- Email: [email protected]
NF-κB pathway in Raw 264.7 murine macrophages
Immunology Letters 110 (2007) 121–125
Lipopolysaccharide stimulates Epac1-mediated Rap1/NF-B pathway in Raw 264.7 murine macrophages Eun-Yi Moon a,b,∗ , Suhkneung Pyo c a
b
Department of Bioscience and Biotechnology, Sejong University, Seoul 143-747, Republic of Korea Laboratory of Human Genomics, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Taejeon 305-806, Republic of Korea c College of Pharmacy, Sung-Kyun-Kwan University, Suwon 440-746, Republic of Korea Received 4 January 2007; received in revised form 18 March 2007; accepted 16 April 2007 Available online 11 May 2007
Abstract Nuclear factor-kappa B (NF-B) is regulated by various stimulants to show many physiological results. Lipopolysaccharide (LPS) activates NF-B through toll-like receptor 4 (TLR4)-dependent signal transduction. LPS-treatment also produces cyclic AMP (cAMP) in Raw 264.7 murine macrophages. Two principal effector proteins for cAMP are protein kinase A (PKA) and cAMP-responsive guanine nucleotide exchange factor (Epac), a Rap GDP exchange factor. Here, we investigated whether NF-B can be activated by cAMP production through Epac1-mediated Rap1 activation by using Epac-specific cAMP analogue, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT). NF-B activity was increased by the treatment with CPT but it was reduced by co-transfection with dominant negative of Rap1 (Rap1N17). In conclusion, NF-B activation should be regulated through Epac1-mediated Rap1 stimulation for LPS-induced inflammatory responses in murine macrophages. It suggests that Epac1-mediated Rap1/NF-B pathway could be helpful for interpretation on various cAMP-mediated physiological responses and it could be used as a target to control their pathological abnormalities. © 2007 Elsevier B.V. All rights reserved. Keywords: LPS; NF-B; cAMP; PKA; Epac1; Rap1
1. Introduction Toll-like receptors (TLRs) recognize pathogen-associated molecular patterns and evoke various cell signaling pathways. In mammals, 10 members of the TLR family have been identified and shown to be involved in innate immunity and inflammation responses [1,2]. LPS is an integral component of the outer membrane of Gram-negative bacteria. Upon binding of LPS to TLR4, the cytoplasmic region of TLR4 recruits MyD88 linking TLR4 to IL-1R kinase (IRAK) associated with TRAF6. Sequential activation of IRAK and TRAF6 results in nuclear factor-kappa B (NF-B) activation [2,3]. Abbreviations: cAMP, cyclic adenine monophosphate; Epac, cAMPresponsive guanine nucleotide exchange factor; FBS, fetal bovine serum; LPS, lipopolysaccharide; ROS, reactive oxygen species; SEAP, secreted alkaline phosphatase ∗ Corresponding author at: Department of Bioscience and Biotechnology, Sejong University, Seoul 143-747, Republic of Korea. Tel.: +82 2 3408 3768; fax: +82 2 466 8768. E-mail addresses: [email protected], [email protected] (E.-Y. Moon). 0165-2478/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.imlet.2007.04.002
NF-B family consists of five members: NF-B 1 (p105/ p50), NF-B 2 (p100/p52), RelA (p65), RelB and c-Rel. The activity of NF-B is primarily controlled at the post-translational level [4,5]. In unstimulated cells, NF-B exists in an inactive state in the cytoplasm complexed with the inhibitory protein called inhibitory factor kappa B (IB). Upon activation, IB undergoes phosphorylaton and degradation. NF-B heterodimer is translocated into the nucleus where it binds to DNA and activates transcription [6]. De novo synthesis of new IB proteins occurs after its phosphorylation and degradation by IB kinase (IKK) and then IB enters the nucleus, dissociates NF-B from DNA, and again inactivates NF-B [7]. Cyclic AMP (cAMP) is produced by the activation of Gs protein-coupled receptors and adenylate cyclase. cAMP degradation is occurred by the phosphodiesterases. cAMP is considered to be a ubiquitous regulator of inflammatory and immunological reactions [8–10]. It regulates many physiological processes via the activation of protein kinase A (PKA). Recently Epac1 was characterized as a new effector molecule of cAMP by Bos’ group and it was demonstrated to exert a regulatory effect on the activity of Rap1 [11–13]. Rap1 is
122
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
one of downstream molecules in integrin-mediated signaling during tumor progression [14]. NF-B is a key transcription factor in cancer development and progression [15]. Through rational drug design, this group has developed a novel cAMP analogue, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 cyclic monophosphate (CPT), which activates Epac, but not PKA, both in vitro and in vivo. CPT has proven to be very useful to study an independent pathway of PKA and Epac [16]. There have been conflicting evidences regarding the action of cAMP/PKA on NF-B [17–19]. Signals that cause the degradation of IB result in activation of PKA in a cAMP-independent manner and the subsequent phosphorylation of p65. Therefore, this pathway represents a novel mechanism for the cAMPindependent activation of PKA and the regulation of NF-B activity [18]. Phosphorylation by PKA both weakens the interaction between the N- and C-terminal regions of p65 and creates an additional site for interaction with CBP/p300. Therefore, PKA regulates the transcriptional activity of NF-B by modulating its interaction with CBP/p300 [19]. In contrast, the inhibitory action of the cAMP/PKA pathway on the transcriptional activity of NF-B appears to be exhibited by modifying the C-terminal transactivation domain of p65, either directly or indirectly [17]. Although PKA affect NF-B activation, little is known about whether another cAMP-mediated signaling pathway, Epac-mediated Rap1 activation, affects NF-B activity. Here, we studied whether LPS-stimulation activates Epac and whether Epac1-mediated Rap1 activation is involved in NFB activation in murine macrophages, since it has been known that macrophages are at the center of either the tumor invasion microenvironment and are an important drug target for cancer therapy [20] or innate immunity and inflammation responses [1,2]. Data suggest that NF-B could be regulated by cAMPdependent pathway through Epac1-mediated Rap1 activation in Raw 264.7 murine macrophages.
