- Email: [email protected]
Liver abscess due to Listeria monocytogenes
CORRESPONDENCE
Liver abscess due to Listeria monocytogenes Listeria monocytogenes is a facultative intracellular, Gram-positive, motile rod which causes both sporadic disease and outbreaks of food-borne infection in humans. Infections with L. monocytogenes occur most frequently in neonates and in adults with immunosuppression, in pregnancy, advanced age, HIV infection, transplant recipients or diabetes mellitus [1–3]. The most apparent clinical forms present as meningitis and primary bacteremia. Focal nonmeningeal infections are uncommon and very few cases affecting the liver have been reported [4–7]. We present a case of solitary liver abscess due to L. monocytogenes. A 58-year-old, obese woman healthy except for a type II diabetes mellitus was admitted to the hospital with fever and abdominal pain in the right upper quadrant that had been present for 1 week. Physical examination revealed a temperature of 39 °C, pallor and tenderness in the right upper quadrant, but no hepatosplenomegaly. Laboratory test findings were as follows: white blood cell count 18 000 per mm3 (77% neutrophils; 23% lymphocytes); haemoglobin level, 9.7 g/dL; erythrocyte sedimentation rate, 120 mm/h; glucose, 404 mg/dL; alkaline phosphatase, 424 U/L; gamma glutamyl
transferase, 89 U/L; alanine aminotransferase, 227 U/L; aspartate aminotransferase, 230 U/L; both total and fraction bilirubin levels were normal as was the immunoglobulin level and the result of the coagulation study. Abdominal ultrasound detected minimal hepatomegaly with a hypoechoic lesion located in the right hepatic lobe that was compatible with a liver abscess. Ultrasound-guided needle aspiration was performed and 30 mL of pus was drained. Empirical treatment with piperacillin/ tazobactan (4/0.5 g IV every 8 h) was instituted. Two days later a culture of the drained pus yielded a heavy growth of L. monocytogenes and so the previously used antibiotics were replaced by ampicillin (12 g/day) and gentamicin (3 mg/kg per day) intravenously for 4 weeks and then oral amoxicillin (1.5 g/day) for 2 weeks. Blood cultures on her admission were negative. The epidemiological history included nothing of particular significance. During the following weeks there was progressive improvement and the patient made a total recovery. A computerized tomography scan of the liver 2 months later showed complete resolution of the lesions and a second globular sedimentation rate was 23 mm/h. Liver involvement in infections due to L. monocytogenes is rare, probably having its origins either in a primary bacteremia then spreading to different organs or through the portal system
Table 1 Summary of data from cases of L. monocytogenes infection of the liver Patient no. [Reference]
Patient Age/Sex
1 [PR]
58/F
2 [4]
73/F
3 [8]
66/M
4 [9]
56/F
5 [10] 6 [11] 7 [12] 8 [13] 9 [14] 10 [15] 11 [16] 12 [17] 13 [18] 14 [5]
77/F 22/F 38/M 70/F 51/M 55/M 59/F 81/M 67/F 67/M
15 [6] 16 [7]
55/M 28/F
Method of diagnosis
Liver function test
Treatment
Outcome
Ultrasound-guided needle aspiration Ultrasound-guided needle aspiration Blood cultures
SGOT,SGPT,gGT,AP
Ampicillin and gentamicin
Survived
Normal
Ampicillin and gentamicin; amoxicillin Penicillin and gentamicin; penicillin; amoxicillin Ampicillin and gentamicin
Survived
Ampicillin and gentamicin NA Penicillin; oxytetracycline Ampicillin Ampicillin Cefoxitin and clindamicin Penicillin and streptomycin Ampicillin Penicillin Cefazolin and gentamicin; ampicillin/sulbactam Ceftriaxone; ceftazidime Cefuroxime and metronidazole; amplicillin and netilmicin
Survived Died Died Died Died Died Died Survived Died Survived
Ultrasound-guided needle aspiration NA NA Blood and CSF cultures Blood and CSF cultures Blood and CSF cultures Blood cultures CSF culture NA Blood cultures Laparotomy Blood cultures Blood and vaginal swabs cultures
NA NA NA NA NA NA NA SGOT NA NA NA gGT,AP SGOT,SGPT,gGT,AP Normal
Survived Survived
Died Survived
PR, present report; NA, data not available.
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases
Correspondence
after enteric colonization. Table 1 summarizes previous cases of L. monocytogenes infection of the liver. Three patterns of liver infection have been described: solitary liver abscess, multiple liver abscesses and acute hepatitis. Our case, as with those previously reported, corresponds to a patient whose only known risk factor was diabetes mellitus and who presented with a solitary liver abscess with neither associated bacteremia nor meningitis. The outcome was completely favourable after surgical drainage and antibiotic treatment with ampicillin and gentamicin. On the other hand, in the cases of liver involvement with multiple abscesses, the clinician may need to exercise more caution since the outcome involves increased morbidity and mortality. M. D. Lo´pez-Prieto*, A. I. Aller Garcı´a, S. Alcaraz Garcı´a and J. Lo´pez Cepero, *S. Microbiologı´a and S. Medicina Interna, Hospital del S.A.S. de Jerez de la Frontera, Ctra de Circunvalacio´n s/n, Je´rez de la Frontera, 11407 Ca´diz, Spain Tel: +34 956 358036 Fax: +34 956 358041
REFERENCES 1. Nieman RE, Loeber B. Listeriosis in adults: a changing pattern. Report of eight cases and review of the literature. 1968–78. Clin Infect Dis 1980; 2: 207–27. 2. Vega T, Echevarrı´a S, Crespo J, Artinano E, San Miguel G, Romero P. Acute hepatitis by Listeria monocytogenes in an HIV patient with chronic HBV hepatitis. J Clin Gastroenterol 1992; 15: 251–5. 3. Bourgeois N, Jacob F, Tavares ML et al. Listeria monocytogenes hepatitis in a liver trasplant recipient: a case report and review of the literature. J Hepatol 1993; 18: 284–9. 4. Braun TI, Travis D, Dee RR, Nieman RE. Liver abscess due to Listeria monocytogenes: case report and review. Clin Infect Dis 1993; 17: 267–9. 5. Manian FA. Liver abscess due to Listeria monocytogenes. Clin Infect Dis 1994; 18: 841–2. 6. Maggioni MP, Preatoni A, Cantoni A, Invernizzi F. Liver abscesses due to Listeria monocytogenes. Liver 1996; 16: 67–9. 7. Lindgren P, Pla JC, Hogberg U, Tarnvik A. Listeria monocytogenesinduced liver abscess in pregnancy. Acta Obstet Gynecol Scand 1997; 76: 486–8. 8. Al-Dajani O, Khatib R. Cryptogenic liver abcess due to Listeria monocytogenes. J Infect Dis 1983; 147: 961. 9. Ribiere O, Cotarel P, Jarlier V et al. Abces du foie a Listeria monocytogenes: chez una malade diabetique. Presse Med 1990; 19: 1538–40. 10. Herreman G, Jaisson B, Quignodon JF, Mundler B, De La Fontaine P. Abces du foie a Listeria monocytogenes: chez una malade diabetique [letter]. Presse Med 1990; 20: 479. 11. Simpson JF, Leddy JP, Hare JD. Listeriosis complicating lym-
12.
