- Email: [email protected]
Lipoxin A4 regulates expression of the estrogen receptor and inhibits 17β-estradiol induced p38 mitogen-activated protein kinase phosphorylation in human endometriotic stromal cells
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
Lipoxin A4 regulates expression of the estrogen receptor and inhibits 17b-estradiol induced p38 mitogen-activated protein kinase phosphorylation in human endometriotic stromal cells Shuo Chen, M.D.,a Rong-Feng Wu, Ph.D.,b Lin Su, M.D.,a Wei-Dong Zhou, Ph.D.,a Mao-Bi Zhu, M.D.,a and Qiong-Hua Chen, Ph.D.a a First Affiliated Hospital of Xiamen University, and b State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, People's Republic of China
Objective: To study the role of lipoxin A4 (LXA4) in endometriosis. Design: Molecular analysis in human samples and primary human endometriotic stromal cells (ESCs). Setting: University hospital. Patient(s): Forty-nine premenopausal women (30 patients with endometriosis and 19 controls). Intervention(s): Normal and ectopic endometrial biopsies obtained during surgery performed during the proliferative phase of the menstrual cycle; ESCs used for in vitro studies. Main Outcome Measure(s): Levels of LXA4 measured by enzyme-linked immunosorbent assay (ELISA); mRNA levels of the estrogen receptor (ER), progestogen receptor (PR), tumor necrosis factor a (TNF-a), and interleukin 6 (IL-6) quantified by quantitative reversetranscription polymerase chain reaction (qRT-PCR); and p38 mitogen-activated protein kinase (p38 MAPK) phosphorylation evaluated by Western blotting. Result(s): The LXA4 expression level decreased in ectopic tissue as well as ERa and PR, although the expression of ERb increased in ectopic endometrium compared with the controls. Investigations with correlation analysis revealed the expression of LXA4 was positively correlated with ERa and negatively correlated with ERb in vivo. Moreover, administering LXA4 could augment ERb expression in ESCs and inhibit the 17b-estradiol-induced phosphorylation of p38 MAPK very likely through ERb. Conclusion(s): Our findings indicate that LXA4 regulates ERb expression and inhibits 17bUse your smartphone estradiol-induced phosphorylation of p38 MAPK, very likely through ERb in ESCs. (Fertil SterilÒ to scan this QR code 2014;-:-–-. Ó2014 by American Society for Reproductive Medicine.) and connect to the Key Words: Endometriosis, estrogen receptor, LXA4, p38 MAPK Discuss: You can discuss this article with its authors and with other ASRM members at http:// fertstertforum.com/shuoc-lipoxin-a4-estrogen-receptor-17%CE%B2-estrodiol-p38mapk-hescs/
Received October 16, 2013; revised February 26, 2014; accepted March 14, 2014. S.C. has nothing to disclose. R.-F.W. has nothing to disclose. L.S. has nothing to disclose. W.-D.Z. has nothing to disclose. M.-B.Z. has nothing to disclose. Q.-H.C. has nothing to disclose. Supported by grant 3502 Z 20134002 of the Science and Technology Planning Project of Xiamen City, People's Republic of China and Grant 2013D001 of the Natural Science Foundation of Fujian Province. Reprint requests: Qiong-Hua Chen, Ph.D., Zhenhai Road, No. 55, Siming District, Xiamen, Fujian, People's Republic of China (E-mail: [email protected]). Fertility and Sterility® Vol. -, No. -, - 2014 0015-0282/$36.00 Copyright ©2014 American Society for Reproductive Medicine, Published by Elsevier Inc. http://dx.doi.org/10.1016/j.fertnstert.2014.03.029 VOL. - NO. - / - 2014
discussion forum for this article now.*
* Download a free QR code scanner by searching for “QR scanner” in your smartphone’s app store or app marketplace.
E
ndometriosis, one of the most common gynecologic diseases in women of reproductive age, has been widely treated as an estrogen-dependent and inflammatory disease (1, 2), but its etiology and pathogenesis remain elusive. The most widely accepted hypothesis was proposed by Sampson, that viable endometrial tissue escapes into the 1
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY peritoneal cavity during menstruation, which is presumably coupled with immune defects in pelvic cavity (3). We previously demonstrated the change pattern of cytokines over time in an endometriotic mouse model (4, 5), showing the alterations in immune response. The inflammatory environment plays a critical role in the pathogenesis of this disorder by inducing the growth, adhesion, invasiveness, and angiogenesis of endometrial fragments outside the uterus. After endometriotic lesions successfully implanted in peritoneal cavity, high levels of estrogen could be produced locally in ectopic endometrium. In addition, estrogen is thought to be an immunomodulating agent (6). Therefore, the relationship between enhanced inflammation and augmented estrogen formation may represent an important step for the development of endometriosis. Lipoxins, metabolites of arachidonic acid, have been widely known as endogenous ‘‘breaking signals’’ in inflammation, which can prevent the recruitment of polymorphonuclear neutrophils (PMNs) at sites of inflammation and promote mononuclear cells to clean up tissue debris. Other functions of lipoxins can be described as antiangiogenesis, antiproliferation and resistance to invasion. Lipoxins are known to play a role in endometrium (7), and their specific receptor (lipoxin A4 receptor, ALXR) can be partly regulated by progesterone during the estrus cycle under physiologic conditions (8). In addition, a higher level of ALXR in endometriotic tissue is seen compared with normal endometrium (8). The inhibitive effects of lipoxin A4 (LXA4) on the endometriosis mouse model were also revealed by our previous research (9, 10), which renders its role in pathogenesis of endometriosis of great interest. The p38 mitogen-activated protein kinase (p38 MAPK) intracellular signal-transducing molecule has been proved to play an important role in inflammatory response. It regulates various kinds of proinflammatory agents such as tumor-necrosis factor a (TNF-a), interleukin-1b (IL-1b), IL-6, IL-8, matrix metalloproteinase 2 (MMP-2), and MMP-9. Recently, researchers showed that the activation of p38 MAPK is involved in the pathophysiologic process of endometriosis (11). Studies by our group and others (12, 13) have shown that the inhibitor of p38 MAPK significantly represses the development of endometriosis. In another study (14), the phosphorylation of p38 MAPK induced by 17b-estradiol (E2) in endometrial stromal cells was prohibited by the estrogen receptor (ER) inhibitor (ICI 182780). It is interesting that LXA4 was recently described as a novel estrogen modulator in Ishikawa cells (15). Therefore, we propose that LXA4 inhibits E2-induced activation of p38 MAPK and is likely involved with ER as well. Although there have been several studies on the therapeutic effects of lipoxins on endometriosis, its mechanism remains elusive. These findings led us to the hypothesis that LXA4 might simultaneously regulate estrogen signaling and inflammatory response to prevent the development and progression of endometriosis. We also examined the question of whether an immunoendocrine crosstalk link in endometriosis could be established by LXA4. 2
MATERIALS AND METHODS Reagents and Antibodies The stock solutions of E2 (Merck KgaA) and ICI 182780 (Fulvestrant; Sigma-Aldrich) were prepared in dimethyl sulfoxide (DMSO). Lipoxin A4 (Neogen Corporation) and diarylprepionitrile (DPN; Sigma-Aldrich) were prepared in ethanol. Dulbecco's modified Eagle's medium/Ham's F-12 medium (DMEM/F-12), antibiotics (mixture of penicillin and streptomycin), 0.25% trypsin, and fetal bovine serum (FBS) were bought from Hyclone. Type IV collagenase and deoxyribonuclease I were both acquired from Bio Basic. The SYBR PrimeScript RT-PCR Kit was purchased from Takara Biotechnology. Mouse monoclonal anti-human estrogen receptor a (ERa) (sc8002), rabbit polyclonal anti-human phosphorylated p38 MAPK (p-p38 MAPK, sc-7975-R), and p38 MAPK (sc-7149) were obtained from Santa Cruz Biotechnology. Rabbit polyclonal anti-human ERb antibody was obtained from Epitomics (S2015). Rabbit polyclonal anti-human progestogen receptor (PR) antibody was purchased from Cell Signaling (D8Q2J). Mouse monoclonal anti-human b-actin antibody was obtained from Anbo Biotechnology (#E0012). The secondary antibodies used were goat polyclonal anti-mouse IgG antibody (A00160, Genscript) and goat polyclonal antirabbit IgG antibody (A00098; Genscript).
Patients and Sample Collection Forty-nine women (between 20 and 49 years old) were examined for pelvic pain, dysmenorrhea, or infertility in the Department of Gynecology and Obstetrics at the First Affiliated Hospital of Xiamen University in Xiamen, People's Republic of China. Among these patients, the absence of endometriosis was laparoscopically confirmed in 19 (normal group, mean age 34 years old, range: 24–49 years), and endometriosis was both laparoscopically and histologically confirmed in 30 (EM group, mean age 35.5 years old, range: 20–47 years). The use of these tissues was approved by the ethics committee of the First Affiliated Hospital of Xiamen University, and informed consent was obtained from each patient. None of these patients had received hormone treatment for at least 3 months before the surgery. All patients were of reproductive age with normal menstrual cycles. For the primary cell culture, the collected endometriotic tissue was immediately transported to the laboratory in DMEM/F-12 on ice under sterile conditions.