fused to a TATA-like promoter region from the Herpes simplex virus thymidine kinase promoter. After endogenous NF-B proteins bind to the kappa () enhancer element (B4) transcription is induced and the reporter gene is activated. The secreted SEAP enzyme can be assayed directly from the culture medium using Great EscAPe Chemilumineacence Detection Kits (BD Biosciences Clontech, Palo Alto, CA). Chemilumineacence was measured by luminometer (Perkin-Elmer, Wellesely, MA). 2.3. Electrophoretic mobility shift assay (EMSA) Nuclear extracts were prepared as described previously [21]. The protein content of the nuclear extracts was determined using a Bio-Rad protein assay kit according to the manufacturer’s instruction (Amersham Nioaciences UL, Ltd.). The oligonucleotide sequence for NF-B was 5 gatctcagaggggactttccgagaga-3 [22]. Double-stranded oligonucleotides were end-labeled with [␥-32 P]-ATP. Nuclear extracts (5 g) were incubated with 2 g of poly(dI–dC) and a 32 Plabeled DNA probe, and DNA binding activity was analyzed using a 5% polyacrylamide gel. After electrophoresis, the gel was dried and subjected to autoradiography. The specificity of binding was examined by competition with an unlabeled oligonucleotide. 2.4. Enzyme-linked immunosorbent assay (ELISA) for cAMP The cAMP assay was performed by ELISA according to the manufacturer’s protocols (Oxford Biomedical Research, Oxford, MI). Samples were processed using the acetylation protocol. Trimethylbenzidine (TMB) was used as a substrate for HRP and absorbance was measured at 450 nm. 2.5. RT-PCR
2. Materials and methods
Bacterial lipopolysaccharide (LPS) from E. coli 055:B5 (Sigma; L6529) was resuspended in serum-free medium at a concentration of 1 mg/ml and stored at −20 ◦ C. 8-CPT-2-MecAMP were purchased from Alexis (Carlsbad, CA). Antibodies which are reactive with Rap1 came from Santa Crut Biotechnology. Except where indicated, all other materials are obtained from the Sigma Chemical Company (St. Louis, MO).
RNA was isolated from Raw 264.7 cells using TRIZOL (Invitrogen, Carlsbad, CA). cDNA was synthesized from 1 g of total RNA, using oligo dT18 primers and superscript reverse transcriptase in a final volume of 21 l (Bioneer, Taejeon, Korea). For standard PCR, 1 l of the first strand cDNA product was then used as a template for PCR amplification with Taq DNA polymerase (Bioneer, Taejeon, Korea). PCR amplification proceeded as follows: 35 thermocycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min, and 72 ◦ C for 1 min, using oligonucleotides specific for Epac1 (sense; gctctcccctcctgtcatcc, antisense; gttcccgctggttgtcaatg).
2.2. Measurement of NF-κB activity
2.6. Western blot analysis
pNF-B-SEAP (BD Biosciences, Palo Alto, CA) was subcloned into pcDNA3.1 between Kpn1 and Xba1 (pNF-BSEAP). NF-B activation was measured by the transfection with pNF-B-SEAP. pNF-B-SEAP (BD Biosciences, Palo Alto, CA) is designed for monitoring the activation of NF-B signal transduction pathway. pNF-B-SEAP contains the secreted alkaline phosphatase (SEAP) reporter gene. This vector also contains four tandem copies of the NF-B consensus sequence
Cells were lysed in ice-cold lysis buffer, containing 0.5% Nonidet P-40 (v/v) in 20 mM Tris–HCl, at a pH of 8.3; 150 mM NaCl; protease inhibitors (2 g/ml aprotinin, pepstatin, and chymostatin; 1 g/ml leupeptin; 1 mM phenylmethyl sulfonyl fluoride (PMSF); and 1 mM Na4 VO3 ). Lysates were incubated for 30 min on ice prior to centrifugation at 14,000 rpm for 5 min at 4 ◦ C. Proteins in the supernatant were denatured by boiling for 5 min in sodium dodecyl sulfate (SDS) sample buffer. Proteins
2.1. Reagents
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
were separated by 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to nitrocellulose membranes. Following this transfer, equal loading of protein was verified by Ponceau staining. The membranes were blocked with 5% skim milk in Tris-buffered saline with Tween (TBST) (10 mM Tris–HCl, pH 7.6; 150 mM NaCl; 0.5% Tween), then incubated with the indicated antibodies. Bound antibodies were visualized with HRP-conjugated secondary antibodies with the use of enhanced chemiluminescence (ECL) (Pierce, Rockford, IL). 2.7. Rap1 GTPase activation assay The level of activated Rap1 was determined by “pulldown” analysis. The technique for pulldown analysis has been previously described [23]. Ten million cells were harvested in lysis buffer (50 mM Tris–HCl, pH 7.2, 200 mM NaCl, 5 mM MgCl2 , 1% NP-40, 10% glycerol, 2 g/ml aprotinin, leupeptin and pepstatin, 1 mM PMSF). Whole cell lysate was incubated for 2 h with 6 l of glutathione sepharose 4B beads, which had been preassociated with 6 g GST-RalGDS-RBD. The beads were washed three times with cell lysis buffer. GTP bound GTPase was released from the beads by addition of 1× protein sample buffer, and 5 min of boiling. The released GTPases was then detected by Western blot analysis using an anti-Rap1 antibody and ECL Plus chemiluminescence (Amersham, Piscataway, NJ).