13. 14.
15.
16. 17. 18.
227
phoma: report of four cases and interpretative review of pathogenic factors. Am J Med 1967; 42: 39–49. Niklasson PM, Hambraeus A, Lungren G, Magnuson G, Sundelin P, Groth CG. Listeria encephalitis in five renal transplant recepients. Acta Med Scand 1978; 203: 181–5. Scully RE, Galdabini JJ, McNeely BU. Case records of the Massachusetts General Hospital. N Engl J Med 1978; 299: 819–26. Stamm AM, Dismukes WE, Simmons BP et al. Listeriosis in renal transplant recipients: report of an outbreak and review of 102 cases. Clin Infec Dis 1982; 4: 665–82. Yu VL, Miller WP, Wing EJ, Romano JM, Ruiz CA, Bruns FJ. Disseminated listeriosis presenting as acute hepatitis: case reports and review of hapatic involvement in listeriosis. Am J Med 1982; 72: 773–7. Henderson JR, Ramsey CA. Military granulomata in a fatal adult case of listerial meningitis. Postgr Med J 1967; 43: 794–6. Jenkins D, Richards JE, Rees Y, Wicks CB. Multiple listerial liver abscesses. Gut 1987; 28: 1661–2. Gebauer K, Hall JC, Donlon JB, Herrmann R, Rofe S, Platell C. Hepatic involvement in listeriosis. Aust N Z J Med 1989; 19: 486– 7.
Isolation of verotoxigenic strains of Escherichia coli O26 in Poland Verocytotoxin-producing strains of Escherichia coli (VTEC) are causes of diarrheal illness and hemolytic uremic syndrome in humans. The most common serotype of VTEC is E. coli O157:H7, which does not ferment sorbitol and does not produce b-glucuronidase, in contrast to other E. coli strains. In this study we searched for VTEC strains in 359 unselected stool samples routinely submitted for culture to the Department of Microbiology of the Medical University. Stool samples were obtained from patients with diarrhea or gastroenteritis (175 adults and 184 children). All specimens were cultured for enteric pathogens by established bacteriologic techniques. From each sample, about 20 separate colonies, presumed on the basis of lactose fermentation and colony morphologic features to be E. coli, were picked from MacConkey agar plates and subcultured on sorbitol–MacConkey agar in order to isolate E. coli O157: H7 [1,2]. The same colonies were plated on tryptone– soya agar supplemented with 5% sheep erythrocytes washed three times in phosphate-buffered saline (PBS) in order to isolate enterohemolysin-producing strains of VTEC, and on tryptone–soya agar supplemented with unwashed sheep erythrocytes for detection of other hemolysins [3]. Since most verocytotoxin-producing E. coli strains show a lack of b-glucuronidase activity, all the examined isolates were tested in a rapid fluorogenic assay in accordance with Thompson et al [4]. This assay used 4-methylumbelliferyl-glucuronide (MUG) as an indicator, which is hydrolyzed to a fluorogenic product by the enzyme b-glucuronidase. The test reaction was performed in a microdilution 96-well U plate. Fifty microliters of MUG reagent was dispensed to wells, and a loopful of pure isolate was emulsified into MUG to produce a milky suspension. The
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
228
Clinical Microbiology and Infection, Volume 6 Number 4, April 2000
MUG reactions were read after 20 min of incubation at 37 °C by using a long-wave UV lamp in a darkened room. A positive reaction was indicated by blue fluorescence. Among 7180 strains isolated from 359 stool samples, we did not find sorbitol-negative strains of E. coli O157:H7, and all the isolates were MUG positive. One hundred and twenty-one isolates were hemolysin-producing: 119 (98.3%) of them were a- and/or b-hemolysin-producing, and two (1.6%) strains were enterohemolysin-producing (small and turbid zone of hemolysis detectable after 24 h of incubation on tryptone–soya agar with washed erythrocytes). The two enterohemolysin-producing strains were identified as E. coli by standard biochemical tests IDGN 32 (bioMerieux S.A., Marcy L’Etoile, France) and they were serotyped using antisera for E. coli somatic antigens for serogroups A, B, C and for E. coli O157. The two strains belonged to the E. coli O26 serogroup (we did not identify flagellar antigens). We have received from our laboratory two other strains of E. coli O26 isolated from other patients with diarrhea. Neither of these strains was a hemolysin producer, and they were both sorbitol positive. The four strains of E. coli O26 were further investigated for verocytotoxicity and the presence of verotoxin genes [5,6]. For production of verocytotoxins, bacteria were grown for 24 h in tryptone–soya broth, and, after overnight incubation at 37 °C, the broth cultures were centrifuged for 15 min at 1400 g and supernatants were assayed on cell lines. Vero and HeLa cells were grown in RPMI medium with glutamine supplemented with 5% heat-inactivated bovine serum and 100 mL of gentamicin sulfate per mL. Confluent monolayers were removed with trypsin–EDTA, washed in RPMI medium (100 g for 10 min) and suspended to 4 × 105 cells/mL in RPMI medium. A 100-mL volume of Vero and HeLa cells was pipetted into each well of 96-well microdilution plates (NUNC A/S) and 10 mL of toxin preparation was added. Each sample was tested in duplicate. Plates were incubated in 5% CO2 at 37 °C for 72 h. Monolayers were checked daily for cytotoxic activity with an inverted microscope. For detection of VT1, VT2 and eae sequences by PCR [6], 20 mL of bacteria broth culture was added to 1 mL of saline, centrifuged and suspended in 1 mL of distilled, sterile water. After incubation at 96–98 °C for 7 min and centrifugation, the supernatant was used in the PCR reaction. Base sequences
Table 1 Primers used in PCR to amplify specific fragments from genes for VT1, VT2, and eae
and sizes of amplified products for the specific oligonucleotide primers used in the study are shown in Table 1. Amplification of bacterial DNA was performed using 28-mL volumes containing 5 mL of the prepared supernatant sample, 0.7 mM of each oligonucleotide primer, 200 mM of each dNTP, PCR buffer at a final concentration of 1.5 mM MgCl2 and 2 mL of shark polymerase (1 U). All used PCR reagents were produced by Gdan´sk (Poland). The amplification was performed in a thermal cycler (PCT—150 Mini Cycler, MJ Research, Inc., Watertown, Massachusetts, USA) at 96 °C for 4 min, followed by 30 cycles at 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 7 min. The amplified product was visualized by standard submarine gel electrophoresis. Amplified DNA fragments of specific sizes were located by UV fluorescence after staining with ethidium bromide. A molecular size marker (pUC 10/Mspl) was included in each gel. PCR analysis showed that the four examined E. coli O26 strains carried VT2 and eae genes. Two of these strains (enterohemolysin-producing) were found to be toxic for Vero and HeLa cell lines after 24 h. Two other strains of E. coli O26 which did not produce the enterohemolysin did not show cytotoxicity for cell lines. All the E. coli O26 strains were isolated from children with diarrhea (2 and 7 months, and two 1-year-old children) housed in the no. 2 Wroclaw university hospital. The diarrhea was without gross blood, and none of the children developed hemolytic uremic syndrome. After a few days, the children recovered. In our study, we did not show the presence of sorbitolnegative E. coli O157 strains in 359 stool samples examined. Since VTEC is characterized by its seasonal pattern, with a peak from June through September [7], it is probable that this was a reason why we did not find sorbitol-negative strains of E. coli O157, as we examined stool samples from October 1997 through May 1998. On the other hand, there are reports of sorbitol-positive E. coli O157 strains isolated in Germany [8]. Geographic location and frequent migration of people between Poland and Germany make it probable that sorbitol-positive strains of E. coli O157 exist in Poland. In such cases, sorbitol– MacConkey agar appeared to be insufficient for detection of these strains. The detection of enterohemolysin production could be helpful in such cases, but not all VTEC strains produce enterohemolysins. Surprisingly, although all the examined E.