Isolation and Culture of Human Endometriotic Stromal Cells Primary endometriotic stromal cell (ESC) culture was based on a previously published protocol with minor modifications (16). Briefly, endometriotic tissue was rinsed with phosphatebuffered saline (PBS), minced into small pieces, and incubated in DMEM/F-12 with type IV collagenase (2 mg/mL) and deoxyribonuclease I (15 U/mL) in a shaking water bath for 1.5 to 2.0 hours at 37 C. The cell suspensions were filtered through nylon cell strainers with 140-mm apertures, and then with 37mm apertures. The endometrial epithelial glands that remained intact were retained by the strainer, and the dispersed stromal VOL. - NO. - / - 2014
Fertility and Sterility® cells passed through the strainer into the filtrate. The remaining ESCs in the filtrate were centrifuged at 800 g for 10 minutes, washed with DMEM/F-12, resuspended in complete medium (DMEM/F-12 supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin, and 15% FBS), and plated onto 60mm dishes. The cells were allowed to adhere selectively to culture dishes for 30 minutes at 37 C in 5% CO2 in air, after which nonadhering epithelial cells and blood cells were removed with PBS rinses. Isolated ESCs were cultured in complete medium at 37 C with 5% CO2. The cells were used for experiments upon reaching confluent state after about 3 to 4 days. The purification of the stromal cells were determined by immunocytochemical staining with mouse anti-human vimentin 9 (stromal cells) and cytokeratin 19 (epithelial cells) antibodies. The ESCs in monolayer culture after the second passage were more than 96% purity, judged by the positive cellular staining for vimentin 9 and the negative cellular staining for cytokeratin 19 (data not shown). These ESCs were used between passages 2 and 6.
Enzyme-linked Immunosorbent Assay Lipoxin A4 level in the supernatant of tissue lysate samples of endometriosis and control patients was measured using an enzyme-linked immunosorbent assay (ELISA) kit (Neogen Corporation) according to the manufacturer's instructions. The tissue samples (control: n ¼ 10; endometriosis: n ¼ 19) were homogenized in PBS (0.4 mL) by TissueLyser at 2,000 rpm for 3 minutes. After centrifugation, the supernatant was assessed by ELISA kits. Standard curve and negative controls were also included in each experiment. The intraassay and interassay coefficients of variation were less than 5% in these assays.
RNA Isolation and Quantitative Real-time Reversetranscription Polymerase Chain Reaction Total RNA was extracted from tissue samples or ESCs with RNAiso Plus (TaKaRa) and stored at 80 C for further use. The cDNA was synthesized with PrimeScript RT reagent kit from total RNA. The polymerase chain reaction (PCR) reaction was performed using the SYBR Premix Ex Taq II (TaKaRa) in Lightcycler 480 (Roche). The results were normalized based on GAPDH expression, and the 2DCT and 2DDCT method was used to calculate the relative mRNA level in tissue and cells, respectively (17). The primer sequences were as follows (50 –30 ): ERa, forward CCACCAACCAGTGCACCATT and reverse GGTCTTTTCGTATCCCACCTTTC; ERb, forward AGAG TCCCTGGTGTGAAGCAAG and reverse GACAGCGCAGAA GTGAGCATC; PR, forward CTAAATGAACAGCGGATGAA AG and reverse GGAACTCTTCTTGGCTAACTTG; GAPDH, forward GGAAGGTGAAGGTCGGAGTCA and reverse GAGT CCTTCCACGATACCAA; TNF-a, forward AAGCCTGTAGCC CACGTCGTA and reverse GGCACCACTAGTTGGTTGTCTTTG; IL-6, GACAGCCACTCACCTCTTCA and reverse AGTGCCTC TTTGCTGCTTTC.
sions and control endometrium. Biopsy samples were fixed in 4% formaldehyde, embedded in paraffin, and cut into 5mm sections for immunohistochemical analysis. All immunohistochemical stainings were performed with the UltraSensitive S-P (MaixinBio). To prevent the histotomy from falling off, the slides were preheated at 60 C for 90 minutes. Then the antigen was treated under high pressure for 2 minutes, and endogenous peroxidase activity was eliminated by endogenous peroxidase blockers (MaixinBio) at room temperature. Nonspecific bindings were blocked with nonimmune animal serum (MaixinBio). The slides were incubated with the primary antibody, ERa (1:200 dilution), ERb (1:500 dilution), PR (1:1,000 dilution), p-p38 MAPK (1:1,000 dilution), and p38 MAPK (1:1,000 dilution) overnight at 4 C. Then a biotinylated secondary anti-rabbit antibody (MaixinBio) was used, and sections were incubated with streptomycete avidin-peroxidase complex (MaixinBio) for 10 minutes at room temperature. After that, DAB (MaixinBio) was used as a substrate, and sections were lightly counterstained with hematoxylin solution (MaixinBio), dehydrated, and mounted. Negative controls without the primary antibody were also included in the experiments (data not shown). Stainings were observed under an inverted microscope (Olympus IX71), and images were captured with image-Pro Express 4.0 (Media Cybernetics).
Western Blot Analysis Whole-cell lysates (30–40 mg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE), and the proteins were transferred to polyvinylidene difluoride (PVDF) membranes by electroblotting. Nonspecific binding was blocked by incubating the membranes in 5% nonfat milk in PBST (0.1% Tween-20) for 1 hour at room temperature. Membranes were subsequently incubated overnight at 4 C with primary antibodies. The antibodies used in Western blotting were ERa (1:500), ERb (1:1,000), PR (1:1,000), p38 MAPK (1:1,000), p-p38MAPK (1:1,000), and b-actin (1:5,000). Then the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody (1:10,000; Genscript) for 1 hour at room temperature and visualized using enhanced chemiluminescence (Lulong Biotech).
Statistical Analysis All experiments were repeated at least three times. All data sets were presented as mean standard error of the man (SEM). Comparisons between groups were performed using a Student's t test or one-way analysis of variance (ANOVA) where appropriate. Linear regression was used to analyze the data in human endometrium. Analysis was performed with Graphpad Prism, version 5.01. P< .05 was considered statistically significant.
RESULTS
Immunohistochemistry
Expression of ER, PR, and LXA4 in Ectopic Endometrial Tissue
The ERa, ERb, PR, p-p38 MAPK and p38 MAPK immunohistochemical stainings were performed on endometriotic le-
As shown in Figure 1A, the expression of LXA4 was significantly decreased in ectopic endometrial tissue compared
VOL. - NO. - / - 2014
3
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 1
Abnormal expression of LXA4, ER, and PR in patients with endometriosis in comparison with control subjects. (A) Concentrations of LXA4 studied by ELISA. A significant decrease in LXA4 concentration was observed between the endometrium from the controls (n ¼ 10) and endometriosis patients (n ¼ 19). Relative mRNA expression of ERa (B), ERb (C), and PR (D) in the endometrial tissue of the controls (n ¼ 15) and ectopic endometrium of endometriosis patients (n ¼ 24) was quantified by qRT-PCR and normalized to GAPDH. Data represent the mean SEM. *P<.05, ***P<.001 versus normal endometrium. (E) Immunohistochemical of ERa (a, d), ERb (b, e), and PR (c, f) in endometrial tissue of the controls (a, b, c) (n ¼ 6) and in ectopic (d, e, f) (n ¼ 6) endometrium. The negative control is not shown. Insert: original magnification, 40. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
with the control subjects by nearly twofold (45.9 3.7 pg/mL vs. 25.7 1.9 pg/mL). In searching for the effects of LXA4 on ER and PR, we detected the abnormal expression of ER and PR in ectopic tissue. As shown in Figure 1B and D, ERa and PR mRNA expression was decreased by sixfold and eightfold over normal endometrium tissue 0.374 0.109 vs. 0.063 0.010; 0.592 0.231 vs. 0.072 0.015 relative expression units), respectively. In contrast, Figure 1C showed the ERb mRNA level of ectopic endometrium was significantly augmented by 30-fold over the control endometrium (from 0.101 0.026 to 0.003 0.001). Immunohistochemical analyses revealed that expression of ER and PR was consistent with the results of the quantitative real-time PCR (qRT-PCR) 4
(see Fig. 1E). Additionally, ERa and PR were expressed specifically in glandular epithelial cells, and nuclear expression was apparent. Both receptors were significantly decreased in the ectopic endometrial tissue. However, ERb, stained with greater intensity in endometriosis, was mainly expressed in nuclear of stromal cells, and only some light cytoplasmic staining could be seen in glandular epithelial cells.