123
2.8. Statistical analyses Experimental differences were tested for statistical significance using ANOVA and Students’ t-test. P value of <0.05 or <0.01 was considered to be significant. 3. Results 3.1. NF-κB was activated by Epac activator Two principal effector proteins for cAMP are protein kinase A (PKA) and cAMP-responsive guanine nucleotide exchange factor (Epac), a Rap GDP exchange factor. Previous reports show that NF-B activation was accomplished by PKA activation and the phosphorylation of p65 subunit [18,19]. Here, we investigated whether NF-B activation can be regulated by Epac1-mediated Rap1 activation. When we treated NF-B-SEAP vector-transfected cells with Epac activator, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT), NF-B was activated, time- and dosedependently (Fig. 1A). It shows that NF-B activation could be regulated by Epac1-mediated Rap1. Based on that LPS stimulated cAMP production [9] and NFB activation [18], we used LPS-stimulation as a positive control for NF-B activation. Our data showed that NF-B was activated
Fig. 1. NF-B activity was increased by the treatment with Epac activator, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT). (A) Raw 264.7 cells were transfected with NF-B-secreted alkaline phosphatase (SEAP) vector. Cells were treated with various concentrations of CPT (12.5, 25, and 50 g/ml) or LPS (5 g/ml). Conditioned media containing SEAP released was sampled at appropriate time point. NF-B activation was measured as SEAP activity with SEAP assay kit, as described in Section 2. SEAP activity in each group was expressed as fold induction of untreated control. Data were the representative of three experiments. (B) Raw 264.7 murine macrophages were transfected with NF-B-SEAP vector. NF-B activation was measured as SEAP activity released with SEAP assay kit, as described in Section 2. Vector indicated the result of pcDNA3.1 vector only-transfected group and control showed the SEAP activity in pNFkB-SEAP-transfected and LPS-untreated group. (C) Raw 264.7 cells were stimulated with lipopolysaccharide (LPS). Intracellular cAMP levels were measured by ELISA, as described in Section 2. cAMP levels increased as a result of LPS stimulation. Data were the representative of three experiments. Data in the bar graph represent the means ± S.E.D. *p < 0.05; **p < 0.01; significant as compared to LPS non-stimulated control.
124
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
Fig. 2. NF-B activation was increased by the treatment with LPS or Epac activator, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT). NF-B activation was measured by the amount of NF-B binding to probe. Electrophoretic mobility shift assay (EMSA) that was described in Section 2 was performed to detect NF-B binding to probe.
by LPS-stimulation after murine macrophages were transfected with pNF-B-SEAP. NF-B activity by LPS-stimulation was more than twice (Fig. 1B). In addition, LPS-stimulation increased cAMP production in murine macrophages (Fig. 1C). These data are consistent with previous reports in other cells [24,25]. It implicates that NF-B activation could be regulated by cAMP-dependent Epac1-mediated Rap1 activation. NF-B activation by Epac activator was re-affirmed by electrophoretic mobility shift assay (EMSA) (Fig. 2). Data suggest that NF-B activation could be a combined result of cAMP-dependent and cAMP-independent signalings by LPS-stimulation. 3.2. Epac1-mediated Rap1 was activated by LPS-stimulation in murine macrophages To confirm the Epac-mediated Rap1 activation in murine macrophages, we examined whether murine macrophages expressed Epac1 gene and whether Epac1-mediated Rap1 was activated by the treatment with LPS or Epac activator. We detected Epac1 expression in Raw 264.7 murine macrophages (Fig. 3A). As shown in (B), Epac1-mediated Rap1 activity was increased by the treatment with Epac activator, CPT. LPSstimulation also increased Rap1 activity (C). It suggests that LPS-stimulated NF-B activation could be affected by Epac1mediated Rap1 activity. 3.3. NF-κB activation was attenuated by dominant negative Rap1 To confirm that NF-B could be activated by Epac1-mediated Rap1 activation in murine macrophages, NF-B-SEAP vector was co-transfected into macrophages with dominant negative Rap1N17. When macrophages were treated with Epac activa-
Fig. 3. Epac1 expression and Epac1-mediated Rap1 activation due to LPSstimulation were detected in the Raw 264.7 cells. (A) Total RNA was isolated with TRIZOL. Epac transcripts measured by RT-PCR were detected in the Raw 264.7 murine macrophages. Open triangle represents the increase of cDNA (0.5, 1 and 2 l) used for PCR. (B) When cells were treated with Epac1-specific activator 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT), Epac1-mediated Rap1 activation was detected in the Raw 264.7 murine macrophages. (C) When cells were stimulated with LPS Epac1-mediated Rap1 activity was increased in a dose-dependent manner. Data were the representative of five experiments.
