- Email: [email protected]
Liver repopulation trial using bone marrow cells in a retrorsine-induced chronic hepatocellular injury model
© Masson, Paris, 2006.
ORIGINAL ARTICLE
Gastroenterol Clin Biol 2006;30:453-459
Liver repopulation trial using bone marrow cells in a retrorsine-induced chronic hepatocellular injury model
Niaz KOHNEH-SHAHRI (1), Jean-Marc REGIMBEAU (1), Benoît TERRIS (2), Valérie PARADIS (3), Marie-Pierre BRALET (4), William COLEMAN (5), Genelle BUTZ (5), Sandrine CHOUZENOUX (1), Didier HOUSSIN (1), Olivier SOUBRANE (1) (1) Laboratoire des Thérapeutiques Innovantes des Maladies du Foie (EA 1833), Université René Descartes Paris V ; (2) Service d’Anatomopathologie, Hôpital Cochin Port Royal, Paris ; (3) Service d’Anatomopathologie, Hôpital Beaujon, Clichy ; (4) Service d’Anatomopathologie, Hôpital Paul Brousse, Villejuif, France ; (5) Department of Pathology and Laboratory Medicine, University of North Carolina School of Medicine, Chapel Hill, USA.
SUMMARY
RÉSUMÉ
Objectives — The aim of this study was to determine the potential of bone marrow derived cells to participate in liver repopulation. In this model, the injected cells had a "selective growth advantage" compared to the native hepatocytes whose proliferation was blocked by retrorsine.
Tentative de repopulation hépatique par des cellules médullaires dans un modèle d’hépatopathie chronique (rétrorsine) Niaz KOHNEH-SHAHRI, Jean-Marc REGIMBEAU, Benoît TERRIS, Valérie PARADIS, Marie-Pierre BRALET, William COLEMAN, Genelle BUTZ, Sandrine CHOUZENOUX, Didier HOUSSIN, Olivier SOUBRANE
Methods — Total bone marrow cells were isolated from male Fisher 344 rats not deficient in dipeptidyl peptidase activity (F344, DPP IV+). The animals were given an injection of retrorsine and were divided in 2 groups: 1/group R (N = 13): female F344 rats received 4.106 male cells at day 0 (labeled by chromosome Y). 2/group RH (N = 19): Male F344 DPP IV- rats received 4.106 male DPP IV+ cells after hepatectomy at day 0 (labelled by DPP IV activity).
(Gastroenterol Clin Biol 2006;30:453-459)
Objectifs — Le but de ce travail était de tester la capacité de cellules médullaires provenant de moelle osseuse totale à repeupler un foie de rat. Les cellules médullaires injectées avaient un avantage sélectif par rapport aux hépatocytes natifs dont la prolifération était bloquée par la rétrorsine. Méthodes — La moelle totale provenait de rats mâles Fisher 344 non déficient en dipeptidyl peptidase (F344, DPP IV+). Les animaux receveurs étaient divisés en 2 groupes et recevaient de la rétrorsine : 1/groupe R (N = 13) : des rats femelles F344 recevaient 4.106 cellules mâles à J0 (marquage par chromosome Y) ; 2/groupe RH (N = 19) : des rats mâles F344 DPP IV- recevaient après hépatectomie, 4.106 cellules mâles DPP IV+ à J0 (marquage par l’activité DPP IV).
Results — Group R: no male cell was detected by PCR at day 14, 28, 56 and 84. Group RH: isolated DPP IV+ transplanted cells were observed at days 14 and 28 in the periportal areas. Later, these cells were no longer visible. Liver regeneration occurred by proliferation of small clusters of hepatocytes. Conclusions — In this experimental model the capacity of transplanted bone marrow cells to repopulate the liver was tested against the same capacity of native liver stem cells. Liver regeneration occurred via native liver cells seen as small hepatocytes. In this model the small hepatocytes may be considered as hepatic stem cells.
Résultats — Dans le groupe R, aucune cellule mâle n’a été retrouvée par PCR à J14, J28, J56 et J84. Dans le groupe RH des cellules DPP IV+ étaient visibles à J14 et J28 en zone périportale. Ces cellules n’étaient plus visibles ultérieurement. Il existait de nombreux foyers de régénération constitués de petits hépatocytes. Conclusions — Dans ce modèle, des cellules médullaires et des cellules souches hépatiques natives potentielles ont été mises en compétition. La régénération hépatique s’est faite exclusivement à partir de cellules natives, sous forme de petits hépatocytes. Ces derniers, ont été considérés dans ce modèle comme des cellules souches pour les hépatocytes.
