouse are derived from progenitor cells in the olfactory placode, Proc. Natl. Acad. Sci. USA, 86 (1989) 8132-8136. [97] Yntema, Ear and nose. In: B.H. Willier, P.A. Weiss and V. Hamburger (Eds.), Analysis of Animal Development, W.B. Saunders, Philadelphia, PA, 1955, pp. 415-428.