tor, CPT, Rap1-mediated NF-B activation was inhibited by dominant negative Rap1N17 (Fig. 4). In this case, dominant negative p300 co-activator (p300DN) was used as a positive control. Data demonstrate that Epac1-mediated Rap1 activation could be another pathway to stimulate NF-B activation. 4. Discussion Ten members of the TLR family have been identified and shown to be involved in innate immunity and inflammation responses [1,2]. Among them, TLR4 agonist, LPS-stimulation produces cAMP [9] and results in nuclear factor-kappa B (NFB) activation [2,3]. There have been conflicting evidences regarding the action of cAMP/cAMP-dependent protein kinase (PKA) signaling pathway on NF-B [17–19]. However, little is known about the other cAMP-mediated signaling pathway, Epac-mediated Rap1 activation on NF-B activation. Our results show that transcriptional activity of NF-B could be elevated by Epac1-mediated Rap1 pathway in murine macrophages. Data implicate that NF-B could be regulated by cAMP-dependent pathway at least in macrophage-mediated inflammation. Some explanations are possible on inter-relationship between cAMP-dependent or -independent NF-B activation. LPS stimulated cAMP production and cAMP activates Epac1-mediated Rap1, which results in NF-B activation. In the meanwhile, PKA activated by LPS-stimulation could lead to cAMP-independent NF-B activation [18,19]. Therefore, LPS-stimulated NF-
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
125
Fig. 4. NF-B activity was decreased by the co-transfection with dominant negative Rap1 (Rap1N17) or p300 (p300DN). (A) Raw 264.7 murine macrophages were transfected with NF-B-SEAP vector and Rap1N17 or p300DN. Cells were stimulated with 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT) and NF-B activation was measured as SEAP activity released with SEAP assay kit, as described in Section 2. At each time point, CPT-stimulated NF-B activation was expressed as fold induction of SEAP activity as compared to CPT-untreated control. Data were the representative of three experiments. (B) Data in the bar graph represent the means ± S.E.D. in 18-h incubation with CPT. *p < 0.05; **p < 0.01; significant as compared to CPT-stimulated control.
B could be cooperatively activated by cAMP-dependent Epac1-mediated Rap1 activation and cAMP-independent PKA activation. However, it is not cleared yet whether one of two pathways is activated first in relation to cAMP production or two pathways are activated at the same time. Even though no evidences are reported until now, it is possible for two pathways to be regulated by each other. It remains to be cleared the inter-relationship of PKA-mediated pathways and Epacmediated pathways on NF-B activation. In conclusion, Epac1-mediated Rap1 pathway is involved in LPS-stimulated NF-B activation in macrophages. NF-B activation may be a result from the total addition of various signaling pathways involving cAMP-independent PKA activation [18,19] and cAMP-dependent Epac1-mediated Rap1 activation. Epac1-mediated Rap1 could play a role in inflammation and a consecutive cancer development through cAMP-dependent NF-B activation. Therefore, it suggests that Epac1-mediated Rap1/NF-B pathway could provide a helpful interpretation on various cAMP-mediated physiological responses and it could be a therapeutic target to develop an inhibitor to control TLR4mediated abnormalities.
References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]
Acknowledgments We thank Dr. Johannes L. Bos, Department of Physiological Chemistry, University Medical Center Utrecht (UMCU) of the Netherlands for providing RalGDS-RBD-GST plasmid. This work was supported by grants from the Molecular and Cellular BioDiscovery Research Program, Ministry of Science and Technology, Korea and National Cancer Control Program, Ministry of Health and Welfare, Korea. This work was also supported by the faculty research fund of Sejong University in 2006.
[19] [20] [21] [22] [23] [24] [25]
Akira S, Takeda K. Nat Rev Immunol 2004;4:499–511. Takeda K, Akira S. Semin Immunol 2004;16:3–9. Akira S, Takeda K, Kaisho T. Nat Immunol 2001;2:675–80. Bonizzi G, Karin M. Trends Immunol 2004;25:280–8. Finco TS, Baldwin AS. Immunity 1995;3:263–72. Shishodia S, Aggarwal BB. Biochem Pharmacol 2004;68:1071–80. Huang TT, Kudo N, Yoshida M, Miyamoto S. Proc Natl Acad Sci USA 2000;97:1014–9. Caggiano AO, Kraig RP. J Neurochem 1999;72:565–75. Moon EY, Oh SY, Han GH, Lee CS, Park SK. J Neurosci Res 2005;81:38–44. Nakamura Y, Si QS, Kataoka K. Neurosci Res 1999;35:95–100. Bos JL. Nat Rev Mol Cell Biol 2003;4:733–8. de Rooij J, Rehmann H, van Triest M, Cool RH, Wittinghofer A, Bos JL. J Biol Chem 2000;275:20829–36. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A, et al. Nature 1998;396:474–7. Guo W, Giancotti FG. Nat Rev Mol Cell Biol 2004;5:816–26. Karin M. Nature 2006;441:431–6. Enserink JM, Christensen AE, de Rooij J, van Triest M, Schwede F, Genieser HG, et al. Nat Cell Biol 2002;4:901–6. Takahashi N, Tetsuka T, Uranishi H, Okamoto T. Eur J Biochem 2002;269:4559–65. Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S. Cell 1997;89:413–24. Zhong H, Voll RE, Ghosh S. Mol Cell 1998;1:661–71. Condeelis J, Pollard JW. Cell 2006;124:263–6. Jeon YJ, Kim YK, Lee M, Park SM, Han SB, Kim HM. J Pharmacol Exp Ther 2000;294:548–54. Pierce JW, Lenardo M, Baltimore D. Proc Natl Acad Sci USA 1988;85:1482–6. Ren XD, Kiosses WB, Schwartz MA. EMBO J 1999;18:578–85. Asehnoune K, Strassheim D, Mitra S, Kim JY, Abraham E. J Immunol 2004;172:2522–9. Sanlioglu S, Williams CM, Samavati L, Butler NS, Wang G, McCray Jr PB, et al. J Biol Chem 2001;276:30188–98.