For certain indications, transplantation of isolated hepatocytes has been proposed as an alternative to whole organ transplantation [6]. Animal experiments [7-10] and clinical trials with isolated liver cell transplantation [11-13] have produced encouraging results. There have been however very few trials because of the technical problems involved: imperfect control of hepatocyte cryopreservation, small number of transplantable cells, requirement for immunosuppression. Recent work has demonstrated that hematopoietic stem cells isolated from murine bone marrow can differentiate in vivo into different cell types including myocytes, endothelial cells, and hepatocytes [14-16]. In humans, cells coming from the donor bone marrow expressing characteristic features of hepatocytes have been demonstrated in the liver of patients with a liver or bone marrow graft [17, 18]. Several animal studies [19, 20] have also shown than bone marrow cells can differentiate into hepatocytes which can repopulate the liver partially. However, for these models, particular conditions had been created by sublethal radiation of the host and bone marrow graft or by hepatic
Introduction Allogenic liver transplantation is the gold-standard treament for chronic liver disease and fulminant hepatitis but its application is limited by organ shortage which persists despite the development of split-organ and living donor techniques [1-4]. Xenografting and cell therapy are two avenues of research offering potential alternatives or complementary solutions to the problem of graft procurement. At the present time, xenografts using swine organs has not reached the clinical phase due to acute xenogenic rejection and the risk of retroviral infection [5]. Cell therapy by transplanted isolated hepatocytes or bone marrow cells is also an attractive solution. Reprints: J.-M. REGIMBEAU, , Service de Chirurgie Digestive, Hôpital Nord Amiens, Université de Picardie, Place Victor Pauchet, 80054 Amiens Cedex 01. E-mail : [email protected]
453
N. Kohneh-Shahri et al.
injury induced with carbon tetrachloride [21] or a Fas receptor agonist antibody [22] to amplify differentiation. The differentiation of bone marrow cells into hepatocytes is a rare phenomenon and limited to a very small proportion of cells which remain to be characterized. To observe even partial repopulation of the liver with transplanted cells, i.e. either with hepatocytes or stem cells, such cells appears to require a selective growth advantage over native hepatocytes [23]. Stem cells would be better than hepatocytes because the use of an autograft avoids the risk of rejection and enables repeated grafts if required.
were washed twice in DMEM before intraportal injection to avoid immune reaction against the FCS. A total of 4.106 cells were injected. Anesthesia was performed with ether to enable a two-thirds hepatectomy, intraportal injection of bone marrow cells and animal sacrifice. The liver was removed and weighed and several liver samples were obtained. Hepatectomy used the standard method for two-third resection [31]. Briefly, after ligation of the pedicule and resection of the two largest lobes, the median and the left, the remaining liver was composed of the caudate and epiploic lobes. Intraportal injections of bone marrow cells from wild (DDP IV+) Fischer F344 male rats were performed on all animals. Injections were made immediately after hepatectomy when performed and during the same laparotomy. Retrorsine (RS, Sigma, France) was supplied as a powder and dissolved in 10 ml sterile water with HCl (pH 2.5) then neutralized with NaOH (0.1 N) to pH 7, followed by addition of 0.15 mol/L NaCl prepared separately with distilled water to obtain a final solution of 6 mg/mL retrorsine [28, 29]. Retrorsine blocks hepatocyte division between phase "S" and "G2" of the cell cycle. Cells remain blocked after DNA synthesis and before phase "M" division [28]. The effect of retrorsine persists for several months in treated hepatocytes, particularly after partial hepatectomy, and the hepatocytes disappear progressively by apoptosis [29]. Thirteen female F344 rats (group R) and nineteen male F344 DPP IV- rats (group RH) were given two intraperitoneal injections of 30 mg/kg retrorsine two weeks apart.
