- Email: [email protected]
Listeria innocua isolated from a case of ovine meningoencephalitis
veterinary microbiology ELSEVIER
Veterinary Microbiology42 (1994) 245-253
Short Communication
Listeria innocua isolated from a case of ovine Meningoencephalitis J.K. Walker a,., J.H. Morgan a, j. McLauchlin b, J.A. Shallcross c
K.A. Grant c,
"Institutefor Animal Health, Compton, Newbury, Berks., UK b PHLSFood Hygiene Laboratory, CentralPublic Health Laboratory, ColindaleAvenue, London, UK c BBSRC, Institute of Food Research, Reading Laboratory, Earley Gate, WhiteknightsRoad, Reading, UK
Received 6 October 1993; accepted 8 March 1994
Abstract
This paper reports a naturally occurring case of meningoencephalitis associated with Listeria innocua in a Polled-Dorset ewe. The ewe was one of a housed group of twenty-five, fed ad lib. on wrapped baled silage. L. innocua was isolated after one week from cold enrichment culture of brain and pituitary tissue. Its identity was confirmed by conventional biochemical tests, API Listeria (BioMerieux UK Ltd), the absence of hly and prfA genes using PCR assay and sequencing two variable regions of 16S rDNA. Histological examination demonstrated lesions of vasculitis and perivascular cuffing in the midbrain which were consistent with listeriosis although limited in distribution and severity. Keywords: Listeria innocua; Sheep, Listeria innocua; Meningoencephalitis
1. Introduction The genus Listeria is classified into six species (Jones and Seeliger, 1993). L. monocytogenes is considered to be the principal pathogen for both man and animals. L. ivanovii is primarily pathogenic for sheep; L. innocua, L. seeligeri, L. grayi and L. welshmeri are considered to be generally avirulent (Seeliger and Jones, 1986). There is some evidence to suggest that strains of both L. seeligeri (Rocourt et al., 1986) and L. innocua (Rocourt and Seeliger, 1985) are occasionally pathogenic for man and animals respectively. L. innocua has been isolated from cases of encephalitis in ruminants. Rocourt and Seeliger (1985) reported one case in a deer and one in a cow. Nicolas et al. (1986) reported seven * Corresponding author. Institute for Animal Health, Compton, Newbury, Berkshire, RG16 ONN, UK. 0378-1135/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSD10378-1135 ( 94 ) 00054-Z
246
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
cases of encephalitis in sheep, although the organism has also been isolated from brain tissue of clinically normal sheep (Gronstol et al., 1986). L. innocua is pathogenic for suckling mice after intracerebral inoculation (Patocka et al., 1976) and for adult mice and rats after intra-oesophageal inoculation (Manev et al., 1981) and produces brain lesions without clinical signs in experimentally infected lambs (Barley, 1990). The following report describes the bacteriological and histological investigation of a case of naturally-occurring meningoencephalitis resembling listeriosis and further implicates L. innocua as a potential pathogen.
2. Methods 2.1. Animals
This incident occurred in January 1992 in a group of 25 Polled-Dorset ewes, which were part of an experimental study of the epidemiology of listerial infection. The ewes, which had no previous history of listerial infection before the study, had been housed on straw since October 1991 and fed ad lib. on wrapped baled silage. The animals were observed frequently; monthly blood and faeces samples were also collected. 2.2. Bacteriology
Tissue homogenates in nutrient broth (Oxoid) were cultured for Listeria by direct plating, onto LPM (Difco) and Oxford (Oxoid) agar plates, and by cold enrichment. The LPM and Oxford agar plates were incubated at 30°C for 2 days. For cold enrichment the tissue homogenates were diluted in 100 ml of sterile nutrient broth (Oxoid) and held at 4°C for a period of up to 2 months. Subcultures were made at regular intervals to FDA selective enrichment broth (Oxoid) held at 30°C for 2 days, before culture onto LPM and Oxford agar plates. Samples of silage taken for culture were shaken in ten parts of 0.05 M KHaPOa/NaOH buffer (pH 7.4), diluted with equal parts double strength nutrient broth and subjected to cold enrichment. 2.3. Identification of listeria
Isolates were identified using conventional characteristics (McLauchlin, 1987) and also with the API Listeria identification kit (BioMerieux UK Ltd, Basingstoke). Polymerase chain reaction analysis (PCR) was also performed to detect two genes, the Listeria-specific gene listeriolysin ( hly), which is present in L. monocytogenes, L. ivanovii and L. seeligeri (Leimeister-Wachter and Chakraborty, 1989), and the L. monocytogenes-specific regulatory factor gene (prfA) (Wernas et al., 1992). Identification of the isolates was confirmed by direct PCR sequencing of the V2 and V9 variable regions of 16S rDNA, and comparison with the sequences of the V2 and V9 of reference strains L. monocytogenes NCTC 10357 and L. innocua NCTC 11288.