LXA4 Regulates Expression of ERb in Human ESCs To examine whether LXA4 can regulate the expression of ER and PR, we treated human ESCs with vehicle control, 108 M E2, 107 M LXA4, or cotreated them for 6 hours. As shown in VOL. - NO. - / - 2014
Fertility and Sterility®
FIGURE 2
LXA4 modulates ERb expression in ESCs. The ESCs were incubated with vehicle control, E2, LXA4, or cotreated for 6 hours. (A) Total RNA was extracted, and qRT-PCR performed. Experiments were repeated in ESCs from five different patients. The data represent the mean SEM. (B) Cell lysates were then analyzed for protein levels by Western blot analysis. One representative blot of three different patients is shown. Quantity-One was used for densitometric analysis. Data represent the mean SEM. *P<.05, **P<.01 versus vehicle-treated cells; tP<.05 versus E2-treated cells. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
Figure 2A, ERa mRNA was decreased in LXA4-treated cells compared with E2-treated cells. The ERb mRNA level was elevated in both the LXA4-treated cells and cotreated cells compared with the control group. No statistically significant difference was observed in the expression of PR. Hence, we then examined the protein expression of ER. We confirmed E2 and LXA4 increased the ERb protein levels by 20% and 16%, respectively; the ERb protein level were further increased by 40% in cotreated cells compared with the vehicle-treated cells (see Fig. 2B). However, the ERa protein expression was not significantly altered in the cells stimulated with E2, LXA4, or cotreated, suggesting a selective modulation of ERb expression.
LXA4 Inhibits E2-induced p38 MAPK Phosphorylation Very Likely through ERb in Human ESCs Immunohistochemical analysis revealed that phosphorylated p38 MAPK (Fig. 3A) was expressed in the nuclei, and ESCs were stained with greater intensity compared with the controls. No staining was observed on sections incubated with an isotype-matched negative control antibody. To determine the effects of LXA4 on E2-induced p38 MAPK phosphorylation, we pretreated ESCs with 107 M ICI 182780 for 24 hours. Afterward, the cell cultures were treated with 107 M LXA4 for 30 minutes, then treated with control or E2 (108 M) for 10 minutes. As shown in Figure 3B, E2 induced the phosphorylated protein expression of p38 MAPK, which could be inhibited by ICI 182780, suggesting that E2 activated p38 VOL. - NO. - / - 2014
MAPK phosphorylation via ER (14). And LXA4 significantly attenuated E2-induced p38 MAPK phosphorylation (see Fig. 3B). To provide further support for our proposal that LXA4 can inhibit E2-induced p38 MAPK phosphorylation, we assessed the level of TNF-a and IL-6, which can be stimulated by activated p38 MAPK. We found that LXA4 significantly suppressed TNF-a and IL-6 mRNA expression in cotreated cells compared with E2-treated cells (see Fig. 3C). Considering that LXA4 could induce the expression of ERb, we assume that the suppression of exogenous LXA4 on p38 MAPK phosphorylation was associated with ERb. As shown in Figure 3D, DPN could strongly suppress the phosphorylation of p38 MAPK at 107 M and 108 M in ESCs, which suggests that LXA4 inhibited p38 MAPK phosphorylation very likely through ERb.
Expression of ERa and ERb was in Strong Correlation with the Level of LXA4 in Human Endometrium Given the abnormal expression of LXA4, ER, and PR, we went on to hypothesize that the expression of LXA4 may be correlated with the expression of ER and PR. To test this hypothesis, total RNA from 22 cases of normal or ectopic endometrium was collected. Linear regression analysis showed that the expression of ERa was in strong positive correlation with the expression of LXA4 (Fig. 4A; P< .01) whereas a negative correlation between the expression of LXA4 and ERb was observed (see Fig. 4B; P< .01). The correlation between LXA4 and PR was not statistically significant (see Fig. 4C; 5
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 3
LXA4 inhibits E2-induced phosphorylation of p38 MAPK in ESCs, probably though ERb. (A) Immunohistochemical of phosphorylated p38 MAPK in normal (a) (n ¼ 6) and ectopic (b) (n ¼ 6) endometrium. Negative control for normal endometrium (c) and ectopic endometrial tissue (d). Insert: original magnification, 40. (B) ESCs (n ¼ 5) were pretreated with 107 M ICI 182780 for 24 hours. Afterward, the cell cultures were treated with 107 M LXA4 for 30 minutes, then treated with control or E2 (108 M) for 10 minutes. Cell lysates were subsequently prepared for Western blot analysis. Quantity-One was used for densitometric analysis. (C) ESCs (n ¼ 5) were incubated with vehicle control, E2, LXA4, or cotreated for 6 hours. We used qRT-PCR to detect the mRNA expression of TNF-a and IL-6. (D) ESCs (n ¼ 4) were incubated with vehicle or DPN at the indicated concentration for 24 hours. Cell lysates were subsequently prepared for Western blot analysis. Quantity-One was used for densitometric analysis. Data represent the mean SEM. *P<.05 versus vehicle-treated cells; tP<.05 versus E2-treated cells. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
P>.05). These results further supported our hypothesis that the expressions of ERa and ERb were positively regulated by LXA4 in vivo.
DISCUSSION To the best of our knowledge, ours is the first report on the effects of LXA4 on human ESCs. In the present study, LXA4 modulated expression of ERb, inhibited E2-induced phosphorylation of p38 MAPK, and down-regulated expression of proinflammatory-associated genes (TNF-a and IL-6) in human ESCs. Our analysis focused on the effects of LXA4, an antiinflammatory endogenously produced eicosanoids, which has been suggested to be a novel candidate as a therapeutic target or agent for endometriosis. Scanty studies about the role of LXA4 are reported in endometriosis. 6
The expression of lipoxygenase enzymes (LOXs) and ALXR have been previously found in endometrium (15, 18, 19). As an endogenous arachidonic acid metabolite, LXA4 could rapidly produce and act locally to promote resolution of inflammation (20, 21). During the menstrual cycle, AXLR mRNA expression is changed (8, 19), which demonstrates that LXA4 can regulate inflammatory events in the human endometrium. The multiple functions of LXA4 with regard to the pathophysiologic progress of endometriosis have been described in the literature, such as antiangiogenesis, antiproliferation, and sex steroid modulation (15, 22). By using the endometriotic mouse model, we found that LXA4 could inhibit the growth of endometriotic lesions in part by lowering the concentration of peritoneal proinflammatory cytokines (9, 10). Additionally, as attenuated production of LXA4 can lead to a defect in the resolution of inflammation, VOL. - NO. - / - 2014
Fertility and Sterility®
FIGURE 4
The expression of LXA4 was positively correlated with the expression of ERa and negatively correlated with ERb in human endometrium. Twentytwo cases of normal or ectopic tissues were analyzed for their mRNA expression of ERa, ERb, and PR by qRT-PCR analysis, and LXA4 expression levels through ELISA. Circles represent individual patients. The correlations were analyzed by linear regression. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
which directly contributes to many chronic disease states (23– 25), the decreased LXA4 level in the ectopic endometrium observed in our experiments very likely involves in endometriosis. The most potent estrogen produced in the body is E2, and estrogen signaling is largely mediated by ERa and ERb, stimulating the proliferation of ectopic tissue and regulating inflammatory responses. In this study, we described the overexpression of ERb and lower levels of ERa and PR in endometriosis, which is consistent with other research (26, 27). Furthermore, our correlation analysis first revealed that the expression of ERa and ERb was significantly correlated with the LXA4 level in human endometrium. However, in vitro experiments showed that exogenous LXA4 augmented ERb expression in human ESCs, which seems to be contradictory to the data on tissues. The reason is probably due to the in vivo cellular context. It is known that E2 down-regulates 15-LOX as well as LXA4 formation in the cornea (28). In addition, E2 could also regulate the expression of ERb (29, 30). Therefore, the low level of LXA4 and abnormal expression of ER in endometriosis tissue are very much likely associated with the high level of E2. It seems that the overall response in vivo is mainly decided by E2. But LXA4 demonstrated antiestrogenic potential, significantly attenuating E2-induced activity (15). Therefore, the different relative concentrations of LXA4 and E2 may result in different outcomes between in vivo and in vitro conditions. These may account for the discrepancy between in vivo and in vitro data. Moreover, another study has shown that the human ERa gene is regulated by ERb via a different promoter in endometrial cells and endometriotic cells, which may be due to the extremely high ERb levels in endometriosis (31). In addition, ERb is a repressor of ERa transcriptional activity (32), which may prevent E2 from exerting its biologic function through ERa. Investigators have found that an ERb-selective agonist might have utility as novel anti-inflammatory agent (33) and cause lesion regression in endometriosis mouse model (34, 35). In a word, activation of ERb could attenuate estrogen signaling and inhibit inflammatory responses at the same time, which is beneficial for endometriosis. Therefore, we considered the VOL. - NO. - / - 2014
possibility that exogenous LXA4 could inhibit endometriosis partly through ERb. Numerous pathophysiologic processes implicated in endometriosis are regulated by p38 MAPK, notably the induction of aberrant inflammatory cytokines and cyclooxygenase-2 (COX-2) expression (12, 36, 37), which can induce the production of E2 and promote the development of endometriosis. Our data show that E2 can activate p38 MAPK through ER, which also has been supported by another study (14). Excessive estrogen in endometriotic tissue leads to the phosphorylation of p38 MAPK; consequently, a positive feedback loop between estrogen and p38 MAPK is established. Here, we report p38 MAPK phosphorylation is augmented in human endometriotic lesions (11), and LXA4 can inhibit E2-induced phosphorylation of p38 MAPK most likely through ER, resulting in a decreased level of TNF-a and IL-6 (see Fig. 3). Phosphorylated p38 MAPK can increase the formation of these two cytokines, and they have been illustrated in various research studies as having important roles in the establishment and maintenance of this disease (3, 38). Our previous study and other investigators have also shown that specific p38 MAPK inhibitor could inhibit the development of endometriosis (12, 13). Therefore, the inhibition of LXA4 on endometriosis is concerned with p38 MAPK. The effects of LXA4 on ERb and p38 MAPK prompt us to consider that LXA4 prohibits the phosphorylation of p38 MAPK partly through ERb, which is supported by the inhibition of DPN on p38 MAPK phosphorylation (see Fig. 3D). Additional research must be performed to better define the role of ERa and ERb in LXA4-elicited effects, but our experimental results could shed some light on the directions of future studies on the precise molecular mechanism of LXA4 in the pathology of endometriosis. The existing major treatment for endometriosis is surgery and pharmacologic treatment as an auxiliary measure, including gonadotropin-releasing hormone (GnRH), oral contraceptives, and progestins. Surgery is effective but invasive, and pharmacologic treatments have a poor curative effect, high recurrence rate, and side effects such as effects on menstrual cycle. In contrast, LXA4 treatment does not interfere 7
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY with the estrous cycle (9), which presents an obvious advantage over traditional steroid drugs. Considering the regulation on inflammatory and estrogen, we believe that the application of lipoxins in the treatment of this chronic disorder has broad prospects. In summary, LXA4 regulates expression of ERb and inhibits the development of endometriosis by suppressing p38 MAPK phosphorylation, very likely through ERb.