Complementary studies have examined the degree of hepatic repopulation and the origin of the repopulating stem cells. In the long-term, the hepatocyte population expresses an inconstant chimerism, which can be identified in the liver or bone marrow graft by cross sexing or fusion of bone marrow cells then differentiation of embryonic cells [24, 25]. The purpose of this study was to test the capacity of bone marrow cells to repopulate livers in a rat model favorable for such repopulation. The experimental protocol was designed after the model reported by Laconi et al. [26, 27] but bone marrow cells were transplanted instead of hepatocytes. In the present work, the selective growth advantage of injected cells was induced by blocking cell division of native hepatocytes with retrorsine, a pyrrolizidine alkaloid [28-30].
Experimental protocol for labeling cells injected via the portal vein
Methods
In this model, because of the predictable problems in identifying injected cells, two methods were used to characterize transplanted cells within native liver:
Recipient animals were wild 6-week-old female Fischer F344 rats (Iffa Credo, France) (mean weight 120 g) and 6-week-old male Fischer 344 rats deficient in dipeptidyl peptidase (DPPIV-) (Charles River, Japan) (mean weight 100 g). DDP IV- rats have a point mutation blocking expression of dipeptidyl peptidase; this deficiency labels injected cells. DDP is a membrane enzyme which, in the hepatocytes of wild animals, is found on the apical border. The animals had access to water and feed at all times and were raised in compliance with the European Council Directives of November 24th 1986. Bone marrow cells were harvested from donor animals and prepared extemporaneously using total bone marrow extracted from the femurs and tibias of male Fischer F344 rats not deficient in DDP IV (DPP IV+). Total bone marrow was obtained by purging the medullary canal of long bones with a 26 G needle. Cells were then suspended in Dulbecco’s Modified Eagle’s Medium (DMEM) + 10% fetal calf serum (FCS) + % antibiotics (10000 IU/mL penicillin and 10000 µg/mL streptomycin). Cells were filtered and centrifuged twice at 1400 rpm for ten minutes at 4°C before typan blue staining for counting on a Malassez slide. Bone marrow cells
RETRORSINE PROTOCOL – SEARCH FOR CHROMOSOME Y (GROUP R) (figure 1a) Two weeks after the last injection of retrorsine, the thirteen female F344 rats received, during lapraotomy, an intraportal injection of 4.106 bone marrow cells harvested from male F344 rats. Groups of three rats were sacrificed on days 7, 14, 28, and 56 after surgery and one rat on day 84. Liver samples were submitted to polymerase chain reaction (PCR) to search for chromosome Y in transplanted cells.
RETRORSINE PROTOCOL AND TWO-THIRDS HEPATECTOMY — DDP ACTIVITY (GROUP RH) (figure 1b) Four weeks after the last retrorsine injection, the time necessary to avoid unacceptable post-hepatectomy mortality, nineteen male DPP IV- rats
B Retrorsine two-third hepatectomy protocol (group RH) Recipient animals: male Fischer F344 DPP IV– rats
A Retrorsine protocol (group R)
Animal sacrifice DPP IV activity on liver samples
Recipient animals : female F344 DPP IV+ rats Animal sacrifice PCR of liver samples
day 1 an 14 : injection of retrorsine (30 mg/kg)
day 1 and 14 : injection of retrorsine (30 mg/kg) 42 (d0) 1
28 (d0) 1
14
35 (d7)
42 (d14)
56 (d28)
84 (d56) 112 (d84) Time (days)
Day 0 : intraportal injection of bone marrow cells from male Fischer F344 DPP IV+ rats labeled by chromosome Y
a b
14
56 (d14)
70 (d28)
84 (d42)
98 (d56) time (days)
d0 : two-third hepatectomy and intraportal injection of bone marrow cells from male Fischer F344 DPP IV+ rats labeled by their DPP IV activity
Fig.1 – a) Diagram group R: retrorsine injection intraperitoneally at day 1 and 14, laparotomy and bone marrow cell injection via portal vein at day 28 (D0), animal sacrifices within regular intervals. b) Diagram group RH: retrorsine injection intraperitoneally at day 1 and 14, laparotomy, 2/3 hepatectomy and bone marrow cell injection via portal vein at day 42 (D0), animal sacrifices within regular intervals. a) Schéma groupe R : injection intrapéritonéale de rétrorsine au 1er et 14ème jour, laparotomie et injection intraportale des cellules médullaires au 28ème jour (J0), sacrifice des animaux à intervalle régulier. b) Schéma groupe RH : injection intrapéritonéale de rétrorsine au 1er et 14ème jour, laparotomie, hépatectomie des 2/3 et injection intraportale des cellules médullaires au 42ème jour (J0), sacrifice des animaux à intervalle régulier.