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
247
Table 1 Sequences of primers used in PCR detection systems and sequencing reactions Primers
Sequence
Primers used for PCR detection assays: 16SrDNA universal primers:
AR 1 pE. hly primers: 452 453 p rfA primers: C1 $6 Primers used to generate PCR products for sequencing:
5'GAGAGTTTGATCCTGGCTCA GGA3' 5'CCGTCAATTCCT'ITGAGTTT3' s'CCTAAGACGCCAATCGAA3' 5'CGCCACACTTGAGATAT3' 5'TCTCCGAGCAACCTCGGAACC3' 5'TGGATTGACAAAATGGAACA3'
16S rDNA primers:
AR1 pE. pD pH. Primers used in direct sequencing reactions:
5'GAGAGTTTGATCCTGGCTCAGGA 3' 5'CCGTCAA'I~CCTITGAGTTT3' 5'CAGCAGCCGCGGTAATAC3' 5'AAGGAGGTGATCCAGCCGCA3'
16S rDNA primers:
5'TCACCCTCTCAGGTCGGCTA3' 5'ACACACGTGCTACAATG3'
Y Anti-R
For PCR assays strains were grown on 5% sheep blood agar and incubated aerobically at 37°C for 18 hours. A small amount of growth was emulsified in 100/zl of sterile distilled water in a microcentrifuge tube, boiled for 10 min and placed immediately on ice. The PCR assay was performed by diluting 2.5-5/zl of boiled suspension to 25 ~1 with reaction mix consisting of the following: 50 mM KC1, 10 mM Tris-HC1 pH 8.3, 1.5-3 mM Mg C12, 0.10.5/xM of each primer (Table 1 ), 125-200/zM of deoxynucleotidetriphosphates and 0.51 unit Taq polymerase (Amplitaq Perkin Elmer Cetus). Initial denaturing at 93°C for 4 min was followed by PCR for 30 cycles of denaturing at 93°C for 1 min, annealing at 50°C for hly primers and 60°C for prfA primers, extending at 72°C for 2 min followed by a final extension at 72°C for 10 min. PCR products were visualized on 1.4% agarose gels by staining with ethidium bromide and examining under UV light. PCR conditions for 16S rDNA sequencing were the same except that a total reaction volume of 100/xl and 2 units of Taq polymerase were used. The V2 and V9 region of the 16S rDNA were sequenced by direct sequencing of PCR products obtained using primer pairs AR1, pE. and pD pH. (Table 1 ). 90~1 of PCR product was purified using Magic T M PCR prep DNA system (Promega) according to the manufacturers instructions. Purified PCR products were then sequenced using a-35S dATP and Sequenase version 2.0 sequencing kit (USB) (Hutson et al., 1993). 2.4.
Histology
Blocks of tissues were fixed in 10% neutral buffered formalin, dehydrated, embedded in wax and sectioned at 5~m by standard methods for staining with haematoxylin and eosin; and sectioned at 1/zm for toluidine blue staining.
248
J.K. Walkeret al. / VeterinaryMicrobiology42 (1994) 245-253
3. Results 3.1. Animals Four months after introduction to silage feeding, a ewe was observed with sudden onset of nervous signs which included apparent blindness, bumping into objects, marked dullness and lack of appetite. There was a tendency for the head to be held to one side, but otherwise no definite signs of unilateral paralysis were observed. Samples of cerebrospinal fluid and blood were taken but haematology and clinical chemistry showed no marked abnormalities; bacteria were not isolated. The following day the ewe had deteriorated rapidly and was lateraly recumbent and exhibited paddling of limbs; the ewe was killed at this point on welfare grounds by barbiturate overdose. Gross lesions were not observed at post-mortem examination and samples of pituitary, liver, spleen, bile duct and bulked tissue from the brainstem were removed for bacteriological examination. Histological examination of the brain tissue was also performed. 3.2. Bacteriology Bacteriological examination of brain and pituitary tissue from the ewe yielded pure growth of L. innocua, designated J179 and J18o respectively, after 1 week cold enrichment. Silage samples were taken from the feed hoppers at monthly intervals for culture and all found to be contaminated with L. innocua. 3.3. Identification of listeria The isolates were identified as L. innocua by conventional characterisation and the API Listeria kits. The conventional phenotypic characters were as follows: gram-positive rod; non-haemolytic; CAMP test negative; Voges-Proskauer test positive; urease test negative; catalase positive; oxidase negative; aesculin hydrolysed; acid but no gas produced from Dglucose; acid from D-salicin, L-rhamnose and alpha-methyl-D-mannoside; and no acid from D-mannitol or D-xylose. Using the API Listeria identification system, the following additional results were obtained: DIM test (differentiation of L. monocytogenes/L, innocua) positive; acid produced from D-arabitol and alpha-D-glucoside; and no acid produced from ribose, glucose-1-phosphate and D-tagatose. The strains J179 and J18o did not produce PCR products with either the hly orprfA primers, but PCR products of the expected size were produced with the 16S rDNA universal primers showing that amplifiable DNA was present in the samples. The hly and prfA primers used in this study have detected hly and prfA in 52 strains of L. monocytogenes but not in 36 strains of L. innocua that were tested (results to be published). These results indicate that J179 and J18o are not strains of L. monocytogenes. 16S rDNA sequencing of the V2 and V9 regions was performed using J179 and the results indicate that the organism is L. innocua as it has 100% homology with the type strain of L. innocua in the two differential regions studied (Table 2) (Collins et al., 1991 ). The biochemistry and molecular biology results confirm that J179 and J18o are strains of L. innocua.