Lipopolysaccharide stimulates Epac1-mediated Rap1/NF-B pathway in Raw 264.7 murine macrophages Eun-Yi Moon a,b,∗ , Suhkneung Pyo c a
b
Department of Bioscience and Biotechnology, Sejong University, Seoul 143-747, Republic of Korea Laboratory of Human Genomics, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Taejeon 305-806, Republic of Korea c College of Pharmacy, Sung-Kyun-Kwan University, Suwon 440-746, Republic of Korea Received 4 January 2007; received in revised form 18 March 2007; accepted 16 April 2007 Available online 11 May 2007
Abstract Nuclear factor-kappa B (NF-B) is regulated by various stimulants to show many physiological results. Lipopolysaccharide (LPS) activates NF-B through toll-like receptor 4 (TLR4)-dependent signal transduction. LPS-treatment also produces cyclic AMP (cAMP) in Raw 264.7 murine macrophages. Two principal effector proteins for cAMP are protein kinase A (PKA) and cAMP-responsive guanine nucleotide exchange factor (Epac), a Rap GDP exchange factor. Here, we investigated whether NF-B can be activated by cAMP production through Epac1-mediated Rap1 activation by using Epac-specific cAMP analogue, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT). NF-B activity was increased by the treatment with CPT but it was reduced by co-transfection with dominant negative of Rap1 (Rap1N17). In conclusion, NF-B activation should be regulated through Epac1-mediated Rap1 stimulation for LPS-induced inflammatory responses in murine macrophages. It suggests that Epac1-mediated Rap1/NF-B pathway could be helpful for interpretation on various cAMP-mediated physiological responses and it could be used as a target to control their pathological abnormalities. © 2007 Elsevier B.V. All rights reserved. Keywords: LPS; NF-B; cAMP; PKA; Epac1; Rap1
1. Introduction Toll-like receptors (TLRs) recognize pathogen-associated molecular patterns and evoke various cell signaling pathways. In mammals, 10 members of the TLR family have been identified and shown to be involved in innate immunity and inflammation responses [1,2]. LPS is an integral component of the outer membrane of Gram-negative bacteria. Upon binding of LPS to TLR4, the cytoplasmic region of TLR4 recruits MyD88 linking TLR4 to IL-1R kinase (IRAK) associated with TRAF6. Sequential activation of IRAK and TRAF6 results in nuclear factor-kappa B (NF-B) activation [2,3]. Abbreviations: cAMP, cyclic adenine monophosphate; Epac, cAMPresponsive guanine nucleotide exchange factor; FBS, fetal bovine serum; LPS, lipopolysaccharide; ROS, reactive oxygen species; SEAP, secreted alkaline phosphatase ∗ Corresponding author at: Department of Bioscience and Biotechnology, Sejong University, Seoul 143-747, Republic of Korea. Tel.: +82 2 3408 3768; fax: +82 2 466 8768. E-mail addresses: [email protected], [email protected] (E.-Y. Moon). 0165-2478/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.imlet.2007.04.002
NF-B family consists of five members: NF-B 1 (p105/ p50), NF-B 2 (p100/p52), RelA (p65), RelB and c-Rel. The activity of NF-B is primarily controlled at the post-translational level [4,5]. In unstimulated cells, NF-B exists in an inactive state in the cytoplasm complexed with the inhibitory protein called inhibitory factor kappa B (IB). Upon activation, IB undergoes phosphorylaton and degradation. NF-B heterodimer is translocated into the nucleus where it binds to DNA and activates transcription [6]. De novo synthesis of new IB proteins occurs after its phosphorylation and degradation by IB kinase (IKK) and then IB enters the nucleus, dissociates NF-B from DNA, and again inactivates NF-B [7]. Cyclic AMP (cAMP) is produced by the activation of Gs protein-coupled receptors and adenylate cyclase. cAMP degradation is occurred by the phosphodiesterases. cAMP is considered to be a ubiquitous regulator of inflammatory and immunological reactions [8–10]. It regulates many physiological processes via the activation of protein kinase A (PKA). Recently Epac1 was characterized as a new effector molecule of cAMP by Bos’ group and it was demonstrated to exert a regulatory effect on the activity of Rap1 [11–13]. Rap1 is
122
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
one of downstream molecules in integrin-mediated signaling during tumor progression [14]. NF-B is a key transcription factor in cancer development and progression [15]. Through rational drug design, this group has developed a novel cAMP analogue, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 cyclic monophosphate (CPT), which activates Epac, but not PKA, both in vitro and in vivo. CPT has proven to be very useful to study an independent pathway of PKA and Epac [16]. There have been conflicting evidences regarding the action of cAMP/PKA on NF-B [17–19]. Signals that cause the degradation of IB result in activation of PKA in a cAMP-independent manner and the subsequent phosphorylation of p65. Therefore, this pathway represents a novel mechanism for the cAMPindependent activation of PKA and the regulation of NF-B activity [18]. Phosphorylation by PKA both weakens the interaction between the N- and C-terminal regions of p65 and creates an additional site for interaction with CBP/p300. Therefore, PKA regulates the transcriptional activity of NF-B by modulating its interaction with CBP/p300 [19]. In contrast, the inhibitory action of the cAMP/PKA pathway on the transcriptional activity of NF-B appears to be exhibited by modifying the C-terminal transactivation domain of p65, either directly or indirectly [17]. Although PKA affect NF-B activation, little is known about whether another cAMP-mediated signaling pathway, Epac-mediated Rap1 activation, affects NF-B activity. Here, we studied whether LPS-stimulation activates Epac and whether Epac1-mediated Rap1 activation is involved in NFB activation in murine macrophages, since it has been known that macrophages are at the center of either the tumor invasion microenvironment and are an important drug target for cancer therapy [20] or innate immunity and inflammation responses [1,2]. Data suggest that NF-B could be regulated by cAMPdependent pathway through Epac1-mediated Rap1 activation in Raw 264.7 murine macrophages.