Primer
Oligonucleotide sequences (5?–3?)
VT1a VT1b VT2a VT2b eae-1 eae-2
GAAGAGTCCGTGGGATTACG AGCGATGCAGCTATTAATAA TACACAGGAGCAGTTTCAGACAGT ACCGTTTTTCAGATTTT(AG)CACATA CACACGAATAAACTGACTAAAATG AAAAACGCTGACCCGCACCTAAAT
Size of amplified products (bp)
130 298 376
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
Correspondence
coli O26 strains harbored VTs genes, two of them were not cytotoxic for Vero and HeLa cell lines. Perhaps both strains elaborate very low quantities of verotoxins, or verotoxin genes were not expressed under the laboratory conditions of growth. The results of this study showed the presence of verocytotoxin-producing strains of E. coli O26 in Poland; nevertheless, further studies are needed to determine the presence of sorbitol-positive and sorbitol-negative VTEC strains. B. M. Sobieszczan˜ska*, R. Gryko and C. W. Malek *Department of Microbiology, University of Medicine, 4 Chalubin˜skiego Street, 50–368 Wroclaw, Poland Tel: +48 71 3209707 Fax: +48 71 3480098 E-mail: [email protected]
REFERENCES 1. Pierard D, Stevens D, Morian L, Lior H, Lauwers S. Isolation and virulence factors of verotoxin-producing Escherichia coli in human stool samples. Clin Microbiol Infect 1997; 3: 531–40. 2. Ritchie M, Partington S, Jessop J, Kelly M. Comparison of a direct fecal Shiga-like toxin assay and sorbitol MacConkey agar culture for laboratory diagnosis of enterohemorrhagic Escherichia coli infection. J Clin Microbiol 1992; 30: 461–4. 3. Beutin L, Montenegro M, O šrskov I et al. Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol 1989; 27: 2559– 64. 4. Thompson J, Hodge D, Borczyk A. Rapid biochemical test to identify verocytotoxin-positive strains of Escherichia coli serotypes O157. J Clin Microbiol 1990; 28: 2165–8. 5. Konowalchuk J, Speirs J, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immun 1977; 18: 775–9. 6. Lingvist R. Preparation of PCR samples from food by a rapid and single centrifugation technique evaluated by detection of Escherichia coli O157:H7. Int J Food Microbiol 1997; 37: 73–82. 7. Chinyu S, Brandt L. Escherichia coli O157:H7 infection in humans. Ann Intern Med 1995; 123: 698–714. 8. Coia J. Clinical, microbiological and epidemiological aspects of Escherichia coli O157 infection. FEMS Immunol Med Microbiol 1998; 20: 1–9.
High frequency of reduced susceptibility to penicillin in serogroup 29E meningococci Penicillin remains one of the most widely used therapies for treating meningococcal disease. Neisseria meningitidis was extremely susceptible to penicillin. However in the last decades meningococcal isolates with decreased susceptibility to penicillin have been reported in several countries [1,2]. Minimum inhibitory concentrations (MICs) for moderately resistant isolates are 2- to 20-fold higher than those of fully susceptible ones
229
Table 1 Distribution of meningoccal strains by serogroup
First survey Second survey
B
C
W-135 Y
Z
X
29E
Ng*
519 273
89 33
– 2
7 3
7 5
6 17
154 106
7 6
*Strains which could not be included in any group.
(− 0.12 mg/L). Two meningococcal carrier surveys were made in Galicia (Spain) between 1996 and 1998 [3]. Table 1 shows the distribution by serogroups of the meningococci isolated from those studies. The susceptibility to penicillin of the meningococcal carrier strains was determined. We used the agar dilution method, in Mueller Hinton agar (Difco Laboratories, Detroit, MI, USA), with a final inoculum of 105 CFU. The MICs doubling dilution range tested was 0.007–2 mg/L. Cultures were incubated for 24 h at 37 °C under a 5% carbon dioxide atmosphere. The plates were read manually and the MIC was defined as the lowest concentration at which no growth was visible on the agar plates. The highest proportion of meningococci that were moderately resistant to penicillin was found among serogroup 29E meningococcal strains. In the first survey 83% of 29E serogroup isolates showed MIC − 0.12 mg/L, and 64% in the second study. The proportion of meningococci with this pattern of susceptibility to penicillin (MIC − 0.12 mg/L) among the others serogroups ranged betweeen 0% (serogroups X and Y) and 64% (serogroup C) in the first survey and between 0% (serogroup Y) and 51% (serogroup C) in the second study (Data not shown). This higher proportion of moderate resistance to penicillin in the strains of 29E serogroup might be due to a clonal spread of resistant isolates. In species with a significant level of recombination, such as Neisseria, it is important to be careful in using traditional markers, such as serogroup or antibiotic resistance, when trying to determine how the resistance has spread. However this distinction can be achieved using methods such as pulsed field gel electrophoresis (PFGE), ribotyping or multilocus enzyme electrophoresis, as these are able to determine relatedness between isolates [4]. In order to index the overall relationships between N. meningitidis 29E isolates the chromosomal DNA from 20 isolates (14 moderately resistant and six susceptible to penicillin) was digested with BglII and analysed by PFGE according to the conditions described previously [5]. Seventeen different banding patterns were found. Estimates of genetic relationships among serogroup 29E meningococcal strains showed extensive genetic diversity. Strains that are moderately resistant to penicillin were no less diverse than the sensitive isolates. Figure 1 shows the dendrogram obtained from the different profiles
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
230
Clinical Microbiology and Infection, Volume 6 Number 4, April 2000
situation found in the N. meningitidis serogroup 29E would be similar to that found in Neisseria flavescens, and presumably by virtue of differences in amino acid sequence the serogroup 29E meningococci strains naturally would produce low-affinity forms of PBP 2. If this hypothesis is true then 29E meningococcal strains would serve as a reservoir of resistant penA genes. This alternative hypothesis could only be tested by nucleotide sequence analysis of the genes involved in resistance to penicillin.