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
249
Table 2 Comparison of the sequences of the 16S rRNA V2 region ( 194 to 219) and V9 region ( 1269 to 1290) of the type strains with J179 Species
Sequence of the V2 region
J179
GAGUGUGGCGCAUGCCACGCUCUUGA AAGUGUGGCGCAUGCCACGCUUUUGA GAGUGUGGCGCAUGCCACGCUCUUGA Sequence~theV9Region GUGGAGCCAAUCCCAUAAAACC GUGGAGCUAAUCCCAUAAAACU GUGGAGCCAAUCCCAUAAAACC
L. monocytogenes NCTC10357 L. innocua NCTC11288
Species
J179 L. monocytogenes NCTC 10357 L. innocua NCTC 11288
3.4. Histology Minimal lesions were present in both the cerebrum and cerebellum with occasional veins showing signs of very early perivascular cuffing and a number of effete neurones observed, these tissues being otherwise normal. Minimal lesions were also observed in the upper medulla (the region of the cerebellar peduncles), consisting of numerous effete neurones with at least one vein/capillary showing early cuffing with margination of polymorphonuclear leucocytes. More marked changes were demonstrated in the midbrain, most blood vessels exhibiting signs of marked vasculitis with limited cuffing (Fig. 1), the cell population consisting mainly of mononuclear cells (Fig. 2). One area of cuffing extending into minimal menin-
Fig. 1. Vasculitis in the midbrain of the ewe suffering from listeriosis associated with L. innocua. (Haematoxylin and Eosin x 500).
250
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
Fig. 2. Higher magnification of lesion shown in Fig 1. (Haernatoxylin and Eosin X 800). gitis. H a e m o r r h a g e s around several b l o o d vessels were also o b s e r v e d (Fig. 3). The lesions w e r e limited in their distribution and severity c o m p a r e d to a case o f classical encephalitic listeriosis, w h i c h was o b s e r v e d a e w e f r o m the same study group two months later. Lesions
Fig. 3. Haemorrahage of a blood vessel in the midbrain of a ewe suffering from listeriosis associated with L. innocua. (Haematoxylin and Eosin x 500).
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
251
Fig. 4. Perivascularcuffing extending into microabcessin mid-brainof a ewe sufferingfrom classical listeriosis associated with L. monocytogenes. (Haematoxylinand Eosin X 500). in the midbrain of the ewe from which L. monocytogenes was isolated, showed more pronounced and extensive perivascular cuffing; the infiltration being composed of mixed inflammatory cells including polymorphonuclear leukocytes, extending into microabscesses (Fig. 4).
4. Discussion Listeria spp. J179 and J180 were isolated from the brain and pituitary tissues of a silage fed ewe exhibiting neurological signs consistent with listeriosis. L. monocytogenes and L. innocua are closely related, share 47-55% DNA relatedness (% binding at 60°C) (Rocourt et al., 1982), and show only 11 differences in a 1458 nucleotide sequence of 16S rRNA (Collins et al., 1991). Furthermore the two species are phenotypically very similar: indeed the type strain of L. monocytogenes, NCTC10357, is non-haemolytic and phenotyically identifies as L. innocua. The absence of t h e p r f A and hly genes together with the rRNA sequence data, unequivically identifies isolates J179 and J18o as L. innocua. However, it was recently reported by Czajka et al. (1993) that one strain of L. monocytogenes has an identical sequence in the V 2 region as L. innocua. The V9 sequence is more consistent and no L. rnonocytogenes strains have been identified with the same sequence as L. innocua in the V9 region. Examination of the brain showed no gross lesions, which is consistent with most reports of naturally occurring encephalitic listeriosis (Ladds et al., 1974) Microscopic lesions were not as florid as those produced by L. monocytogenes but were similar to early lesions of
252
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
naturally occurring listeric infection (Cordy and Osebold, 1959), consisting of small veins which were the foci of loose clusters of cells resembling mobilizing microglial macrophages. Similar lesions have been described in the brains of lambs experimentally infected with L. innocua NCTC 11288, as consisting of proliferations of microglial cells and perivascular cuffs composed of macrophages (Barley, 1990). Haemorrhage has also been noted as a feature of listeric encephalitis in sheep (Gray and Killinger, 1965). Co-infection with L. monocytogenes seems an unlikely explanation for listeriosis in this case as pure cultures of L. innocua were isolated from two separate tissues and the unusual histological picture found resembled that described after experimental infection of lambs with L. innocua (Barley, 1990). This isolation of L. innocua increases the evidence that indicates some species of Listeria originally thought to be non-pathogenic may occasionally cause disease (Nicolas et al., 1986; Rocourt et al., 1986; Rocourt and Seeliger, 1985). This implies that the presence of L. innocua in silage can be considered as a potential hazard to livestock.
Acknowledgements The authors wish to thank S. Stevenson. AFRC, Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire. The work in this study was supported by the Ministry of Agriculture, Fisheries and Food and the Department of Health. The epidemiological survey was funded by a MAFF Open contract No. CSA 1739.