REFERENCES 1. 2. 3. 4.
5.
6. 7. 8.
9.
10.
11.
12.
13.
14.
15. 16.
17. 18.
8
Rizner TL. Estrogen metabolism and action in endometriosis. Mol Cell Endocrinol 2009;307:8–18. Warren PD, Nothnick B. Treating endometriosis as an autoimmune disease. Fertil Steril 2001;76:223–31. Giudice LC, Kao LC. Endometriosis. Lancet 2004;364:1789–99. Chen QH, Zhou WD, Su ZY, Huang QS, Jiang JN, Chen QX. Change of proinflammatory cytokines follows certain patterns after induction of endometriosis in a mouse model. Fertil Steril 2010;93:1448–54. Chen Q, Qiu N, Pu D, Zhou Y, Li T, Yang H. Change profiles in matrix metalloproteinase-2 and -9 in induced endometriosis in mice. J Huazhong Univ Sci Technolog Med Sci 2010;30:188–92. Straub RH. The complex role of estrogens in inflammation. Endocr Rev 2007; 28:521–74. Canny GO, Lessey BA. The role of lipoxin A4 in endometrial biology and endometriosis. Mucosal Immunol 2013;6:439–50. Motohashi E, Kawauchi H, Endo H, Kondo H, Kitasato H, Kuramoto H, et al. Regulatory expression of lipoxin A4 receptor in physiologically estrus cycle and pathologically endometriosis. Biomed Pharmacother 2005;59:330–8. Chen QH, Zhou WD, Pu DM, Huang QS, Li T, Chen QX. 15-Epi-lipoxin A4 inhibits the progression of endometriosis in a murine model. Fertil Steril 2010;93:1440–7. Chen Q, Zhou W, Pu D, Li Z, Huang Q, Chen Q. The inhibitory effect of 15-RLXA4 on experimental endometriosis. Eur J Obstet Gynecol Reprod Biol 2009;145:200–4. Kayisli UA, Cakmak H, Seval Y, Donmez BO, Arici A. In vivo regulation of p38 MAPK activation in human endometrium and endometriosis. Fertil Steril 2005;84:S441. Zhou WD, Yang HM, Wang Q, Su DY, Liu FA, Zhao M, et al. SB203580, a p38 mitogen-activated protein kinase inhibitor, suppresses the development of endometriosis by down-regulating proinflammatory cytokines and proteolytic factors in a mouse model. Hum Reprod 2010;25:3110–6. Yoshino O, Osuga Y, Koga K, Hirota Y, Hirata T, Ruimeng X, et al. FR 167653, a p38 mitogen-activated protein kinase inhibitor, suppresses the development of endometriosis in a murine model. J Reprod Immunol 2006;72:85–93. Seval Y, Cakmak H, Kayisli UA, Arici A. Estrogen-mediated regulation of p38 mitogen-activated protein kinase in human endometrium. J Clin Endocrinol Metab 2006;91:2349–57. Russell R, Gori I, Pellegrini C, Kumar R, Achtari C, Canny GO. Lipoxin A4 is a novel estrogen receptor modulator. FASEB J 2011;25:4326–37. Delbandi AA, Mahmoudi M, Shervin A, Akbari E, Jeddi-Tehrani M, Sankian M, et al. Eutopic and ectopic stromal cells from patients with endometriosis exhibit differential invasive, adhesive, and proliferative behavior. Fertil Steril 2013;100:761–9. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 2008;3:1101–8. Lousse JC, Defrere S, Colette S, Van Langendonckt A, Donnez J. Expression of eicosanoid biosynthetic and catabolic enzymes in peritoneal endometriosis. Hum Reprod 2010;25:734–41.
19.
20.
21. 22.
23.
24. 25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Macdonald LJ, Boddy SC, Denison FC, Sales KJ, Jabbour HN. A role for lipoxin A4 as an anti-inflammatory mediator in the human endometrium. Reproduction 2011;142:345–52. Chiang N, Serhan CN, Dahlen SE, Drazen JM, Hay DW, Rovati GE, et al. The lipoxin receptor ALX: potent ligand-specific and stereoselective actions in vivo. Pharmacol Rev 2006;58:463–87. Maderna P, Godson C. Lipoxins: resolutionary road. Br J Pharmacol 2009; 158:947–59. Xu Z, Zhao F, Lin F, Chen J, Huang Y. Lipoxin A4 inhibits the development of endometriosis in mice: the role of anti-inflammation and anti-angiogenesis. Am J Reprod Immunol 2012;67:491–7. Celik GE, Erkekol FO, Misirligil Z, Melli M. Lipoxin A4 levels in asthma: relation with disease severity and aspirin sensitivity. Clin Exp Allergy 2007;37: 1494–501. O’Meara YM, Brady HR. Lipoxins, leukocyte recruitment and the resolution phase of acute glomerulonephritis. Kidney Int Suppl 1997;58:S56–61. Merched AJ, Ko K, Gotlinger KH, Serhan CN, Chan L. Atherosclerosis: evidence for impairment of resolution of vascular inflammation governed by specific lipid mediators. FASEB J 2008;22:3595–606. Smuc T, Pucelj MR, Sinkovec J, Husen B, Thole H, Lanisnik Rizner T. Expression analysis of the genes involved in estradiol and progesterone action in human ovarian endometriosis. Gynecol Endocrinol 2007;23: 105–11. Xue Q, Lin Z, Cheng YH, Huang CC, Marsh E, Yin P, et al. Promoter methylation regulates estrogen receptor 2 in human endometrium and endometriosis. Biol Reprod 2007;77:681–7. Wang SB. Estrogen regulation of the 15-LOX/LXA4 protective lipid circuit in the corneal inflammatory-reparative response [dissertation]. Berkeley: Univ. of California; 2013. Khurana SR, Ben-Jonathan N. Exposure of newborn male and female rats to environmental estrogens: delayed and sustained hyperprolactinemia and alterations in estrogen receptor expression. Endocrinology 2000; 141:4512–7. Vladusic AE, Guerra-Vladusic FK, Lakins J, Lupu R. Expression and regulation of estrogen receptor beta in human breast tumors and cell lines. Oncol Rep 2000;7:157–224. Trukhacheva E, Lin Z, Reierstad S, Cheng YH, Milad M, Bulun SE. Estrogen receptor (ER) regulates ER expression in stromal cells derived from ovarian endometriosis. J Clin Endocrinol Metab 2009;94:615–22. Hall JM, McDonnell DP. The estrogen receptor beta-isoform (ERb) of the human estrogen receptor modulates ERa transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 1999;140:5566–78. Harris HA. The unexpected science of estrogen receptor-beta selective agonists: a new class of anti-inflammatory agents? Nucl Recept Signal 2006; 4:1–4. Cvoro A, Tatomer D, Tee MK, Zogovic T, Harris HA, Leitman DC. Selective estrogen receptor-beta agonists repress transcription of proinflammatory genes. J Immunol 2008;180:630–6. Harris HA, Bruner-Tran KL, Zhang X, Osteen KG, Lyttle CR. A selective estrogen receptor-beta agonist causes lesion regression in an experimentally induced model of endometriosis. Hum Reprod 2005;20:936–41. Yoshino O, Osuga Y, Hirota Y, Koga K, Hirata T, Harada M, et al. Possible pathophysiological roles of mitogen-activated protein kinases (MAPKs) in endometriosis. Am J Reprod Immunol 2004;52:306–11. Wu MH, Wang CA, Lin CC, Chen LC, Chang WC, Tsai SJ. Distinct regulation of cyclooxygenase-2 by interleukin-1b in normal and endometriotic stromal cells. J Clin Endocrinol Metab 2005;90:286–95. Gori I, Pellegrini C, Staedler D, Russell R, Jan C, Canny GO. Tumor necrosis factor-a activates estrogen signaling pathways in endometrial epithelial cells via estrogen receptor a. Mol Cell Endocrinol 2011;345:27–37.