ACKNOWLEDGMENTS This study was partly supported by the Direccio´n Xeral de Sau´de Pu´blica (Xunta de Galicia). We are grateful to the staff working on the carrier surveys, particularly to Socorro Ferna´ndez, Xurxo Hervada and Alberto Malvar. L. Arreaza is a fellow of the Instituto Carlos III. L. Arreaza and J. A. Va´zquez* *Servicio de Bacteriologı´a, Centro Nacional de Microbiologı´a, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain Tel: 34 1 5097901 Fax: 34 1 5097966 E-mail: [email protected] Figure 1 Dendrogram of genetic relationship among 20 serogroup 29E meningococcal strains with different susceptibility patterns to penicillin (S: CMI ¾ 0.06 mg/L; R: CMI − 0.12 mg/L). The number of strains in each pattern is indicated in brackets.
using UPGMA (unweighted pair-group mean average). On this basis we can disregard the clonal spread hypothesis as an explanation for the high proportion of moderate resistance to penicillin in 29E meningococcal strains. Neisseria meningitidis isolates that are moderately resistant to penicillin show the expression of PBP 2 (encoded by the penA gene) variants with low affinity for penicillin [6]. Meningococcal colonization may persist for several weeks to several months, but this time-period differs for meningoccoci strains of different serogroups [7]. The serogroup 29E meningoccocci might persist in the nasopharynx for longer than other serogroups and then it might have more opportunities to exchange DNA with related species such as commensal Neisseria species (horizontal spread of resistance genes). Most investigations of N. meningitidis strains that are moderately resistant to penicillin have been carried out with serogroup isolates which most commonly produce meningococcal disease [8], and for this reason it is possible to think that the
REFERENCES 1. Sa´ez-Nieto JA, Fontanals D, Garcia de Jalon J et al. Isolation of Neisseria meningitidis strains with increase of penicillin minimal inhibitory concentrations. Epidemiol Infect 1987; 99: 463–9. 2. Sutcliffe EM, Jones DM, El-Sheikh S, Percival A. Penicillin insensitive meningococci in the UK. Lancet 1988; i: 657–8. 3. Arreaza L, Berro´n S, Go´mez JA et al. High genetic identity between the C.2b: P1.2, 5 meningococcal epidemic strain in Galicia (Spain). Clin Microbiol Infect 1999; 5: 292–3. 4. Caugant DA. Population genetics and molecular epidemiology of Neisseria meningitidis. APMIS 1998; 106: 505–25. 5. Berro´n S, De La Fuente L, Martı´n E, Va´zquez JA. Increasing incidence of meningococcal disease in Spain associated with a new variant of serogroup C. Eur J Clin Microbiol Infect Dis 1998; 17: 85– 9. 6. Spratt BG, Zhang Q-Y, Jones DM, Hutchison A, Brannigan JA, Dowson C. Recruitment of a penicillin-binding protein gene from Neisseria flavescens during the emergence of penicillin resistance in Neisseria meningitidis. Proc Natl Acad Sci USA 1989; 86: 8988–92. 7. Blakebrough IS, Greenwood M, Whitte HC, Broadley AK, Gilles HM. The epidemiology of infections due to Neisseria meningitidis and Neisseria lactamica in a northern Nigerian community. J Infect Dis 1982; 146: 626–37. 8. Medelman PM, Campos J, Chaffin DO, Serfass DA, Smith AL, Sa´ez-Nieto JA. Relative penicillin G resistance in Neisseria meningitidis and reduced affinity of penicillin-binding protein 3. Antimicrob Agents Chemother 1988; 32: 706–9.
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
Correspondence
Low-level resistance to fluoroquinolones among Salmonella and Shigella We have read with interest the recent article by Willke et al. [1] on resistance of Salmonella and Shigella in Turkey. As published by Willke ‘‘there are alarming reports of reduced susceptibility and even resistance of Salmonella strains to quinolones’’. Clinicians and microbiologists have to keep in mind this risk since failures of treatment of typhoid fever with ciprofloxacin have been reported [2,3,4] and particularly with strains that have low-level resistance to fluoroquinolones [5,6]. This paper described Salmonella strains with reduced susceptibility to fluoroquinolones: for example, the MICs of Salmonella typhi to pefloxacin, ofloxacin and ciprofloxacin were 4, 1 and 0.5 mg/L, respectively. It is probably due to a percentage of strains with low-level resistance especially in Salmonella typhi. We are thus interested to know how many strains had lowlevel resistance to fluoroquinolones in this study? The author should provide the distribution of the minimum inhibitory concentrations and the percentage that were nalidixic acidresistant. We strongly suggest that nalidixic acid is tested against all Salmonella isolates to detect this low level of resistance and against isolates from acute shigellosis where nalidixic acid can be used for treatment of children. It is known in Gram-negative bacilli that fluoroquinolone resistance is most frequently a twostage process, with resistance to older quinolones such as nalidixic acid emerging first, conferring higher MICs for the fluoroquinolones, but usually staying within the ‘‘susceptible’’ range. This is followed by further mutations to generate highlevel resistance to the fluoroquinolones. In conclusion, the number of strains with low-level resist-
231
ance to fluoroquinolones is certainly underestimated, since, in the usual susceptibility tests, with the breakpoints presently accepted world-wide, such strains are categorized as susceptible. Strains resistant to nalidixic acid should be reported to the clinician and the MIC of ciprofloxacin measured. J.-C. Nguyen Van* and F. W. Goldstein *Laboratoire de Microbiologie Me´dicale, Fondation Hoˆpital Saint Joseph, 185 rue Raymond Losserand, 75014 Paris, France Tel: +33 1 44 12 34 53 Fax: +33 1 44 12 32 34 E-mail: jean claude nguyen [email protected] REFERENCES 1. Willke A, Arman D, C ¸ okc¸a F et al. Resistance of Salmonella and Shigella. Clin Microbiol Infect 1999; 5: 588–90. 2. Bhatia RS. Typhoid fever not responding to ciprofloxacin therapy. Assoc Physicians India 1992; 40: 705–6. 3. Rowe B, Ward LR, Threlfall EJ. Ciprofloxacin and typhoid fever. Lancet 1992; 339: 740. 4. Umasankar S, Wall RA, Berger J. A case of ciprofloxacin-resistant typhoid fever. Communicable Disease Report. CDR Rev 1992; 2: R139–40. 5. Le Lostec Z, Fegueux S, Jouve P, Boisivon A, Cheron M, Mornet P. Quinolone resistant Salmonella typhi acquired in Europe: a clinical failure of quinolone treatment [abstract 79/P6]. In: Program and Abstracts of the 16th Interdisciplinary Meeting on Anti-Infectious Chemotherapy, Paris: Socie´te´ Franc¸oise de Microbiologie, 1996: 121. 6. Launay O, Nguyen Van JC, Buu-Hoı¨ A, Acar JF. Typhoid fever due to a Salmonella typhi strain of reduced susceptibility to fluoroquinolones. Clin Microbiol Infect 1997; 3: 541–4.