fused to a TATA-like promoter region from the Herpes simplex virus thymidine kinase promoter. After endogenous NF-B proteins bind to the kappa () enhancer element (B4) transcription is induced and the reporter gene is activated. The secreted SEAP enzyme can be assayed directly from the culture medium using Great EscAPe Chemilumineacence Detection Kits (BD Biosciences Clontech, Palo Alto, CA). Chemilumineacence was measured by luminometer (Perkin-Elmer, Wellesely, MA). 2.3. Electrophoretic mobility shift assay (EMSA) Nuclear extracts were prepared as described previously [21]. The protein content of the nuclear extracts was determined using a Bio-Rad protein assay kit according to the manufacturer’s instruction (Amersham Nioaciences UL, Ltd.). The oligonucleotide sequence for NF-B was 5 gatctcagaggggactttccgagaga-3 [22]. Double-stranded oligonucleotides were end-labeled with [␥-32 P]-ATP. Nuclear extracts (5 g) were incubated with 2 g of poly(dI–dC) and a 32 Plabeled DNA probe, and DNA binding activity was analyzed using a 5% polyacrylamide gel. After electrophoresis, the gel was dried and subjected to autoradiography. The specificity of binding was examined by competition with an unlabeled oligonucleotide. 2.4. Enzyme-linked immunosorbent assay (ELISA) for cAMP The cAMP assay was performed by ELISA according to the manufacturer’s protocols (Oxford Biomedical Research, Oxford, MI). Samples were processed using the acetylation protocol. Trimethylbenzidine (TMB) was used as a substrate for HRP and absorbance was measured at 450 nm. 2.5. RT-PCR
2. Materials and methods
Bacterial lipopolysaccharide (LPS) from E. coli 055:B5 (Sigma; L6529) was resuspended in serum-free medium at a concentration of 1 mg/ml and stored at −20 ◦ C. 8-CPT-2-MecAMP were purchased from Alexis (Carlsbad, CA). Antibodies which are reactive with Rap1 came from Santa Crut Biotechnology. Except where indicated, all other materials are obtained from the Sigma Chemical Company (St. Louis, MO).
RNA was isolated from Raw 264.7 cells using TRIZOL (Invitrogen, Carlsbad, CA). cDNA was synthesized from 1 g of total RNA, using oligo dT18 primers and superscript reverse transcriptase in a final volume of 21 l (Bioneer, Taejeon, Korea). For standard PCR, 1 l of the first strand cDNA product was then used as a template for PCR amplification with Taq DNA polymerase (Bioneer, Taejeon, Korea). PCR amplification proceeded as follows: 35 thermocycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min, and 72 ◦ C for 1 min, using oligonucleotides specific for Epac1 (sense; gctctcccctcctgtcatcc, antisense; gttcccgctggttgtcaatg).
2.2. Measurement of NF-κB activity
2.6. Western blot analysis
pNF-B-SEAP (BD Biosciences, Palo Alto, CA) was subcloned into pcDNA3.1 between Kpn1 and Xba1 (pNF-BSEAP). NF-B activation was measured by the transfection with pNF-B-SEAP. pNF-B-SEAP (BD Biosciences, Palo Alto, CA) is designed for monitoring the activation of NF-B signal transduction pathway. pNF-B-SEAP contains the secreted alkaline phosphatase (SEAP) reporter gene. This vector also contains four tandem copies of the NF-B consensus sequence
Cells were lysed in ice-cold lysis buffer, containing 0.5% Nonidet P-40 (v/v) in 20 mM Tris–HCl, at a pH of 8.3; 150 mM NaCl; protease inhibitors (2 g/ml aprotinin, pepstatin, and chymostatin; 1 g/ml leupeptin; 1 mM phenylmethyl sulfonyl fluoride (PMSF); and 1 mM Na4 VO3 ). Lysates were incubated for 30 min on ice prior to centrifugation at 14,000 rpm for 5 min at 4 ◦ C. Proteins in the supernatant were denatured by boiling for 5 min in sodium dodecyl sulfate (SDS) sample buffer. Proteins
2.1. Reagents
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
were separated by 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to nitrocellulose membranes. Following this transfer, equal loading of protein was verified by Ponceau staining. The membranes were blocked with 5% skim milk in Tris-buffered saline with Tween (TBST) (10 mM Tris–HCl, pH 7.6; 150 mM NaCl; 0.5% Tween), then incubated with the indicated antibodies. Bound antibodies were visualized with HRP-conjugated secondary antibodies with the use of enhanced chemiluminescence (ECL) (Pierce, Rockford, IL). 2.7. Rap1 GTPase activation assay The level of activated Rap1 was determined by “pulldown” analysis. The technique for pulldown analysis has been previously described [23]. Ten million cells were harvested in lysis buffer (50 mM Tris–HCl, pH 7.2, 200 mM NaCl, 5 mM MgCl2 , 1% NP-40, 10% glycerol, 2 g/ml aprotinin, leupeptin and pepstatin, 1 mM PMSF). Whole cell lysate was incubated for 2 h with 6 l of glutathione sepharose 4B beads, which had been preassociated with 6 g GST-RalGDS-RBD. The beads were washed three times with cell lysis buffer. GTP bound GTPase was released from the beads by addition of 1× protein sample buffer, and 5 min of boiling. The released GTPases was then detected by Western blot analysis using an anti-Rap1 antibody and ECL Plus chemiluminescence (Amersham, Piscataway, NJ).