VOL. - NO. - / - 2014
Lipoxin A4 regulates expression of the estrogen receptor and inhibits 17b-estradiol induced p38 mitogen-activated protein kinase phosphorylation in human endometriotic stromal cells Shuo Chen, M.D.,a Rong-Feng Wu, Ph.D.,b Lin Su, M.D.,a Wei-Dong Zhou, Ph.D.,a Mao-Bi Zhu, M.D.,a and Qiong-Hua Chen, Ph.D.a a First Affiliated Hospital of Xiamen University, and b State Key Laboratory of Cellular Stress Biology, School of Life Sciences, Xiamen University, Xiamen, People's Republic of China
Objective: To study the role of lipoxin A4 (LXA4) in endometriosis. Design: Molecular analysis in human samples and primary human endometriotic stromal cells (ESCs). Setting: University hospital. Patient(s): Forty-nine premenopausal women (30 patients with endometriosis and 19 controls). Intervention(s): Normal and ectopic endometrial biopsies obtained during surgery performed during the proliferative phase of the menstrual cycle; ESCs used for in vitro studies. Main Outcome Measure(s): Levels of LXA4 measured by enzyme-linked immunosorbent assay (ELISA); mRNA levels of the estrogen receptor (ER), progestogen receptor (PR), tumor necrosis factor a (TNF-a), and interleukin 6 (IL-6) quantified by quantitative reversetranscription polymerase chain reaction (qRT-PCR); and p38 mitogen-activated protein kinase (p38 MAPK) phosphorylation evaluated by Western blotting. Result(s): The LXA4 expression level decreased in ectopic tissue as well as ERa and PR, although the expression of ERb increased in ectopic endometrium compared with the controls. Investigations with correlation analysis revealed the expression of LXA4 was positively correlated with ERa and negatively correlated with ERb in vivo. Moreover, administering LXA4 could augment ERb expression in ESCs and inhibit the 17b-estradiol-induced phosphorylation of p38 MAPK very likely through ERb. Conclusion(s): Our findings indicate that LXA4 regulates ERb expression and inhibits 17bUse your smartphone estradiol-induced phosphorylation of p38 MAPK, very likely through ERb in ESCs. (Fertil SterilÒ to scan this QR code 2014;-:-–-. Ó2014 by American Society for Reproductive Medicine.) and connect to the Key Words: Endometriosis, estrogen receptor, LXA4, p38 MAPK Discuss: You can discuss this article with its authors and with other ASRM members at http:// fertstertforum.com/shuoc-lipoxin-a4-estrogen-receptor-17%CE%B2-estrodiol-p38mapk-hescs/
Received October 16, 2013; revised February 26, 2014; accepted March 14, 2014. S.C. has nothing to disclose. R.-F.W. has nothing to disclose. L.S. has nothing to disclose. W.-D.Z. has nothing to disclose. M.-B.Z. has nothing to disclose. Q.-H.C. has nothing to disclose. Supported by grant 3502 Z 20134002 of the Science and Technology Planning Project of Xiamen City, People's Republic of China and Grant 2013D001 of the Natural Science Foundation of Fujian Province. Reprint requests: Qiong-Hua Chen, Ph.D., Zhenhai Road, No. 55, Siming District, Xiamen, Fujian, People's Republic of China (E-mail: [email protected]). Fertility and Sterility® Vol. -, No. -, - 2014 0015-0282/$36.00 Copyright ©2014 American Society for Reproductive Medicine, Published by Elsevier Inc. http://dx.doi.org/10.1016/j.fertnstert.2014.03.029 VOL. - NO. - / - 2014
discussion forum for this article now.*
* Download a free QR code scanner by searching for “QR scanner” in your smartphone’s app store or app marketplace.
E
ndometriosis, one of the most common gynecologic diseases in women of reproductive age, has been widely treated as an estrogen-dependent and inflammatory disease (1, 2), but its etiology and pathogenesis remain elusive. The most widely accepted hypothesis was proposed by Sampson, that viable endometrial tissue escapes into the 1
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY peritoneal cavity during menstruation, which is presumably coupled with immune defects in pelvic cavity (3). We previously demonstrated the change pattern of cytokines over time in an endometriotic mouse model (4, 5), showing the alterations in immune response. The inflammatory environment plays a critical role in the pathogenesis of this disorder by inducing the growth, adhesion, invasiveness, and angiogenesis of endometrial fragments outside the uterus. After endometriotic lesions successfully implanted in peritoneal cavity, high levels of estrogen could be produced locally in ectopic endometrium. In addition, estrogen is thought to be an immunomodulating agent (6). Therefore, the relationship between enhanced inflammation and augmented estrogen formation may represent an important step for the development of endometriosis. Lipoxins, metabolites of arachidonic acid, have been widely known as endogenous ‘‘breaking signals’’ in inflammation, which can prevent the recruitment of polymorphonuclear neutrophils (PMNs) at sites of inflammation and promote mononuclear cells to clean up tissue debris. Other functions of lipoxins can be described as antiangiogenesis, antiproliferation and resistance to invasion. Lipoxins are known to play a role in endometrium (7), and their specific receptor (lipoxin A4 receptor, ALXR) can be partly regulated by progesterone during the estrus cycle under physiologic conditions (8). In addition, a higher level of ALXR in endometriotic tissue is seen compared with normal endometrium (8). The inhibitive effects of lipoxin A4 (LXA4) on the endometriosis mouse model were also revealed by our previous research (9, 10), which renders its role in pathogenesis of endometriosis of great interest. The p38 mitogen-activated protein kinase (p38 MAPK) intracellular signal-transducing molecule has been proved to play an important role in inflammatory response. It regulates various kinds of proinflammatory agents such as tumor-necrosis factor a (TNF-a), interleukin-1b (IL-1b), IL-6, IL-8, matrix metalloproteinase 2 (MMP-2), and MMP-9. Recently, researchers showed that the activation of p38 MAPK is involved in the pathophysiologic process of endometriosis (11). Studies by our group and others (12, 13) have shown that the inhibitor of p38 MAPK significantly represses the development of endometriosis. In another study (14), the phosphorylation of p38 MAPK induced by 17b-estradiol (E2) in endometrial stromal cells was prohibited by the estrogen receptor (ER) inhibitor (ICI 182780). It is interesting that LXA4 was recently described as a novel estrogen modulator in Ishikawa cells (15). Therefore, we propose that LXA4 inhibits E2-induced activation of p38 MAPK and is likely involved with ER as well. Although there have been several studies on the therapeutic effects of lipoxins on endometriosis, its mechanism remains elusive. These findings led us to the hypothesis that LXA4 might simultaneously regulate estrogen signaling and inflammatory response to prevent the development and progression of endometriosis. We also examined the question of whether an immunoendocrine crosstalk link in endometriosis could be established by LXA4. 2
MATERIALS AND METHODS Reagents and Antibodies The stock solutions of E2 (Merck KgaA) and ICI 182780 (Fulvestrant; Sigma-Aldrich) were prepared in dimethyl sulfoxide (DMSO). Lipoxin A4 (Neogen Corporation) and diarylprepionitrile (DPN; Sigma-Aldrich) were prepared in ethanol. Dulbecco's modified Eagle's medium/Ham's F-12 medium (DMEM/F-12), antibiotics (mixture of penicillin and streptomycin), 0.25% trypsin, and fetal bovine serum (FBS) were bought from Hyclone. Type IV collagenase and deoxyribonuclease I were both acquired from Bio Basic. The SYBR PrimeScript RT-PCR Kit was purchased from Takara Biotechnology. Mouse monoclonal anti-human estrogen receptor a (ERa) (sc8002), rabbit polyclonal anti-human phosphorylated p38 MAPK (p-p38 MAPK, sc-7975-R), and p38 MAPK (sc-7149) were obtained from Santa Cruz Biotechnology. Rabbit polyclonal anti-human ERb antibody was obtained from Epitomics (S2015). Rabbit polyclonal anti-human progestogen receptor (PR) antibody was purchased from Cell Signaling (D8Q2J). Mouse monoclonal anti-human b-actin antibody was obtained from Anbo Biotechnology (#E0012). The secondary antibodies used were goat polyclonal anti-mouse IgG antibody (A00160, Genscript) and goat polyclonal antirabbit IgG antibody (A00098; Genscript).
Patients and Sample Collection Forty-nine women (between 20 and 49 years old) were examined for pelvic pain, dysmenorrhea, or infertility in the Department of Gynecology and Obstetrics at the First Affiliated Hospital of Xiamen University in Xiamen, People's Republic of China. Among these patients, the absence of endometriosis was laparoscopically confirmed in 19 (normal group, mean age 34 years old, range: 24–49 years), and endometriosis was both laparoscopically and histologically confirmed in 30 (EM group, mean age 35.5 years old, range: 20–47 years). The use of these tissues was approved by the ethics committee of the First Affiliated Hospital of Xiamen University, and informed consent was obtained from each patient. None of these patients had received hormone treatment for at least 3 months before the surgery. All patients were of reproductive age with normal menstrual cycles. For the primary cell culture, the collected endometriotic tissue was immediately transported to the laboratory in DMEM/F-12 on ice under sterile conditions.