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
Liver abscess due to Listeria monocytogenes Listeria monocytogenes is a facultative intracellular, Gram-positive, motile rod which causes both sporadic disease and outbreaks of food-borne infection in humans. Infections with L. monocytogenes occur most frequently in neonates and in adults with immunosuppression, in pregnancy, advanced age, HIV infection, transplant recipients or diabetes mellitus [1–3]. The most apparent clinical forms present as meningitis and primary bacteremia. Focal nonmeningeal infections are uncommon and very few cases affecting the liver have been reported [4–7]. We present a case of solitary liver abscess due to L. monocytogenes. A 58-year-old, obese woman healthy except for a type II diabetes mellitus was admitted to the hospital with fever and abdominal pain in the right upper quadrant that had been present for 1 week. Physical examination revealed a temperature of 39 °C, pallor and tenderness in the right upper quadrant, but no hepatosplenomegaly. Laboratory test findings were as follows: white blood cell count 18 000 per mm3 (77% neutrophils; 23% lymphocytes); haemoglobin level, 9.7 g/dL; erythrocyte sedimentation rate, 120 mm/h; glucose, 404 mg/dL; alkaline phosphatase, 424 U/L; gamma glutamyl
transferase, 89 U/L; alanine aminotransferase, 227 U/L; aspartate aminotransferase, 230 U/L; both total and fraction bilirubin levels were normal as was the immunoglobulin level and the result of the coagulation study. Abdominal ultrasound detected minimal hepatomegaly with a hypoechoic lesion located in the right hepatic lobe that was compatible with a liver abscess. Ultrasound-guided needle aspiration was performed and 30 mL of pus was drained. Empirical treatment with piperacillin/ tazobactan (4/0.5 g IV every 8 h) was instituted. Two days later a culture of the drained pus yielded a heavy growth of L. monocytogenes and so the previously used antibiotics were replaced by ampicillin (12 g/day) and gentamicin (3 mg/kg per day) intravenously for 4 weeks and then oral amoxicillin (1.5 g/day) for 2 weeks. Blood cultures on her admission were negative. The epidemiological history included nothing of particular significance. During the following weeks there was progressive improvement and the patient made a total recovery. A computerized tomography scan of the liver 2 months later showed complete resolution of the lesions and a second globular sedimentation rate was 23 mm/h. Liver involvement in infections due to L. monocytogenes is rare, probably having its origins either in a primary bacteremia then spreading to different organs or through the portal system
Table 1 Summary of data from cases of L. monocytogenes infection of the liver Patient no. [Reference]
Patient Age/Sex
1 [PR]
58/F
2 [4]
73/F
3 [8]
66/M
4 [9]
56/F
5 [10] 6 [11] 7 [12] 8 [13] 9 [14] 10 [15] 11 [16] 12 [17] 13 [18] 14 [5]
77/F 22/F 38/M 70/F 51/M 55/M 59/F 81/M 67/F 67/M
15 [6] 16 [7]
55/M 28/F
Method of diagnosis
Liver function test
Treatment
Outcome
Ultrasound-guided needle aspiration Ultrasound-guided needle aspiration Blood cultures
SGOT,SGPT,gGT,AP
Ampicillin and gentamicin
Survived
Normal
Ampicillin and gentamicin; amoxicillin Penicillin and gentamicin; penicillin; amoxicillin Ampicillin and gentamicin
Survived
Ampicillin and gentamicin NA Penicillin; oxytetracycline Ampicillin Ampicillin Cefoxitin and clindamicin Penicillin and streptomycin Ampicillin Penicillin Cefazolin and gentamicin; ampicillin/sulbactam Ceftriaxone; ceftazidime Cefuroxime and metronidazole; amplicillin and netilmicin
Survived Died Died Died Died Died Died Survived Died Survived
Ultrasound-guided needle aspiration NA NA Blood and CSF cultures Blood and CSF cultures Blood and CSF cultures Blood cultures CSF culture NA Blood cultures Laparotomy Blood cultures Blood and vaginal swabs cultures
NA NA NA NA NA NA NA SGOT NA NA NA gGT,AP SGOT,SGPT,gGT,AP Normal
Survived Survived
Died Survived
PR, present report; NA, data not available.
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases
Correspondence
after enteric colonization. Table 1 summarizes previous cases of L. monocytogenes infection of the liver. Three patterns of liver infection have been described: solitary liver abscess, multiple liver abscesses and acute hepatitis. Our case, as with those previously reported, corresponds to a patient whose only known risk factor was diabetes mellitus and who presented with a solitary liver abscess with neither associated bacteremia nor meningitis. The outcome was completely favourable after surgical drainage and antibiotic treatment with ampicillin and gentamicin. On the other hand, in the cases of liver involvement with multiple abscesses, the clinician may need to exercise more caution since the outcome involves increased morbidity and mortality. M. D. Lo´pez-Prieto*, A. I. Aller Garcı´a, S. Alcaraz Garcı´a and J. Lo´pez Cepero, *S. Microbiologı´a and S. Medicina Interna, Hospital del S.A.S. de Jerez de la Frontera, Ctra de Circunvalacio´n s/n, Je´rez de la Frontera, 11407 Ca´diz, Spain Tel: +34 956 358036 Fax: +34 956 358041
REFERENCES 1. Nieman RE, Loeber B. Listeriosis in adults: a changing pattern. Report of eight cases and review of the literature. 1968–78. Clin Infect Dis 1980; 2: 207–27. 2. Vega T, Echevarrı´a S, Crespo J, Artinano E, San Miguel G, Romero P. Acute hepatitis by Listeria monocytogenes in an HIV patient with chronic HBV hepatitis. J Clin Gastroenterol 1992; 15: 251–5. 3. Bourgeois N, Jacob F, Tavares ML et al. Listeria monocytogenes hepatitis in a liver trasplant recipient: a case report and review of the literature. J Hepatol 1993; 18: 284–9. 4. Braun TI, Travis D, Dee RR, Nieman RE. Liver abscess due to Listeria monocytogenes: case report and review. Clin Infect Dis 1993; 17: 267–9. 5. Manian FA. Liver abscess due to Listeria monocytogenes. Clin Infect Dis 1994; 18: 841–2. 6. Maggioni MP, Preatoni A, Cantoni A, Invernizzi F. Liver abscesses due to Listeria monocytogenes. Liver 1996; 16: 67–9. 7. Lindgren P, Pla JC, Hogberg U, Tarnvik A. Listeria monocytogenesinduced liver abscess in pregnancy. Acta Obstet Gynecol Scand 1997; 76: 486–8. 8. Al-Dajani O, Khatib R. Cryptogenic liver abcess due to Listeria monocytogenes. J Infect Dis 1983; 147: 961. 9. Ribiere O, Cotarel P, Jarlier V et al. Abces du foie a Listeria monocytogenes: chez una malade diabetique. Presse Med 1990; 19: 1538–40. 10. Herreman G, Jaisson B, Quignodon JF, Mundler B, De La Fontaine P. Abces du foie a Listeria monocytogenes: chez una malade diabetique [letter]. Presse Med 1990; 20: 479. 11. Simpson JF, Leddy JP, Hare JD. Listeriosis complicating lym-
12.
13. 14.
15.
16. 17. 18.