References Barley, J.P., 1990. Observations on the pathogenesis and pathology of listerial encephalitis in small ruminants. Ph.D Thesis, University of London, London, pp. 210-213. Collins, M.D., Wallbanks, S., Lane, D.J., Shah, J., Nietupski, R., Smida, J., Dorsch, M. and Stackerbrandt, E., 1991. Phylogenetic analysis of the Genus Listeria based of reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol., 41: 240-246. Cordy, D.R. and Osebold, J.W., 1959. The neuropathogenesis of Listeria encephalomyelitis in sheep and mice. J. Infect. Dis., 104: 164-173. Czajka, J., Bsat, N., Piani, M., Russ, W., Sultana, K., Wiedmann, M., Whitaker, R. and Batt, C.A., 1993. Differentiation of Listeria monocytogenes and Listeria innocua by 16S rRNA genes and intraspecies discrimination ofListeria monocytogenes strains by random amplified polymeric DNA polymorphisms. Appl. Environ. Microbiol., 59: 304-308. Gray, M.L. and Killinger, A.H., 1965. Listeria monocytogenes and listeric infections. Bacteriol. Rev., 30: 309382. Gronstol, H., Rocourt, J. and Catimel, B., 1986. Study of 214 Listeria strains isolated from animals and silage in Norway. In: A-L. Courtieu, E.P. Espaze and A.E. Reynaud (Editors), Listeriose, Listeria, Listeriosis 198586. Proc. 9th Int. Symp. on the Problems of Listeriosis. University of Nantes, pp. 325-329. Hutson, R., Thompson, D.E. and Collins, M.D., 1993. Genetic interrelationships of saccharolytic CIostridium botulinum types B, E and F and related Clostridia as revealed by small subunit rRNA gene sequencing. FEMS Microbiol. Lett., 108: 103. Jones, D. and Seeliger, H.P.R., 1993. International Committee on Systemic Bacteriology, Subcommittee on the Taxonomy of Listeria, Brochothrix and Erysipelothrix. Int. J. Syst. Bacteriol., 43:186.
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
253
Ladds, P.W., Dennis, S.M. and Njoku, C.O., 1974. Pathology of listeric infection in domestic animals. Vet. Bull., 44: 67-74. Leimeister-Wachter, M. and Chakraborty, T., 1989. Detection of listeriolysin, the thiol-dependent haemolysin in L. monocytogenes, L. ivanovii, and L. seeligeri. Infect. Immun., 57: 2350-2357. Manev, H., Stoyanov, D. and Makeva, M., 1981. Study of the pathogenicity of strain L. innocua for experimental animals infected orally. In: Fifth Congress of Microbiology Varna 1981, Part II. Publishing House of the Bulgarian Academy of Sciences, Sofia, pp. 141-146. McLauchlin, J., 1987. Listeria monocytogenes, recent advances in the taxonomy and epidemiology of listeriosis in humans. J. Appl. Bacteriol., 63:1-11. Nicolas, J.A., Cournuejolis, M.J. and Lamachere, M., 1986. Existe-t-il une relation entre les Listeria isolees d'ensilages et les Listeria isolees d'encephales d'animaux malades? In: A-L. Courtieu, E.P. Espaze and A.E. Reynaud (Editors), Listeriose, Listeria, Listeriosis 1985-86. Proc. of the 9th Int. Symp. on the Problems of Listeriosis. University of Nantes, pp. 317-322. Patocka, F., Mencikova, E., Seeliger H.P.R. and Jirasek, A., 1976. Neurotrophic activity of a strain of Listeria innocua in suckling mice. Zbtralbl. Bakteriol. [Orig A]., A243: 490--498. Rocourt, J and Seeliger, H.P.R., 1985. Distribution des especes du genre Listeria. Zbtralbl. Bakteriol. [Orig A]., A259: 317-330. Rocourt, J., Grimont, F., Grimont, P.A.D. and Seeliger., 1982. DNA relatedness among serovars of Listeria monocytogenes sensu lato. Curr. Microbiol., 7:383-388 Rocourt, J., Hof H., Schrettenbrunner, A., Malinverni, R. and Bille, J., 1986. Virulence moderee d'une souche humaine de Listeria seeligeri. In: A-L. Courtieu, E.P. Espaze and A.E. Reynaud (Editors), Listeriose, Listeria, Listeriosis 1985-86. Proc. of the 9th Int. Symp. on the Problems of Listeriosis. University of Nantes, pp. 266270. Seeliger, H.P.R. and Jones, D., 1986. Genus Listeria Pirie 1940, 383AL. In: P.H.A. Sneath, N.S. Mair, M.E. Sharpe and J.G. Holt (Editors), Bergey's Manual of Systematic Bacteriology Vol 2. Williams and Wilklns, Baltimore, pp. 1235-1245. Wernas, K., Heuvelman, K., Notermans, S., Domann, E., Leimeister-Wachter, M. and Chakraborty T., 1992. Suitability of the prfA gene, which encodes a regulator of virulence genes in Listeria monocytogenes, in the identification of pathogenic Listeria spp. Appl. Environ. Microbiol., 58: 765-768.