Isolation and Culture of Human Endometriotic Stromal Cells Primary endometriotic stromal cell (ESC) culture was based on a previously published protocol with minor modifications (16). Briefly, endometriotic tissue was rinsed with phosphatebuffered saline (PBS), minced into small pieces, and incubated in DMEM/F-12 with type IV collagenase (2 mg/mL) and deoxyribonuclease I (15 U/mL) in a shaking water bath for 1.5 to 2.0 hours at 37 C. The cell suspensions were filtered through nylon cell strainers with 140-mm apertures, and then with 37mm apertures. The endometrial epithelial glands that remained intact were retained by the strainer, and the dispersed stromal VOL. - NO. - / - 2014
Fertility and Sterility® cells passed through the strainer into the filtrate. The remaining ESCs in the filtrate were centrifuged at 800 g for 10 minutes, washed with DMEM/F-12, resuspended in complete medium (DMEM/F-12 supplemented with 100 U/mL penicillin, 100 mg/mL streptomycin, and 15% FBS), and plated onto 60mm dishes. The cells were allowed to adhere selectively to culture dishes for 30 minutes at 37 C in 5% CO2 in air, after which nonadhering epithelial cells and blood cells were removed with PBS rinses. Isolated ESCs were cultured in complete medium at 37 C with 5% CO2. The cells were used for experiments upon reaching confluent state after about 3 to 4 days. The purification of the stromal cells were determined by immunocytochemical staining with mouse anti-human vimentin 9 (stromal cells) and cytokeratin 19 (epithelial cells) antibodies. The ESCs in monolayer culture after the second passage were more than 96% purity, judged by the positive cellular staining for vimentin 9 and the negative cellular staining for cytokeratin 19 (data not shown). These ESCs were used between passages 2 and 6.
Enzyme-linked Immunosorbent Assay Lipoxin A4 level in the supernatant of tissue lysate samples of endometriosis and control patients was measured using an enzyme-linked immunosorbent assay (ELISA) kit (Neogen Corporation) according to the manufacturer's instructions. The tissue samples (control: n ¼ 10; endometriosis: n ¼ 19) were homogenized in PBS (0.4 mL) by TissueLyser at 2,000 rpm for 3 minutes. After centrifugation, the supernatant was assessed by ELISA kits. Standard curve and negative controls were also included in each experiment. The intraassay and interassay coefficients of variation were less than 5% in these assays.
RNA Isolation and Quantitative Real-time Reversetranscription Polymerase Chain Reaction Total RNA was extracted from tissue samples or ESCs with RNAiso Plus (TaKaRa) and stored at 80 C for further use. The cDNA was synthesized with PrimeScript RT reagent kit from total RNA. The polymerase chain reaction (PCR) reaction was performed using the SYBR Premix Ex Taq II (TaKaRa) in Lightcycler 480 (Roche). The results were normalized based on GAPDH expression, and the 2DCT and 2DDCT method was used to calculate the relative mRNA level in tissue and cells, respectively (17). The primer sequences were as follows (50 –30 ): ERa, forward CCACCAACCAGTGCACCATT and reverse GGTCTTTTCGTATCCCACCTTTC; ERb, forward AGAG TCCCTGGTGTGAAGCAAG and reverse GACAGCGCAGAA GTGAGCATC; PR, forward CTAAATGAACAGCGGATGAA AG and reverse GGAACTCTTCTTGGCTAACTTG; GAPDH, forward GGAAGGTGAAGGTCGGAGTCA and reverse GAGT CCTTCCACGATACCAA; TNF-a, forward AAGCCTGTAGCC CACGTCGTA and reverse GGCACCACTAGTTGGTTGTCTTTG; IL-6, GACAGCCACTCACCTCTTCA and reverse AGTGCCTC TTTGCTGCTTTC.
sions and control endometrium. Biopsy samples were fixed in 4% formaldehyde, embedded in paraffin, and cut into 5mm sections for immunohistochemical analysis. All immunohistochemical stainings were performed with the UltraSensitive S-P (MaixinBio). To prevent the histotomy from falling off, the slides were preheated at 60 C for 90 minutes. Then the antigen was treated under high pressure for 2 minutes, and endogenous peroxidase activity was eliminated by endogenous peroxidase blockers (MaixinBio) at room temperature. Nonspecific bindings were blocked with nonimmune animal serum (MaixinBio). The slides were incubated with the primary antibody, ERa (1:200 dilution), ERb (1:500 dilution), PR (1:1,000 dilution), p-p38 MAPK (1:1,000 dilution), and p38 MAPK (1:1,000 dilution) overnight at 4 C. Then a biotinylated secondary anti-rabbit antibody (MaixinBio) was used, and sections were incubated with streptomycete avidin-peroxidase complex (MaixinBio) for 10 minutes at room temperature. After that, DAB (MaixinBio) was used as a substrate, and sections were lightly counterstained with hematoxylin solution (MaixinBio), dehydrated, and mounted. Negative controls without the primary antibody were also included in the experiments (data not shown). Stainings were observed under an inverted microscope (Olympus IX71), and images were captured with image-Pro Express 4.0 (Media Cybernetics).
Western Blot Analysis Whole-cell lysates (30–40 mg) were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE), and the proteins were transferred to polyvinylidene difluoride (PVDF) membranes by electroblotting. Nonspecific binding was blocked by incubating the membranes in 5% nonfat milk in PBST (0.1% Tween-20) for 1 hour at room temperature. Membranes were subsequently incubated overnight at 4 C with primary antibodies. The antibodies used in Western blotting were ERa (1:500), ERb (1:1,000), PR (1:1,000), p38 MAPK (1:1,000), p-p38MAPK (1:1,000), and b-actin (1:5,000). Then the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody (1:10,000; Genscript) for 1 hour at room temperature and visualized using enhanced chemiluminescence (Lulong Biotech).
Statistical Analysis All experiments were repeated at least three times. All data sets were presented as mean standard error of the man (SEM). Comparisons between groups were performed using a Student's t test or one-way analysis of variance (ANOVA) where appropriate. Linear regression was used to analyze the data in human endometrium. Analysis was performed with Graphpad Prism, version 5.01. P< .05 was considered statistically significant.
RESULTS
Immunohistochemistry
Expression of ER, PR, and LXA4 in Ectopic Endometrial Tissue
The ERa, ERb, PR, p-p38 MAPK and p38 MAPK immunohistochemical stainings were performed on endometriotic le-
As shown in Figure 1A, the expression of LXA4 was significantly decreased in ectopic endometrial tissue compared
VOL. - NO. - / - 2014
3
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 1
Abnormal expression of LXA4, ER, and PR in patients with endometriosis in comparison with control subjects. (A) Concentrations of LXA4 studied by ELISA. A significant decrease in LXA4 concentration was observed between the endometrium from the controls (n ¼ 10) and endometriosis patients (n ¼ 19). Relative mRNA expression of ERa (B), ERb (C), and PR (D) in the endometrial tissue of the controls (n ¼ 15) and ectopic endometrium of endometriosis patients (n ¼ 24) was quantified by qRT-PCR and normalized to GAPDH. Data represent the mean SEM. *P<.05, ***P<.001 versus normal endometrium. (E) Immunohistochemical of ERa (a, d), ERb (b, e), and PR (c, f) in endometrial tissue of the controls (a, b, c) (n ¼ 6) and in ectopic (d, e, f) (n ¼ 6) endometrium. The negative control is not shown. Insert: original magnification, 40. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
with the control subjects by nearly twofold (45.9 3.7 pg/mL vs. 25.7 1.9 pg/mL). In searching for the effects of LXA4 on ER and PR, we detected the abnormal expression of ER and PR in ectopic tissue. As shown in Figure 1B and D, ERa and PR mRNA expression was decreased by sixfold and eightfold over normal endometrium tissue 0.374 0.109 vs. 0.063 0.010; 0.592 0.231 vs. 0.072 0.015 relative expression units), respectively. In contrast, Figure 1C showed the ERb mRNA level of ectopic endometrium was significantly augmented by 30-fold over the control endometrium (from 0.101 0.026 to 0.003 0.001). Immunohistochemical analyses revealed that expression of ER and PR was consistent with the results of the quantitative real-time PCR (qRT-PCR) 4
(see Fig. 1E). Additionally, ERa and PR were expressed specifically in glandular epithelial cells, and nuclear expression was apparent. Both receptors were significantly decreased in the ectopic endometrial tissue. However, ERb, stained with greater intensity in endometriosis, was mainly expressed in nuclear of stromal cells, and only some light cytoplasmic staining could be seen in glandular epithelial cells.
LXA4 Regulates Expression of ERb in Human ESCs To examine whether LXA4 can regulate the expression of ER and PR, we treated human ESCs with vehicle control, 108 M E2, 107 M LXA4, or cotreated them for 6 hours. As shown in VOL. - NO. - / - 2014
Fertility and Sterility®
FIGURE 2
LXA4 modulates ERb expression in ESCs. The ESCs were incubated with vehicle control, E2, LXA4, or cotreated for 6 hours. (A) Total RNA was extracted, and qRT-PCR performed. Experiments were repeated in ESCs from five different patients. The data represent the mean SEM. (B) Cell lysates were then analyzed for protein levels by Western blot analysis. One representative blot of three different patients is shown. Quantity-One was used for densitometric analysis. Data represent the mean SEM. *P<.05, **P<.01 versus vehicle-treated cells; tP<.05 versus E2-treated cells. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
Figure 2A, ERa mRNA was decreased in LXA4-treated cells compared with E2-treated cells. The ERb mRNA level was elevated in both the LXA4-treated cells and cotreated cells compared with the control group. No statistically significant difference was observed in the expression of PR. Hence, we then examined the protein expression of ER. We confirmed E2 and LXA4 increased the ERb protein levels by 20% and 16%, respectively; the ERb protein level were further increased by 40% in cotreated cells compared with the vehicle-treated cells (see Fig. 2B). However, the ERa protein expression was not significantly altered in the cells stimulated with E2, LXA4, or cotreated, suggesting a selective modulation of ERb expression.