227
phoma: report of four cases and interpretative review of pathogenic factors. Am J Med 1967; 42: 39–49. Niklasson PM, Hambraeus A, Lungren G, Magnuson G, Sundelin P, Groth CG. Listeria encephalitis in five renal transplant recepients. Acta Med Scand 1978; 203: 181–5. Scully RE, Galdabini JJ, McNeely BU. Case records of the Massachusetts General Hospital. N Engl J Med 1978; 299: 819–26. Stamm AM, Dismukes WE, Simmons BP et al. Listeriosis in renal transplant recipients: report of an outbreak and review of 102 cases. Clin Infec Dis 1982; 4: 665–82. Yu VL, Miller WP, Wing EJ, Romano JM, Ruiz CA, Bruns FJ. Disseminated listeriosis presenting as acute hepatitis: case reports and review of hapatic involvement in listeriosis. Am J Med 1982; 72: 773–7. Henderson JR, Ramsey CA. Military granulomata in a fatal adult case of listerial meningitis. Postgr Med J 1967; 43: 794–6. Jenkins D, Richards JE, Rees Y, Wicks CB. Multiple listerial liver abscesses. Gut 1987; 28: 1661–2. Gebauer K, Hall JC, Donlon JB, Herrmann R, Rofe S, Platell C. Hepatic involvement in listeriosis. Aust N Z J Med 1989; 19: 486– 7.
Isolation of verotoxigenic strains of Escherichia coli O26 in Poland Verocytotoxin-producing strains of Escherichia coli (VTEC) are causes of diarrheal illness and hemolytic uremic syndrome in humans. The most common serotype of VTEC is E. coli O157:H7, which does not ferment sorbitol and does not produce b-glucuronidase, in contrast to other E. coli strains. In this study we searched for VTEC strains in 359 unselected stool samples routinely submitted for culture to the Department of Microbiology of the Medical University. Stool samples were obtained from patients with diarrhea or gastroenteritis (175 adults and 184 children). All specimens were cultured for enteric pathogens by established bacteriologic techniques. From each sample, about 20 separate colonies, presumed on the basis of lactose fermentation and colony morphologic features to be E. coli, were picked from MacConkey agar plates and subcultured on sorbitol–MacConkey agar in order to isolate E. coli O157: H7 [1,2]. The same colonies were plated on tryptone– soya agar supplemented with 5% sheep erythrocytes washed three times in phosphate-buffered saline (PBS) in order to isolate enterohemolysin-producing strains of VTEC, and on tryptone–soya agar supplemented with unwashed sheep erythrocytes for detection of other hemolysins [3]. Since most verocytotoxin-producing E. coli strains show a lack of b-glucuronidase activity, all the examined isolates were tested in a rapid fluorogenic assay in accordance with Thompson et al [4]. This assay used 4-methylumbelliferyl-glucuronide (MUG) as an indicator, which is hydrolyzed to a fluorogenic product by the enzyme b-glucuronidase. The test reaction was performed in a microdilution 96-well U plate. Fifty microliters of MUG reagent was dispensed to wells, and a loopful of pure isolate was emulsified into MUG to produce a milky suspension. The
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
228
Clinical Microbiology and Infection, Volume 6 Number 4, April 2000
MUG reactions were read after 20 min of incubation at 37 °C by using a long-wave UV lamp in a darkened room. A positive reaction was indicated by blue fluorescence. Among 7180 strains isolated from 359 stool samples, we did not find sorbitol-negative strains of E. coli O157:H7, and all the isolates were MUG positive. One hundred and twenty-one isolates were hemolysin-producing: 119 (98.3%) of them were a- and/or b-hemolysin-producing, and two (1.6%) strains were enterohemolysin-producing (small and turbid zone of hemolysis detectable after 24 h of incubation on tryptone–soya agar with washed erythrocytes). The two enterohemolysin-producing strains were identified as E. coli by standard biochemical tests IDGN 32 (bioMerieux S.A., Marcy L’Etoile, France) and they were serotyped using antisera for E. coli somatic antigens for serogroups A, B, C and for E. coli O157. The two strains belonged to the E. coli O26 serogroup (we did not identify flagellar antigens). We have received from our laboratory two other strains of E. coli O26 isolated from other patients with diarrhea. Neither of these strains was a hemolysin producer, and they were both sorbitol positive. The four strains of E. coli O26 were further investigated for verocytotoxicity and the presence of verotoxin genes [5,6]. For production of verocytotoxins, bacteria were grown for 24 h in tryptone–soya broth, and, after overnight incubation at 37 °C, the broth cultures were centrifuged for 15 min at 1400 g and supernatants were assayed on cell lines. Vero and HeLa cells were grown in RPMI medium with glutamine supplemented with 5% heat-inactivated bovine serum and 100 mL of gentamicin sulfate per mL. Confluent monolayers were removed with trypsin–EDTA, washed in RPMI medium (100 g for 10 min) and suspended to 4 × 105 cells/mL in RPMI medium. A 100-mL volume of Vero and HeLa cells was pipetted into each well of 96-well microdilution plates (NUNC A/S) and 10 mL of toxin preparation was added. Each sample was tested in duplicate. Plates were incubated in 5% CO2 at 37 °C for 72 h. Monolayers were checked daily for cytotoxic activity with an inverted microscope. For detection of VT1, VT2 and eae sequences by PCR [6], 20 mL of bacteria broth culture was added to 1 mL of saline, centrifuged and suspended in 1 mL of distilled, sterile water. After incubation at 96–98 °C for 7 min and centrifugation, the supernatant was used in the PCR reaction. Base sequences
Table 1 Primers used in PCR to amplify specific fragments from genes for VT1, VT2, and eae
and sizes of amplified products for the specific oligonucleotide primers used in the study are shown in Table 1. Amplification of bacterial DNA was performed using 28-mL volumes containing 5 mL of the prepared supernatant sample, 0.7 mM of each oligonucleotide primer, 200 mM of each dNTP, PCR buffer at a final concentration of 1.5 mM MgCl2 and 2 mL of shark polymerase (1 U). All used PCR reagents were produced by Gdan´sk (Poland). The amplification was performed in a thermal cycler (PCT—150 Mini Cycler, MJ Research, Inc., Watertown, Massachusetts, USA) at 96 °C for 4 min, followed by 30 cycles at 94 °C for 20 s, 55 °C for 20 s, and 72 °C for 7 min. The amplified product was visualized by standard submarine gel electrophoresis. Amplified DNA fragments of specific sizes were located by UV fluorescence after staining with ethidium bromide. A molecular size marker (pUC 10/Mspl) was included in each gel. PCR analysis showed that the four examined E. coli O26 strains carried VT2 and eae genes. Two of these strains (enterohemolysin-producing) were found to be toxic for Vero and HeLa cell lines after 24 h. Two other strains of E. coli O26 which did not produce the enterohemolysin did not show cytotoxicity for cell lines. All the E. coli O26 strains were isolated from children with diarrhea (2 and 7 months, and two 1-year-old children) housed in the no. 2 Wroclaw university hospital. The diarrhea was without gross blood, and none of the children developed hemolytic uremic syndrome. After a few days, the children recovered. In our study, we did not show the presence of sorbitolnegative E. coli O157 strains in 359 stool samples examined. Since VTEC is characterized by its seasonal pattern, with a peak from June through September [7], it is probable that this was a reason why we did not find sorbitol-negative strains of E. coli O157, as we examined stool samples from October 1997 through May 1998. On the other hand, there are reports of sorbitol-positive E. coli O157 strains isolated in Germany [8]. Geographic location and frequent migration of people between Poland and Germany make it probable that sorbitol-positive strains of E. coli O157 exist in Poland. In such cases, sorbitol– MacConkey agar appeared to be insufficient for detection of these strains. The detection of enterohemolysin production could be helpful in such cases, but not all VTEC strains produce enterohemolysins. Surprisingly, although all the examined E.