Veterinary Microbiology42 (1994) 245-253
Short Communication
Listeria innocua isolated from a case of ovine Meningoencephalitis J.K. Walker a,., J.H. Morgan a, j. McLauchlin b, J.A. Shallcross c
K.A. Grant c,
"Institutefor Animal Health, Compton, Newbury, Berks., UK b PHLSFood Hygiene Laboratory, CentralPublic Health Laboratory, ColindaleAvenue, London, UK c BBSRC, Institute of Food Research, Reading Laboratory, Earley Gate, WhiteknightsRoad, Reading, UK
Received 6 October 1993; accepted 8 March 1994
Abstract
This paper reports a naturally occurring case of meningoencephalitis associated with Listeria innocua in a Polled-Dorset ewe. The ewe was one of a housed group of twenty-five, fed ad lib. on wrapped baled silage. L. innocua was isolated after one week from cold enrichment culture of brain and pituitary tissue. Its identity was confirmed by conventional biochemical tests, API Listeria (BioMerieux UK Ltd), the absence of hly and prfA genes using PCR assay and sequencing two variable regions of 16S rDNA. Histological examination demonstrated lesions of vasculitis and perivascular cuffing in the midbrain which were consistent with listeriosis although limited in distribution and severity. Keywords: Listeria innocua; Sheep, Listeria innocua; Meningoencephalitis
1. Introduction The genus Listeria is classified into six species (Jones and Seeliger, 1993). L. monocytogenes is considered to be the principal pathogen for both man and animals. L. ivanovii is primarily pathogenic for sheep; L. innocua, L. seeligeri, L. grayi and L. welshmeri are considered to be generally avirulent (Seeliger and Jones, 1986). There is some evidence to suggest that strains of both L. seeligeri (Rocourt et al., 1986) and L. innocua (Rocourt and Seeliger, 1985) are occasionally pathogenic for man and animals respectively. L. innocua has been isolated from cases of encephalitis in ruminants. Rocourt and Seeliger (1985) reported one case in a deer and one in a cow. Nicolas et al. (1986) reported seven * Corresponding author. Institute for Animal Health, Compton, Newbury, Berkshire, RG16 ONN, UK. 0378-1135/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSD10378-1135 ( 94 ) 00054-Z
246
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
cases of encephalitis in sheep, although the organism has also been isolated from brain tissue of clinically normal sheep (Gronstol et al., 1986). L. innocua is pathogenic for suckling mice after intracerebral inoculation (Patocka et al., 1976) and for adult mice and rats after intra-oesophageal inoculation (Manev et al., 1981) and produces brain lesions without clinical signs in experimentally infected lambs (Barley, 1990). The following report describes the bacteriological and histological investigation of a case of naturally-occurring meningoencephalitis resembling listeriosis and further implicates L. innocua as a potential pathogen.
2. Methods 2.1. Animals
This incident occurred in January 1992 in a group of 25 Polled-Dorset ewes, which were part of an experimental study of the epidemiology of listerial infection. The ewes, which had no previous history of listerial infection before the study, had been housed on straw since October 1991 and fed ad lib. on wrapped baled silage. The animals were observed frequently; monthly blood and faeces samples were also collected. 2.2. Bacteriology
Tissue homogenates in nutrient broth (Oxoid) were cultured for Listeria by direct plating, onto LPM (Difco) and Oxford (Oxoid) agar plates, and by cold enrichment. The LPM and Oxford agar plates were incubated at 30°C for 2 days. For cold enrichment the tissue homogenates were diluted in 100 ml of sterile nutrient broth (Oxoid) and held at 4°C for a period of up to 2 months. Subcultures were made at regular intervals to FDA selective enrichment broth (Oxoid) held at 30°C for 2 days, before culture onto LPM and Oxford agar plates. Samples of silage taken for culture were shaken in ten parts of 0.05 M KHaPOa/NaOH buffer (pH 7.4), diluted with equal parts double strength nutrient broth and subjected to cold enrichment. 2.3. Identification of listeria
Isolates were identified using conventional characteristics (McLauchlin, 1987) and also with the API Listeria identification kit (BioMerieux UK Ltd, Basingstoke). Polymerase chain reaction analysis (PCR) was also performed to detect two genes, the Listeria-specific gene listeriolysin ( hly), which is present in L. monocytogenes, L. ivanovii and L. seeligeri (Leimeister-Wachter and Chakraborty, 1989), and the L. monocytogenes-specific regulatory factor gene (prfA) (Wernas et al., 1992). Identification of the isolates was confirmed by direct PCR sequencing of the V2 and V9 variable regions of 16S rDNA, and comparison with the sequences of the V2 and V9 of reference strains L. monocytogenes NCTC 10357 and L. innocua NCTC 11288.