123
2.8. Statistical analyses Experimental differences were tested for statistical significance using ANOVA and Students’ t-test. P value of <0.05 or <0.01 was considered to be significant. 3. Results 3.1. NF-κB was activated by Epac activator Two principal effector proteins for cAMP are protein kinase A (PKA) and cAMP-responsive guanine nucleotide exchange factor (Epac), a Rap GDP exchange factor. Previous reports show that NF-B activation was accomplished by PKA activation and the phosphorylation of p65 subunit [18,19]. Here, we investigated whether NF-B activation can be regulated by Epac1-mediated Rap1 activation. When we treated NF-B-SEAP vector-transfected cells with Epac activator, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT), NF-B was activated, time- and dosedependently (Fig. 1A). It shows that NF-B activation could be regulated by Epac1-mediated Rap1. Based on that LPS stimulated cAMP production [9] and NFB activation [18], we used LPS-stimulation as a positive control for NF-B activation. Our data showed that NF-B was activated
Fig. 1. NF-B activity was increased by the treatment with Epac activator, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT). (A) Raw 264.7 cells were transfected with NF-B-secreted alkaline phosphatase (SEAP) vector. Cells were treated with various concentrations of CPT (12.5, 25, and 50 g/ml) or LPS (5 g/ml). Conditioned media containing SEAP released was sampled at appropriate time point. NF-B activation was measured as SEAP activity with SEAP assay kit, as described in Section 2. SEAP activity in each group was expressed as fold induction of untreated control. Data were the representative of three experiments. (B) Raw 264.7 murine macrophages were transfected with NF-B-SEAP vector. NF-B activation was measured as SEAP activity released with SEAP assay kit, as described in Section 2. Vector indicated the result of pcDNA3.1 vector only-transfected group and control showed the SEAP activity in pNFkB-SEAP-transfected and LPS-untreated group. (C) Raw 264.7 cells were stimulated with lipopolysaccharide (LPS). Intracellular cAMP levels were measured by ELISA, as described in Section 2. cAMP levels increased as a result of LPS stimulation. Data were the representative of three experiments. Data in the bar graph represent the means ± S.E.D. *p < 0.05; **p < 0.01; significant as compared to LPS non-stimulated control.
124
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
Fig. 2. NF-B activation was increased by the treatment with LPS or Epac activator, 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT). NF-B activation was measured by the amount of NF-B binding to probe. Electrophoretic mobility shift assay (EMSA) that was described in Section 2 was performed to detect NF-B binding to probe.
by LPS-stimulation after murine macrophages were transfected with pNF-B-SEAP. NF-B activity by LPS-stimulation was more than twice (Fig. 1B). In addition, LPS-stimulation increased cAMP production in murine macrophages (Fig. 1C). These data are consistent with previous reports in other cells [24,25]. It implicates that NF-B activation could be regulated by cAMP-dependent Epac1-mediated Rap1 activation. NF-B activation by Epac activator was re-affirmed by electrophoretic mobility shift assay (EMSA) (Fig. 2). Data suggest that NF-B activation could be a combined result of cAMP-dependent and cAMP-independent signalings by LPS-stimulation. 3.2. Epac1-mediated Rap1 was activated by LPS-stimulation in murine macrophages To confirm the Epac-mediated Rap1 activation in murine macrophages, we examined whether murine macrophages expressed Epac1 gene and whether Epac1-mediated Rap1 was activated by the treatment with LPS or Epac activator. We detected Epac1 expression in Raw 264.7 murine macrophages (Fig. 3A). As shown in (B), Epac1-mediated Rap1 activity was increased by the treatment with Epac activator, CPT. LPSstimulation also increased Rap1 activity (C). It suggests that LPS-stimulated NF-B activation could be affected by Epac1mediated Rap1 activity. 3.3. NF-κB activation was attenuated by dominant negative Rap1 To confirm that NF-B could be activated by Epac1-mediated Rap1 activation in murine macrophages, NF-B-SEAP vector was co-transfected into macrophages with dominant negative Rap1N17. When macrophages were treated with Epac activa-
Fig. 3. Epac1 expression and Epac1-mediated Rap1 activation due to LPSstimulation were detected in the Raw 264.7 cells. (A) Total RNA was isolated with TRIZOL. Epac transcripts measured by RT-PCR were detected in the Raw 264.7 murine macrophages. Open triangle represents the increase of cDNA (0.5, 1 and 2 l) used for PCR. (B) When cells were treated with Epac1-specific activator 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT), Epac1-mediated Rap1 activation was detected in the Raw 264.7 murine macrophages. (C) When cells were stimulated with LPS Epac1-mediated Rap1 activity was increased in a dose-dependent manner. Data were the representative of five experiments.