Primer
Oligonucleotide sequences (5?–3?)
VT1a VT1b VT2a VT2b eae-1 eae-2
GAAGAGTCCGTGGGATTACG AGCGATGCAGCTATTAATAA TACACAGGAGCAGTTTCAGACAGT ACCGTTTTTCAGATTTT(AG)CACATA CACACGAATAAACTGACTAAAATG AAAAACGCTGACCCGCACCTAAAT
Size of amplified products (bp)
130 298 376
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
Correspondence
coli O26 strains harbored VTs genes, two of them were not cytotoxic for Vero and HeLa cell lines. Perhaps both strains elaborate very low quantities of verotoxins, or verotoxin genes were not expressed under the laboratory conditions of growth. The results of this study showed the presence of verocytotoxin-producing strains of E. coli O26 in Poland; nevertheless, further studies are needed to determine the presence of sorbitol-positive and sorbitol-negative VTEC strains. B. M. Sobieszczan˜ska*, R. Gryko and C. W. Malek *Department of Microbiology, University of Medicine, 4 Chalubin˜skiego Street, 50–368 Wroclaw, Poland Tel: +48 71 3209707 Fax: +48 71 3480098 E-mail: [email protected]
REFERENCES 1. Pierard D, Stevens D, Morian L, Lior H, Lauwers S. Isolation and virulence factors of verotoxin-producing Escherichia coli in human stool samples. Clin Microbiol Infect 1997; 3: 531–40. 2. Ritchie M, Partington S, Jessop J, Kelly M. Comparison of a direct fecal Shiga-like toxin assay and sorbitol MacConkey agar culture for laboratory diagnosis of enterohemorrhagic Escherichia coli infection. J Clin Microbiol 1992; 30: 461–4. 3. Beutin L, Montenegro M, O šrskov I et al. Close association of verotoxin (Shiga-like toxin) production with enterohemolysin production in strains of Escherichia coli. J Clin Microbiol 1989; 27: 2559– 64. 4. Thompson J, Hodge D, Borczyk A. Rapid biochemical test to identify verocytotoxin-positive strains of Escherichia coli serotypes O157. J Clin Microbiol 1990; 28: 2165–8. 5. Konowalchuk J, Speirs J, Stavric S. Vero response to a cytotoxin of Escherichia coli. Infect Immun 1977; 18: 775–9. 6. Lingvist R. Preparation of PCR samples from food by a rapid and single centrifugation technique evaluated by detection of Escherichia coli O157:H7. Int J Food Microbiol 1997; 37: 73–82. 7. Chinyu S, Brandt L. Escherichia coli O157:H7 infection in humans. Ann Intern Med 1995; 123: 698–714. 8. Coia J. Clinical, microbiological and epidemiological aspects of Escherichia coli O157 infection. FEMS Immunol Med Microbiol 1998; 20: 1–9.
High frequency of reduced susceptibility to penicillin in serogroup 29E meningococci Penicillin remains one of the most widely used therapies for treating meningococcal disease. Neisseria meningitidis was extremely susceptible to penicillin. However in the last decades meningococcal isolates with decreased susceptibility to penicillin have been reported in several countries [1,2]. Minimum inhibitory concentrations (MICs) for moderately resistant isolates are 2- to 20-fold higher than those of fully susceptible ones
229
Table 1 Distribution of meningoccal strains by serogroup
First survey Second survey
B
C
W-135 Y
Z
X
29E
Ng*
519 273
89 33
– 2
7 3
7 5
6 17
154 106
7 6
*Strains which could not be included in any group.
(− 0.12 mg/L). Two meningococcal carrier surveys were made in Galicia (Spain) between 1996 and 1998 [3]. Table 1 shows the distribution by serogroups of the meningococci isolated from those studies. The susceptibility to penicillin of the meningococcal carrier strains was determined. We used the agar dilution method, in Mueller Hinton agar (Difco Laboratories, Detroit, MI, USA), with a final inoculum of 105 CFU. The MICs doubling dilution range tested was 0.007–2 mg/L. Cultures were incubated for 24 h at 37 °C under a 5% carbon dioxide atmosphere. The plates were read manually and the MIC was defined as the lowest concentration at which no growth was visible on the agar plates. The highest proportion of meningococci that were moderately resistant to penicillin was found among serogroup 29E meningococcal strains. In the first survey 83% of 29E serogroup isolates showed MIC − 0.12 mg/L, and 64% in the second study. The proportion of meningococci with this pattern of susceptibility to penicillin (MIC − 0.12 mg/L) among the others serogroups ranged betweeen 0% (serogroups X and Y) and 64% (serogroup C) in the first survey and between 0% (serogroup Y) and 51% (serogroup C) in the second study (Data not shown). This higher proportion of moderate resistance to penicillin in the strains of 29E serogroup might be due to a clonal spread of resistant isolates. In species with a significant level of recombination, such as Neisseria, it is important to be careful in using traditional markers, such as serogroup or antibiotic resistance, when trying to determine how the resistance has spread. However this distinction can be achieved using methods such as pulsed field gel electrophoresis (PFGE), ribotyping or multilocus enzyme electrophoresis, as these are able to determine relatedness between isolates [4]. In order to index the overall relationships between N. meningitidis 29E isolates the chromosomal DNA from 20 isolates (14 moderately resistant and six susceptible to penicillin) was digested with BglII and analysed by PFGE according to the conditions described previously [5]. Seventeen different banding patterns were found. Estimates of genetic relationships among serogroup 29E meningococcal strains showed extensive genetic diversity. Strains that are moderately resistant to penicillin were no less diverse than the sensitive isolates. Figure 1 shows the dendrogram obtained from the different profiles
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
230
Clinical Microbiology and Infection, Volume 6 Number 4, April 2000
situation found in the N. meningitidis serogroup 29E would be similar to that found in Neisseria flavescens, and presumably by virtue of differences in amino acid sequence the serogroup 29E meningococci strains naturally would produce low-affinity forms of PBP 2. If this hypothesis is true then 29E meningococcal strains would serve as a reservoir of resistant penA genes. This alternative hypothesis could only be tested by nucleotide sequence analysis of the genes involved in resistance to penicillin.