LXA4 Inhibits E2-induced p38 MAPK Phosphorylation Very Likely through ERb in Human ESCs Immunohistochemical analysis revealed that phosphorylated p38 MAPK (Fig. 3A) was expressed in the nuclei, and ESCs were stained with greater intensity compared with the controls. No staining was observed on sections incubated with an isotype-matched negative control antibody. To determine the effects of LXA4 on E2-induced p38 MAPK phosphorylation, we pretreated ESCs with 107 M ICI 182780 for 24 hours. Afterward, the cell cultures were treated with 107 M LXA4 for 30 minutes, then treated with control or E2 (108 M) for 10 minutes. As shown in Figure 3B, E2 induced the phosphorylated protein expression of p38 MAPK, which could be inhibited by ICI 182780, suggesting that E2 activated p38 VOL. - NO. - / - 2014
MAPK phosphorylation via ER (14). And LXA4 significantly attenuated E2-induced p38 MAPK phosphorylation (see Fig. 3B). To provide further support for our proposal that LXA4 can inhibit E2-induced p38 MAPK phosphorylation, we assessed the level of TNF-a and IL-6, which can be stimulated by activated p38 MAPK. We found that LXA4 significantly suppressed TNF-a and IL-6 mRNA expression in cotreated cells compared with E2-treated cells (see Fig. 3C). Considering that LXA4 could induce the expression of ERb, we assume that the suppression of exogenous LXA4 on p38 MAPK phosphorylation was associated with ERb. As shown in Figure 3D, DPN could strongly suppress the phosphorylation of p38 MAPK at 107 M and 108 M in ESCs, which suggests that LXA4 inhibited p38 MAPK phosphorylation very likely through ERb.
Expression of ERa and ERb was in Strong Correlation with the Level of LXA4 in Human Endometrium Given the abnormal expression of LXA4, ER, and PR, we went on to hypothesize that the expression of LXA4 may be correlated with the expression of ER and PR. To test this hypothesis, total RNA from 22 cases of normal or ectopic endometrium was collected. Linear regression analysis showed that the expression of ERa was in strong positive correlation with the expression of LXA4 (Fig. 4A; P< .01) whereas a negative correlation between the expression of LXA4 and ERb was observed (see Fig. 4B; P< .01). The correlation between LXA4 and PR was not statistically significant (see Fig. 4C; 5
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 3
LXA4 inhibits E2-induced phosphorylation of p38 MAPK in ESCs, probably though ERb. (A) Immunohistochemical of phosphorylated p38 MAPK in normal (a) (n ¼ 6) and ectopic (b) (n ¼ 6) endometrium. Negative control for normal endometrium (c) and ectopic endometrial tissue (d). Insert: original magnification, 40. (B) ESCs (n ¼ 5) were pretreated with 107 M ICI 182780 for 24 hours. Afterward, the cell cultures were treated with 107 M LXA4 for 30 minutes, then treated with control or E2 (108 M) for 10 minutes. Cell lysates were subsequently prepared for Western blot analysis. Quantity-One was used for densitometric analysis. (C) ESCs (n ¼ 5) were incubated with vehicle control, E2, LXA4, or cotreated for 6 hours. We used qRT-PCR to detect the mRNA expression of TNF-a and IL-6. (D) ESCs (n ¼ 4) were incubated with vehicle or DPN at the indicated concentration for 24 hours. Cell lysates were subsequently prepared for Western blot analysis. Quantity-One was used for densitometric analysis. Data represent the mean SEM. *P<.05 versus vehicle-treated cells; tP<.05 versus E2-treated cells. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
P>.05). These results further supported our hypothesis that the expressions of ERa and ERb were positively regulated by LXA4 in vivo.
DISCUSSION To the best of our knowledge, ours is the first report on the effects of LXA4 on human ESCs. In the present study, LXA4 modulated expression of ERb, inhibited E2-induced phosphorylation of p38 MAPK, and down-regulated expression of proinflammatory-associated genes (TNF-a and IL-6) in human ESCs. Our analysis focused on the effects of LXA4, an antiinflammatory endogenously produced eicosanoids, which has been suggested to be a novel candidate as a therapeutic target or agent for endometriosis. Scanty studies about the role of LXA4 are reported in endometriosis. 6
The expression of lipoxygenase enzymes (LOXs) and ALXR have been previously found in endometrium (15, 18, 19). As an endogenous arachidonic acid metabolite, LXA4 could rapidly produce and act locally to promote resolution of inflammation (20, 21). During the menstrual cycle, AXLR mRNA expression is changed (8, 19), which demonstrates that LXA4 can regulate inflammatory events in the human endometrium. The multiple functions of LXA4 with regard to the pathophysiologic progress of endometriosis have been described in the literature, such as antiangiogenesis, antiproliferation, and sex steroid modulation (15, 22). By using the endometriotic mouse model, we found that LXA4 could inhibit the growth of endometriotic lesions in part by lowering the concentration of peritoneal proinflammatory cytokines (9, 10). Additionally, as attenuated production of LXA4 can lead to a defect in the resolution of inflammation, VOL. - NO. - / - 2014
Fertility and Sterility®
FIGURE 4
The expression of LXA4 was positively correlated with the expression of ERa and negatively correlated with ERb in human endometrium. Twentytwo cases of normal or ectopic tissues were analyzed for their mRNA expression of ERa, ERb, and PR by qRT-PCR analysis, and LXA4 expression levels through ELISA. Circles represent individual patients. The correlations were analyzed by linear regression. Chen. Role of lipoxin A4 in endometriosis. Fertil Steril 2014.
which directly contributes to many chronic disease states (23– 25), the decreased LXA4 level in the ectopic endometrium observed in our experiments very likely involves in endometriosis. The most potent estrogen produced in the body is E2, and estrogen signaling is largely mediated by ERa and ERb, stimulating the proliferation of ectopic tissue and regulating inflammatory responses. In this study, we described the overexpression of ERb and lower levels of ERa and PR in endometriosis, which is consistent with other research (26, 27). Furthermore, our correlation analysis first revealed that the expression of ERa and ERb was significantly correlated with the LXA4 level in human endometrium. However, in vitro experiments showed that exogenous LXA4 augmented ERb expression in human ESCs, which seems to be contradictory to the data on tissues. The reason is probably due to the in vivo cellular context. It is known that E2 down-regulates 15-LOX as well as LXA4 formation in the cornea (28). In addition, E2 could also regulate the expression of ERb (29, 30). Therefore, the low level of LXA4 and abnormal expression of ER in endometriosis tissue are very much likely associated with the high level of E2. It seems that the overall response in vivo is mainly decided by E2. But LXA4 demonstrated antiestrogenic potential, significantly attenuating E2-induced activity (15). Therefore, the different relative concentrations of LXA4 and E2 may result in different outcomes between in vivo and in vitro conditions. These may account for the discrepancy between in vivo and in vitro data. Moreover, another study has shown that the human ERa gene is regulated by ERb via a different promoter in endometrial cells and endometriotic cells, which may be due to the extremely high ERb levels in endometriosis (31). In addition, ERb is a repressor of ERa transcriptional activity (32), which may prevent E2 from exerting its biologic function through ERa. Investigators have found that an ERb-selective agonist might have utility as novel anti-inflammatory agent (33) and cause lesion regression in endometriosis mouse model (34, 35). In a word, activation of ERb could attenuate estrogen signaling and inhibit inflammatory responses at the same time, which is beneficial for endometriosis. Therefore, we considered the VOL. - NO. - / - 2014
possibility that exogenous LXA4 could inhibit endometriosis partly through ERb. Numerous pathophysiologic processes implicated in endometriosis are regulated by p38 MAPK, notably the induction of aberrant inflammatory cytokines and cyclooxygenase-2 (COX-2) expression (12, 36, 37), which can induce the production of E2 and promote the development of endometriosis. Our data show that E2 can activate p38 MAPK through ER, which also has been supported by another study (14). Excessive estrogen in endometriotic tissue leads to the phosphorylation of p38 MAPK; consequently, a positive feedback loop between estrogen and p38 MAPK is established. Here, we report p38 MAPK phosphorylation is augmented in human endometriotic lesions (11), and LXA4 can inhibit E2-induced phosphorylation of p38 MAPK most likely through ER, resulting in a decreased level of TNF-a and IL-6 (see Fig. 3). Phosphorylated p38 MAPK can increase the formation of these two cytokines, and they have been illustrated in various research studies as having important roles in the establishment and maintenance of this disease (3, 38). Our previous study and other investigators have also shown that specific p38 MAPK inhibitor could inhibit the development of endometriosis (12, 13). Therefore, the inhibition of LXA4 on endometriosis is concerned with p38 MAPK. The effects of LXA4 on ERb and p38 MAPK prompt us to consider that LXA4 prohibits the phosphorylation of p38 MAPK partly through ERb, which is supported by the inhibition of DPN on p38 MAPK phosphorylation (see Fig. 3D). Additional research must be performed to better define the role of ERa and ERb in LXA4-elicited effects, but our experimental results could shed some light on the directions of future studies on the precise molecular mechanism of LXA4 in the pathology of endometriosis. The existing major treatment for endometriosis is surgery and pharmacologic treatment as an auxiliary measure, including gonadotropin-releasing hormone (GnRH), oral contraceptives, and progestins. Surgery is effective but invasive, and pharmacologic treatments have a poor curative effect, high recurrence rate, and side effects such as effects on menstrual cycle. In contrast, LXA4 treatment does not interfere 7
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY with the estrous cycle (9), which presents an obvious advantage over traditional steroid drugs. Considering the regulation on inflammatory and estrogen, we believe that the application of lipoxins in the treatment of this chronic disorder has broad prospects. In summary, LXA4 regulates expression of ERb and inhibits the development of endometriosis by suppressing p38 MAPK phosphorylation, very likely through ERb.