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
247
Table 1 Sequences of primers used in PCR detection systems and sequencing reactions Primers
Sequence
Primers used for PCR detection assays: 16SrDNA universal primers:
AR 1 pE. hly primers: 452 453 p rfA primers: C1 $6 Primers used to generate PCR products for sequencing:
5'GAGAGTTTGATCCTGGCTCA GGA3' 5'CCGTCAATTCCT'ITGAGTTT3' s'CCTAAGACGCCAATCGAA3' 5'CGCCACACTTGAGATAT3' 5'TCTCCGAGCAACCTCGGAACC3' 5'TGGATTGACAAAATGGAACA3'
16S rDNA primers:
AR1 pE. pD pH. Primers used in direct sequencing reactions:
5'GAGAGTTTGATCCTGGCTCAGGA 3' 5'CCGTCAA'I~CCTITGAGTTT3' 5'CAGCAGCCGCGGTAATAC3' 5'AAGGAGGTGATCCAGCCGCA3'
16S rDNA primers:
5'TCACCCTCTCAGGTCGGCTA3' 5'ACACACGTGCTACAATG3'
Y Anti-R
For PCR assays strains were grown on 5% sheep blood agar and incubated aerobically at 37°C for 18 hours. A small amount of growth was emulsified in 100/zl of sterile distilled water in a microcentrifuge tube, boiled for 10 min and placed immediately on ice. The PCR assay was performed by diluting 2.5-5/zl of boiled suspension to 25 ~1 with reaction mix consisting of the following: 50 mM KC1, 10 mM Tris-HC1 pH 8.3, 1.5-3 mM Mg C12, 0.10.5/xM of each primer (Table 1 ), 125-200/zM of deoxynucleotidetriphosphates and 0.51 unit Taq polymerase (Amplitaq Perkin Elmer Cetus). Initial denaturing at 93°C for 4 min was followed by PCR for 30 cycles of denaturing at 93°C for 1 min, annealing at 50°C for hly primers and 60°C for prfA primers, extending at 72°C for 2 min followed by a final extension at 72°C for 10 min. PCR products were visualized on 1.4% agarose gels by staining with ethidium bromide and examining under UV light. PCR conditions for 16S rDNA sequencing were the same except that a total reaction volume of 100/xl and 2 units of Taq polymerase were used. The V2 and V9 region of the 16S rDNA were sequenced by direct sequencing of PCR products obtained using primer pairs AR1, pE. and pD pH. (Table 1 ). 90~1 of PCR product was purified using Magic T M PCR prep DNA system (Promega) according to the manufacturers instructions. Purified PCR products were then sequenced using a-35S dATP and Sequenase version 2.0 sequencing kit (USB) (Hutson et al., 1993). 2.4.
Histology
Blocks of tissues were fixed in 10% neutral buffered formalin, dehydrated, embedded in wax and sectioned at 5~m by standard methods for staining with haematoxylin and eosin; and sectioned at 1/zm for toluidine blue staining.
248
J.K. Walkeret al. / VeterinaryMicrobiology42 (1994) 245-253
3. Results 3.1. Animals Four months after introduction to silage feeding, a ewe was observed with sudden onset of nervous signs which included apparent blindness, bumping into objects, marked dullness and lack of appetite. There was a tendency for the head to be held to one side, but otherwise no definite signs of unilateral paralysis were observed. Samples of cerebrospinal fluid and blood were taken but haematology and clinical chemistry showed no marked abnormalities; bacteria were not isolated. The following day the ewe had deteriorated rapidly and was lateraly recumbent and exhibited paddling of limbs; the ewe was killed at this point on welfare grounds by barbiturate overdose. Gross lesions were not observed at post-mortem examination and samples of pituitary, liver, spleen, bile duct and bulked tissue from the brainstem were removed for bacteriological examination. Histological examination of the brain tissue was also performed. 3.2. Bacteriology Bacteriological examination of brain and pituitary tissue from the ewe yielded pure growth of L. innocua, designated J179 and J18o respectively, after 1 week cold enrichment. Silage samples were taken from the feed hoppers at monthly intervals for culture and all found to be contaminated with L. innocua. 3.3. Identification of listeria The isolates were identified as L. innocua by conventional characterisation and the API Listeria kits. The conventional phenotypic characters were as follows: gram-positive rod; non-haemolytic; CAMP test negative; Voges-Proskauer test positive; urease test negative; catalase positive; oxidase negative; aesculin hydrolysed; acid but no gas produced from Dglucose; acid from D-salicin, L-rhamnose and alpha-methyl-D-mannoside; and no acid from D-mannitol or D-xylose. Using the API Listeria identification system, the following additional results were obtained: DIM test (differentiation of L. monocytogenes/L, innocua) positive; acid produced from D-arabitol and alpha-D-glucoside; and no acid produced from ribose, glucose-1-phosphate and D-tagatose. The strains J179 and J18o did not produce PCR products with either the hly orprfA primers, but PCR products of the expected size were produced with the 16S rDNA universal primers showing that amplifiable DNA was present in the samples. The hly and prfA primers used in this study have detected hly and prfA in 52 strains of L. monocytogenes but not in 36 strains of L. innocua that were tested (results to be published). These results indicate that J179 and J18o are not strains of L. monocytogenes. 16S rDNA sequencing of the V2 and V9 regions was performed using J179 and the results indicate that the organism is L. innocua as it has 100% homology with the type strain of L. innocua in the two differential regions studied (Table 2) (Collins et al., 1991 ). The biochemistry and molecular biology results confirm that J179 and J18o are strains of L. innocua.