tor, CPT, Rap1-mediated NF-B activation was inhibited by dominant negative Rap1N17 (Fig. 4). In this case, dominant negative p300 co-activator (p300DN) was used as a positive control. Data demonstrate that Epac1-mediated Rap1 activation could be another pathway to stimulate NF-B activation. 4. Discussion Ten members of the TLR family have been identified and shown to be involved in innate immunity and inflammation responses [1,2]. Among them, TLR4 agonist, LPS-stimulation produces cAMP [9] and results in nuclear factor-kappa B (NFB) activation [2,3]. There have been conflicting evidences regarding the action of cAMP/cAMP-dependent protein kinase (PKA) signaling pathway on NF-B [17–19]. However, little is known about the other cAMP-mediated signaling pathway, Epac-mediated Rap1 activation on NF-B activation. Our results show that transcriptional activity of NF-B could be elevated by Epac1-mediated Rap1 pathway in murine macrophages. Data implicate that NF-B could be regulated by cAMP-dependent pathway at least in macrophage-mediated inflammation. Some explanations are possible on inter-relationship between cAMP-dependent or -independent NF-B activation. LPS stimulated cAMP production and cAMP activates Epac1-mediated Rap1, which results in NF-B activation. In the meanwhile, PKA activated by LPS-stimulation could lead to cAMP-independent NF-B activation [18,19]. Therefore, LPS-stimulated NF-
E.-Y. Moon, S. Pyo / Immunology Letters 110 (2007) 121–125
125
Fig. 4. NF-B activity was decreased by the co-transfection with dominant negative Rap1 (Rap1N17) or p300 (p300DN). (A) Raw 264.7 murine macrophages were transfected with NF-B-SEAP vector and Rap1N17 or p300DN. Cells were stimulated with 8-(4-chloro-phenylthio)-2 -O-methyladenosine-3 ,5 -cyclic monophosphate (CPT) and NF-B activation was measured as SEAP activity released with SEAP assay kit, as described in Section 2. At each time point, CPT-stimulated NF-B activation was expressed as fold induction of SEAP activity as compared to CPT-untreated control. Data were the representative of three experiments. (B) Data in the bar graph represent the means ± S.E.D. in 18-h incubation with CPT. *p < 0.05; **p < 0.01; significant as compared to CPT-stimulated control.
B could be cooperatively activated by cAMP-dependent Epac1-mediated Rap1 activation and cAMP-independent PKA activation. However, it is not cleared yet whether one of two pathways is activated first in relation to cAMP production or two pathways are activated at the same time. Even though no evidences are reported until now, it is possible for two pathways to be regulated by each other. It remains to be cleared the inter-relationship of PKA-mediated pathways and Epacmediated pathways on NF-B activation. In conclusion, Epac1-mediated Rap1 pathway is involved in LPS-stimulated NF-B activation in macrophages. NF-B activation may be a result from the total addition of various signaling pathways involving cAMP-independent PKA activation [18,19] and cAMP-dependent Epac1-mediated Rap1 activation. Epac1-mediated Rap1 could play a role in inflammation and a consecutive cancer development through cAMP-dependent NF-B activation. Therefore, it suggests that Epac1-mediated Rap1/NF-B pathway could provide a helpful interpretation on various cAMP-mediated physiological responses and it could be a therapeutic target to develop an inhibitor to control TLR4mediated abnormalities.
References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]
Acknowledgments We thank Dr. Johannes L. Bos, Department of Physiological Chemistry, University Medical Center Utrecht (UMCU) of the Netherlands for providing RalGDS-RBD-GST plasmid. This work was supported by grants from the Molecular and Cellular BioDiscovery Research Program, Ministry of Science and Technology, Korea and National Cancer Control Program, Ministry of Health and Welfare, Korea. This work was also supported by the faculty research fund of Sejong University in 2006.
[19] [20] [21] [22] [23] [24] [25]
Akira S, Takeda K. Nat Rev Immunol 2004;4:499–511. Takeda K, Akira S. Semin Immunol 2004;16:3–9. Akira S, Takeda K, Kaisho T. Nat Immunol 2001;2:675–80. Bonizzi G, Karin M. Trends Immunol 2004;25:280–8. Finco TS, Baldwin AS. Immunity 1995;3:263–72. Shishodia S, Aggarwal BB. Biochem Pharmacol 2004;68:1071–80. Huang TT, Kudo N, Yoshida M, Miyamoto S. Proc Natl Acad Sci USA 2000;97:1014–9. Caggiano AO, Kraig RP. J Neurochem 1999;72:565–75. Moon EY, Oh SY, Han GH, Lee CS, Park SK. J Neurosci Res 2005;81:38–44. Nakamura Y, Si QS, Kataoka K. Neurosci Res 1999;35:95–100. Bos JL. Nat Rev Mol Cell Biol 2003;4:733–8. de Rooij J, Rehmann H, van Triest M, Cool RH, Wittinghofer A, Bos JL. J Biol Chem 2000;275:20829–36. de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A, et al. Nature 1998;396:474–7. Guo W, Giancotti FG. Nat Rev Mol Cell Biol 2004;5:816–26. Karin M. Nature 2006;441:431–6. Enserink JM, Christensen AE, de Rooij J, van Triest M, Schwede F, Genieser HG, et al. Nat Cell Biol 2002;4:901–6. Takahashi N, Tetsuka T, Uranishi H, Okamoto T. Eur J Biochem 2002;269:4559–65. Zhong H, SuYang H, Erdjument-Bromage H, Tempst P, Ghosh S. Cell 1997;89:413–24. Zhong H, Voll RE, Ghosh S. Mol Cell 1998;1:661–71. Condeelis J, Pollard JW. Cell 2006;124:263–6. Jeon YJ, Kim YK, Lee M, Park SM, Han SB, Kim HM. J Pharmacol Exp Ther 2000;294:548–54. Pierce JW, Lenardo M, Baltimore D. Proc Natl Acad Sci USA 1988;85:1482–6. Ren XD, Kiosses WB, Schwartz MA. EMBO J 1999;18:578–85. Asehnoune K, Strassheim D, Mitra S, Kim JY, Abraham E. J Immunol 2004;172:2522–9. Sanlioglu S, Williams CM, Samavati L, Butler NS, Wang G, McCray Jr PB, et al. J Biol Chem 2001;276:30188–98.