REFERENCES 1. 2. 3. 4.
5.
6. 7. 8.
9.
10.
11.
12.
13.
14.
15. 16.
17. 18.
8
Rizner TL. Estrogen metabolism and action in endometriosis. Mol Cell Endocrinol 2009;307:8–18. Warren PD, Nothnick B. Treating endometriosis as an autoimmune disease. Fertil Steril 2001;76:223–31. Giudice LC, Kao LC. Endometriosis. Lancet 2004;364:1789–99. Chen QH, Zhou WD, Su ZY, Huang QS, Jiang JN, Chen QX. Change of proinflammatory cytokines follows certain patterns after induction of endometriosis in a mouse model. Fertil Steril 2010;93:1448–54. Chen Q, Qiu N, Pu D, Zhou Y, Li T, Yang H. Change profiles in matrix metalloproteinase-2 and -9 in induced endometriosis in mice. J Huazhong Univ Sci Technolog Med Sci 2010;30:188–92. Straub RH. The complex role of estrogens in inflammation. Endocr Rev 2007; 28:521–74. Canny GO, Lessey BA. The role of lipoxin A4 in endometrial biology and endometriosis. Mucosal Immunol 2013;6:439–50. Motohashi E, Kawauchi H, Endo H, Kondo H, Kitasato H, Kuramoto H, et al. Regulatory expression of lipoxin A4 receptor in physiologically estrus cycle and pathologically endometriosis. Biomed Pharmacother 2005;59:330–8. Chen QH, Zhou WD, Pu DM, Huang QS, Li T, Chen QX. 15-Epi-lipoxin A4 inhibits the progression of endometriosis in a murine model. Fertil Steril 2010;93:1440–7. Chen Q, Zhou W, Pu D, Li Z, Huang Q, Chen Q. The inhibitory effect of 15-RLXA4 on experimental endometriosis. Eur J Obstet Gynecol Reprod Biol 2009;145:200–4. Kayisli UA, Cakmak H, Seval Y, Donmez BO, Arici A. In vivo regulation of p38 MAPK activation in human endometrium and endometriosis. Fertil Steril 2005;84:S441. Zhou WD, Yang HM, Wang Q, Su DY, Liu FA, Zhao M, et al. SB203580, a p38 mitogen-activated protein kinase inhibitor, suppresses the development of endometriosis by down-regulating proinflammatory cytokines and proteolytic factors in a mouse model. Hum Reprod 2010;25:3110–6. Yoshino O, Osuga Y, Koga K, Hirota Y, Hirata T, Ruimeng X, et al. FR 167653, a p38 mitogen-activated protein kinase inhibitor, suppresses the development of endometriosis in a murine model. J Reprod Immunol 2006;72:85–93. Seval Y, Cakmak H, Kayisli UA, Arici A. Estrogen-mediated regulation of p38 mitogen-activated protein kinase in human endometrium. J Clin Endocrinol Metab 2006;91:2349–57. Russell R, Gori I, Pellegrini C, Kumar R, Achtari C, Canny GO. Lipoxin A4 is a novel estrogen receptor modulator. FASEB J 2011;25:4326–37. Delbandi AA, Mahmoudi M, Shervin A, Akbari E, Jeddi-Tehrani M, Sankian M, et al. Eutopic and ectopic stromal cells from patients with endometriosis exhibit differential invasive, adhesive, and proliferative behavior. Fertil Steril 2013;100:761–9. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 2008;3:1101–8. Lousse JC, Defrere S, Colette S, Van Langendonckt A, Donnez J. Expression of eicosanoid biosynthetic and catabolic enzymes in peritoneal endometriosis. Hum Reprod 2010;25:734–41.
19.
20.
21. 22.
23.
24. 25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Macdonald LJ, Boddy SC, Denison FC, Sales KJ, Jabbour HN. A role for lipoxin A4 as an anti-inflammatory mediator in the human endometrium. Reproduction 2011;142:345–52. Chiang N, Serhan CN, Dahlen SE, Drazen JM, Hay DW, Rovati GE, et al. The lipoxin receptor ALX: potent ligand-specific and stereoselective actions in vivo. Pharmacol Rev 2006;58:463–87. Maderna P, Godson C. Lipoxins: resolutionary road. Br J Pharmacol 2009; 158:947–59. Xu Z, Zhao F, Lin F, Chen J, Huang Y. Lipoxin A4 inhibits the development of endometriosis in mice: the role of anti-inflammation and anti-angiogenesis. Am J Reprod Immunol 2012;67:491–7. Celik GE, Erkekol FO, Misirligil Z, Melli M. Lipoxin A4 levels in asthma: relation with disease severity and aspirin sensitivity. Clin Exp Allergy 2007;37: 1494–501. O’Meara YM, Brady HR. Lipoxins, leukocyte recruitment and the resolution phase of acute glomerulonephritis. Kidney Int Suppl 1997;58:S56–61. Merched AJ, Ko K, Gotlinger KH, Serhan CN, Chan L. Atherosclerosis: evidence for impairment of resolution of vascular inflammation governed by specific lipid mediators. FASEB J 2008;22:3595–606. Smuc T, Pucelj MR, Sinkovec J, Husen B, Thole H, Lanisnik Rizner T. Expression analysis of the genes involved in estradiol and progesterone action in human ovarian endometriosis. Gynecol Endocrinol 2007;23: 105–11. Xue Q, Lin Z, Cheng YH, Huang CC, Marsh E, Yin P, et al. Promoter methylation regulates estrogen receptor 2 in human endometrium and endometriosis. Biol Reprod 2007;77:681–7. Wang SB. Estrogen regulation of the 15-LOX/LXA4 protective lipid circuit in the corneal inflammatory-reparative response [dissertation]. Berkeley: Univ. of California; 2013. Khurana SR, Ben-Jonathan N. Exposure of newborn male and female rats to environmental estrogens: delayed and sustained hyperprolactinemia and alterations in estrogen receptor expression. Endocrinology 2000; 141:4512–7. Vladusic AE, Guerra-Vladusic FK, Lakins J, Lupu R. Expression and regulation of estrogen receptor beta in human breast tumors and cell lines. Oncol Rep 2000;7:157–224. Trukhacheva E, Lin Z, Reierstad S, Cheng YH, Milad M, Bulun SE. Estrogen receptor (ER) regulates ER expression in stromal cells derived from ovarian endometriosis. J Clin Endocrinol Metab 2009;94:615–22. Hall JM, McDonnell DP. The estrogen receptor beta-isoform (ERb) of the human estrogen receptor modulates ERa transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 1999;140:5566–78. Harris HA. The unexpected science of estrogen receptor-beta selective agonists: a new class of anti-inflammatory agents? Nucl Recept Signal 2006; 4:1–4. Cvoro A, Tatomer D, Tee MK, Zogovic T, Harris HA, Leitman DC. Selective estrogen receptor-beta agonists repress transcription of proinflammatory genes. J Immunol 2008;180:630–6. Harris HA, Bruner-Tran KL, Zhang X, Osteen KG, Lyttle CR. A selective estrogen receptor-beta agonist causes lesion regression in an experimentally induced model of endometriosis. Hum Reprod 2005;20:936–41. Yoshino O, Osuga Y, Hirota Y, Koga K, Hirata T, Harada M, et al. Possible pathophysiological roles of mitogen-activated protein kinases (MAPKs) in endometriosis. Am J Reprod Immunol 2004;52:306–11. Wu MH, Wang CA, Lin CC, Chen LC, Chang WC, Tsai SJ. Distinct regulation of cyclooxygenase-2 by interleukin-1b in normal and endometriotic stromal cells. J Clin Endocrinol Metab 2005;90:286–95. Gori I, Pellegrini C, Staedler D, Russell R, Jan C, Canny GO. Tumor necrosis factor-a activates estrogen signaling pathways in endometrial epithelial cells via estrogen receptor a. Mol Cell Endocrinol 2011;345:27–37.
VOL. - NO. - / - 2014