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
249
Table 2 Comparison of the sequences of the 16S rRNA V2 region ( 194 to 219) and V9 region ( 1269 to 1290) of the type strains with J179 Species
Sequence of the V2 region
J179
GAGUGUGGCGCAUGCCACGCUCUUGA AAGUGUGGCGCAUGCCACGCUUUUGA GAGUGUGGCGCAUGCCACGCUCUUGA Sequence~theV9Region GUGGAGCCAAUCCCAUAAAACC GUGGAGCUAAUCCCAUAAAACU GUGGAGCCAAUCCCAUAAAACC
L. monocytogenes NCTC10357 L. innocua NCTC11288
Species
J179 L. monocytogenes NCTC 10357 L. innocua NCTC 11288
3.4. Histology Minimal lesions were present in both the cerebrum and cerebellum with occasional veins showing signs of very early perivascular cuffing and a number of effete neurones observed, these tissues being otherwise normal. Minimal lesions were also observed in the upper medulla (the region of the cerebellar peduncles), consisting of numerous effete neurones with at least one vein/capillary showing early cuffing with margination of polymorphonuclear leucocytes. More marked changes were demonstrated in the midbrain, most blood vessels exhibiting signs of marked vasculitis with limited cuffing (Fig. 1), the cell population consisting mainly of mononuclear cells (Fig. 2). One area of cuffing extending into minimal menin-
Fig. 1. Vasculitis in the midbrain of the ewe suffering from listeriosis associated with L. innocua. (Haematoxylin and Eosin x 500).
250
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
Fig. 2. Higher magnification of lesion shown in Fig 1. (Haernatoxylin and Eosin X 800). gitis. H a e m o r r h a g e s around several b l o o d vessels were also o b s e r v e d (Fig. 3). The lesions w e r e limited in their distribution and severity c o m p a r e d to a case o f classical encephalitic listeriosis, w h i c h was o b s e r v e d a e w e f r o m the same study group two months later. Lesions
Fig. 3. Haemorrahage of a blood vessel in the midbrain of a ewe suffering from listeriosis associated with L. innocua. (Haematoxylin and Eosin x 500).
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
251
Fig. 4. Perivascularcuffing extending into microabcessin mid-brainof a ewe sufferingfrom classical listeriosis associated with L. monocytogenes. (Haematoxylinand Eosin X 500). in the midbrain of the ewe from which L. monocytogenes was isolated, showed more pronounced and extensive perivascular cuffing; the infiltration being composed of mixed inflammatory cells including polymorphonuclear leukocytes, extending into microabscesses (Fig. 4).
4. Discussion Listeria spp. J179 and J180 were isolated from the brain and pituitary tissues of a silage fed ewe exhibiting neurological signs consistent with listeriosis. L. monocytogenes and L. innocua are closely related, share 47-55% DNA relatedness (% binding at 60°C) (Rocourt et al., 1982), and show only 11 differences in a 1458 nucleotide sequence of 16S rRNA (Collins et al., 1991). Furthermore the two species are phenotypically very similar: indeed the type strain of L. monocytogenes, NCTC10357, is non-haemolytic and phenotyically identifies as L. innocua. The absence of t h e p r f A and hly genes together with the rRNA sequence data, unequivically identifies isolates J179 and J18o as L. innocua. However, it was recently reported by Czajka et al. (1993) that one strain of L. monocytogenes has an identical sequence in the V 2 region as L. innocua. The V9 sequence is more consistent and no L. rnonocytogenes strains have been identified with the same sequence as L. innocua in the V9 region. Examination of the brain showed no gross lesions, which is consistent with most reports of naturally occurring encephalitic listeriosis (Ladds et al., 1974) Microscopic lesions were not as florid as those produced by L. monocytogenes but were similar to early lesions of
252
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
naturally occurring listeric infection (Cordy and Osebold, 1959), consisting of small veins which were the foci of loose clusters of cells resembling mobilizing microglial macrophages. Similar lesions have been described in the brains of lambs experimentally infected with L. innocua NCTC 11288, as consisting of proliferations of microglial cells and perivascular cuffs composed of macrophages (Barley, 1990). Haemorrhage has also been noted as a feature of listeric encephalitis in sheep (Gray and Killinger, 1965). Co-infection with L. monocytogenes seems an unlikely explanation for listeriosis in this case as pure cultures of L. innocua were isolated from two separate tissues and the unusual histological picture found resembled that described after experimental infection of lambs with L. innocua (Barley, 1990). This isolation of L. innocua increases the evidence that indicates some species of Listeria originally thought to be non-pathogenic may occasionally cause disease (Nicolas et al., 1986; Rocourt et al., 1986; Rocourt and Seeliger, 1985). This implies that the presence of L. innocua in silage can be considered as a potential hazard to livestock.
Acknowledgements The authors wish to thank S. Stevenson. AFRC, Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire. The work in this study was supported by the Ministry of Agriculture, Fisheries and Food and the Department of Health. The epidemiological survey was funded by a MAFF Open contract No. CSA 1739.