ACKNOWLEDGMENTS This study was partly supported by the Direccio´n Xeral de Sau´de Pu´blica (Xunta de Galicia). We are grateful to the staff working on the carrier surveys, particularly to Socorro Ferna´ndez, Xurxo Hervada and Alberto Malvar. L. Arreaza is a fellow of the Instituto Carlos III. L. Arreaza and J. A. Va´zquez* *Servicio de Bacteriologı´a, Centro Nacional de Microbiologı´a, Instituto de Salud Carlos III, 28220 Majadahonda, Madrid, Spain Tel: 34 1 5097901 Fax: 34 1 5097966 E-mail: [email protected] Figure 1 Dendrogram of genetic relationship among 20 serogroup 29E meningococcal strains with different susceptibility patterns to penicillin (S: CMI ¾ 0.06 mg/L; R: CMI − 0.12 mg/L). The number of strains in each pattern is indicated in brackets.
using UPGMA (unweighted pair-group mean average). On this basis we can disregard the clonal spread hypothesis as an explanation for the high proportion of moderate resistance to penicillin in 29E meningococcal strains. Neisseria meningitidis isolates that are moderately resistant to penicillin show the expression of PBP 2 (encoded by the penA gene) variants with low affinity for penicillin [6]. Meningococcal colonization may persist for several weeks to several months, but this time-period differs for meningoccoci strains of different serogroups [7]. The serogroup 29E meningoccocci might persist in the nasopharynx for longer than other serogroups and then it might have more opportunities to exchange DNA with related species such as commensal Neisseria species (horizontal spread of resistance genes). Most investigations of N. meningitidis strains that are moderately resistant to penicillin have been carried out with serogroup isolates which most commonly produce meningococcal disease [8], and for this reason it is possible to think that the
REFERENCES 1. Sa´ez-Nieto JA, Fontanals D, Garcia de Jalon J et al. Isolation of Neisseria meningitidis strains with increase of penicillin minimal inhibitory concentrations. Epidemiol Infect 1987; 99: 463–9. 2. Sutcliffe EM, Jones DM, El-Sheikh S, Percival A. Penicillin insensitive meningococci in the UK. Lancet 1988; i: 657–8. 3. Arreaza L, Berro´n S, Go´mez JA et al. High genetic identity between the C.2b: P1.2, 5 meningococcal epidemic strain in Galicia (Spain). Clin Microbiol Infect 1999; 5: 292–3. 4. Caugant DA. Population genetics and molecular epidemiology of Neisseria meningitidis. APMIS 1998; 106: 505–25. 5. Berro´n S, De La Fuente L, Martı´n E, Va´zquez JA. Increasing incidence of meningococcal disease in Spain associated with a new variant of serogroup C. Eur J Clin Microbiol Infect Dis 1998; 17: 85– 9. 6. Spratt BG, Zhang Q-Y, Jones DM, Hutchison A, Brannigan JA, Dowson C. Recruitment of a penicillin-binding protein gene from Neisseria flavescens during the emergence of penicillin resistance in Neisseria meningitidis. Proc Natl Acad Sci USA 1989; 86: 8988–92. 7. Blakebrough IS, Greenwood M, Whitte HC, Broadley AK, Gilles HM. The epidemiology of infections due to Neisseria meningitidis and Neisseria lactamica in a northern Nigerian community. J Infect Dis 1982; 146: 626–37. 8. Medelman PM, Campos J, Chaffin DO, Serfass DA, Smith AL, Sa´ez-Nieto JA. Relative penicillin G resistance in Neisseria meningitidis and reduced affinity of penicillin-binding protein 3. Antimicrob Agents Chemother 1988; 32: 706–9.
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231
Correspondence
Low-level resistance to fluoroquinolones among Salmonella and Shigella We have read with interest the recent article by Willke et al. [1] on resistance of Salmonella and Shigella in Turkey. As published by Willke ‘‘there are alarming reports of reduced susceptibility and even resistance of Salmonella strains to quinolones’’. Clinicians and microbiologists have to keep in mind this risk since failures of treatment of typhoid fever with ciprofloxacin have been reported [2,3,4] and particularly with strains that have low-level resistance to fluoroquinolones [5,6]. This paper described Salmonella strains with reduced susceptibility to fluoroquinolones: for example, the MICs of Salmonella typhi to pefloxacin, ofloxacin and ciprofloxacin were 4, 1 and 0.5 mg/L, respectively. It is probably due to a percentage of strains with low-level resistance especially in Salmonella typhi. We are thus interested to know how many strains had lowlevel resistance to fluoroquinolones in this study? The author should provide the distribution of the minimum inhibitory concentrations and the percentage that were nalidixic acidresistant. We strongly suggest that nalidixic acid is tested against all Salmonella isolates to detect this low level of resistance and against isolates from acute shigellosis where nalidixic acid can be used for treatment of children. It is known in Gram-negative bacilli that fluoroquinolone resistance is most frequently a twostage process, with resistance to older quinolones such as nalidixic acid emerging first, conferring higher MICs for the fluoroquinolones, but usually staying within the ‘‘susceptible’’ range. This is followed by further mutations to generate highlevel resistance to the fluoroquinolones. In conclusion, the number of strains with low-level resist-
231
ance to fluoroquinolones is certainly underestimated, since, in the usual susceptibility tests, with the breakpoints presently accepted world-wide, such strains are categorized as susceptible. Strains resistant to nalidixic acid should be reported to the clinician and the MIC of ciprofloxacin measured. J.-C. Nguyen Van* and F. W. Goldstein *Laboratoire de Microbiologie Me´dicale, Fondation Hoˆpital Saint Joseph, 185 rue Raymond Losserand, 75014 Paris, France Tel: +33 1 44 12 34 53 Fax: +33 1 44 12 32 34 E-mail: jean claude nguyen [email protected] REFERENCES 1. Willke A, Arman D, C ¸ okc¸a F et al. Resistance of Salmonella and Shigella. Clin Microbiol Infect 1999; 5: 588–90. 2. Bhatia RS. Typhoid fever not responding to ciprofloxacin therapy. Assoc Physicians India 1992; 40: 705–6. 3. Rowe B, Ward LR, Threlfall EJ. Ciprofloxacin and typhoid fever. Lancet 1992; 339: 740. 4. Umasankar S, Wall RA, Berger J. A case of ciprofloxacin-resistant typhoid fever. Communicable Disease Report. CDR Rev 1992; 2: R139–40. 5. Le Lostec Z, Fegueux S, Jouve P, Boisivon A, Cheron M, Mornet P. Quinolone resistant Salmonella typhi acquired in Europe: a clinical failure of quinolone treatment [abstract 79/P6]. In: Program and Abstracts of the 16th Interdisciplinary Meeting on Anti-Infectious Chemotherapy, Paris: Socie´te´ Franc¸oise de Microbiologie, 1996: 121. 6. Launay O, Nguyen Van JC, Buu-Hoı¨ A, Acar JF. Typhoid fever due to a Salmonella typhi strain of reduced susceptibility to fluoroquinolones. Clin Microbiol Infect 1997; 3: 541–4.
© 2000 Copyright by the European Society of Clinical Microbiology and Infectious Diseases, CMI, 6, 226–231