References Barley, J.P., 1990. Observations on the pathogenesis and pathology of listerial encephalitis in small ruminants. Ph.D Thesis, University of London, London, pp. 210-213. Collins, M.D., Wallbanks, S., Lane, D.J., Shah, J., Nietupski, R., Smida, J., Dorsch, M. and Stackerbrandt, E., 1991. Phylogenetic analysis of the Genus Listeria based of reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol., 41: 240-246. Cordy, D.R. and Osebold, J.W., 1959. The neuropathogenesis of Listeria encephalomyelitis in sheep and mice. J. Infect. Dis., 104: 164-173. Czajka, J., Bsat, N., Piani, M., Russ, W., Sultana, K., Wiedmann, M., Whitaker, R. and Batt, C.A., 1993. Differentiation of Listeria monocytogenes and Listeria innocua by 16S rRNA genes and intraspecies discrimination ofListeria monocytogenes strains by random amplified polymeric DNA polymorphisms. Appl. Environ. Microbiol., 59: 304-308. Gray, M.L. and Killinger, A.H., 1965. Listeria monocytogenes and listeric infections. Bacteriol. Rev., 30: 309382. Gronstol, H., Rocourt, J. and Catimel, B., 1986. Study of 214 Listeria strains isolated from animals and silage in Norway. In: A-L. Courtieu, E.P. Espaze and A.E. Reynaud (Editors), Listeriose, Listeria, Listeriosis 198586. Proc. 9th Int. Symp. on the Problems of Listeriosis. University of Nantes, pp. 325-329. Hutson, R., Thompson, D.E. and Collins, M.D., 1993. Genetic interrelationships of saccharolytic CIostridium botulinum types B, E and F and related Clostridia as revealed by small subunit rRNA gene sequencing. FEMS Microbiol. Lett., 108: 103. Jones, D. and Seeliger, H.P.R., 1993. International Committee on Systemic Bacteriology, Subcommittee on the Taxonomy of Listeria, Brochothrix and Erysipelothrix. Int. J. Syst. Bacteriol., 43:186.
J.K. Walker et al. / Veterinary Microbiology 42 (1994) 245-253
253
Ladds, P.W., Dennis, S.M. and Njoku, C.O., 1974. Pathology of listeric infection in domestic animals. Vet. Bull., 44: 67-74. Leimeister-Wachter, M. and Chakraborty, T., 1989. Detection of listeriolysin, the thiol-dependent haemolysin in L. monocytogenes, L. ivanovii, and L. seeligeri. Infect. Immun., 57: 2350-2357. Manev, H., Stoyanov, D. and Makeva, M., 1981. Study of the pathogenicity of strain L. innocua for experimental animals infected orally. In: Fifth Congress of Microbiology Varna 1981, Part II. Publishing House of the Bulgarian Academy of Sciences, Sofia, pp. 141-146. McLauchlin, J., 1987. Listeria monocytogenes, recent advances in the taxonomy and epidemiology of listeriosis in humans. J. Appl. Bacteriol., 63:1-11. Nicolas, J.A., Cournuejolis, M.J. and Lamachere, M., 1986. Existe-t-il une relation entre les Listeria isolees d'ensilages et les Listeria isolees d'encephales d'animaux malades? In: A-L. Courtieu, E.P. Espaze and A.E. Reynaud (Editors), Listeriose, Listeria, Listeriosis 1985-86. Proc. of the 9th Int. Symp. on the Problems of Listeriosis. University of Nantes, pp. 317-322. Patocka, F., Mencikova, E., Seeliger H.P.R. and Jirasek, A., 1976. Neurotrophic activity of a strain of Listeria innocua in suckling mice. Zbtralbl. Bakteriol. [Orig A]., A243: 490--498. Rocourt, J and Seeliger, H.P.R., 1985. Distribution des especes du genre Listeria. Zbtralbl. Bakteriol. [Orig A]., A259: 317-330. Rocourt, J., Grimont, F., Grimont, P.A.D. and Seeliger., 1982. DNA relatedness among serovars of Listeria monocytogenes sensu lato. Curr. Microbiol., 7:383-388 Rocourt, J., Hof H., Schrettenbrunner, A., Malinverni, R. and Bille, J., 1986. Virulence moderee d'une souche humaine de Listeria seeligeri. In: A-L. Courtieu, E.P. Espaze and A.E. Reynaud (Editors), Listeriose, Listeria, Listeriosis 1985-86. Proc. of the 9th Int. Symp. on the Problems of Listeriosis. University of Nantes, pp. 266270. Seeliger, H.P.R. and Jones, D., 1986. Genus Listeria Pirie 1940, 383AL. In: P.H.A. Sneath, N.S. Mair, M.E. Sharpe and J.G. Holt (Editors), Bergey's Manual of Systematic Bacteriology Vol 2. Williams and Wilklns, Baltimore, pp. 1235-1245. Wernas, K., Heuvelman, K., Notermans, S., Domann, E., Leimeister-Wachter, M. and Chakraborty T., 1992. Suitability of the prfA gene, which encodes a regulator of virulence genes in Listeria monocytogenes, in the identification of pathogenic Listeria spp. Appl. Environ. Microbiol., 58: 765-768.