454
Liver repopulation trial
underwent two-thirds hepatectomy followed by intraportal injection of 4.10 bone marrow cells which had been harvested from wild male Fischer F344 rats (DPP IV+). These cells could be identified by their dipeptidyl peptidase activity. The animals were sacrificed at days 14, 28, 42, and 56 after surgery (one animal at each date because of the high mortality with this protocol, N = 11 rats). Transplanted cells were demonstrated by search for dipeptidyl peptidase activity using histochemistry methods on liver slices.
Migration of the final product took place on 2% aragose gel in the presence of ethidium bromide for one hour at 150V. Each PCR series included a blank sample (without DNA), a positive control (male rat liver) and a negative control (female rat liver). PCR was performed on two liver samples from each sacrificed rat. Complementary experiments were also conducted, particularly to determine the quantity of DNA necessary to obtain the best amplification. This quantity was 50 ng (figure 2a).
SEARCH FOR DIPEPTIDYL PEPTIDASE ACTIVITY (GROUP RH)
Control groups
DPP IV activity was demonstrated on 5 µm slices of tissue frozen at -70°C after immersion in methyl butane (Sigma Aldrich, France). Tissues were fixed in acetone chloroform for 10 min then incubated with glycyl L praline 4 methoxy 2 naphthylamide (Sigma Aldrich, France) and 1 mg/mL fast blue B (Sigma Aldrich, France) for 30 min [33]. Histological analysis was not possible in group R because of the cyropreservation of the samples.
RETRORSINE PROTOCOL (GROUP R) Chromosome Y detected in hepatocytes and bone marrow cells in male rats was the positive control for this cell labeling method. The negative control consisted of the absence of chromosome Y in liver samples from four female rats which had received injections of bone marrow cells from syngenic female rats.
DEMONSTRATION OF SMALL HEPATOCYTES In this study, hepatic regeneration in group RH occurred not from injected bone marrow cells but from small hepatocytes, described previously by Prof. Coleman’s team. A study of tissues frozen in liquid nitrogen and preserved at -80°C was conducted according to the technique described by this team [34-36] to determine whether the small hepatocytes observed were the same as previously described.
RETRORSINE PROTOCOL AND TWO-THIRDS HEPATECTOMY (GROUP RH) DPP IV activity present in liver and bone marrow cells of DDP IV+ rats was the positive control for this labeling method. The absence of this activity in liver and bone marrow samples of DPP IV- rats was the negative control.
Results
POLYMERASE CHAIN REACTION (PCR) IN THE PRESENCE OF CHROMOSOME Y (GROUP R)
Retrorsine group (group R)
Chromosome Y was detected by PCR of the sry fragment situated on the short arm of chromosome Y [32]. DNA was extracted with the DNeasy Tissue kit (Qiagen, France). The quantity of DNA was estimated by measuring the absorbance at 260 nm. The DNA obtained was preserved at -20°C until PCR amplification. Fifty ng DNA were mixed in 37.5 µL sterile water, 5 µL 10X buffer (Gibco, France), 1.5 µL MgCL2 (50 mM) (Gibco, France), 1 µL DNTP (2.5 mM), 1.5 µL oligo-sense at 100 ng/µL and 1.5 µL nonsense at 100 ng/µL (Genst Oligos, France) and 0.5 µL Taq polymerase (Promega, France). The oligo-sense and nonesense sequence used were: 5’ GATTTTTAGTGTTCAGCCCT 3’ and 5’ TGCAGCTCTACTCCAGTCT 3’. The amplified sequence had 459 base pairs. Heat cycle conditions were: 1 min at 95°C then 35 1-min amplification cycles with denaturation at 94°C, 30s hybridization at 53°C, and 1 min elongation at 72°C, followed by a final step of 1 min at 72°C.
There were no deaths among the 13 rats in group R during the experimental protocol.
INTRAOPERATIVE OBSERVATIONS The liver presented a congestive aspect but no signs of chronic disease (ascites, portal hypertension) at injection of bone marrow cells on day 0 then at sacrifice on days 7, 14, 28, 56 and 84. Inflammatory adhesions tightly connected the liver with neighboring organs. There were no detectable tumor formations at any of the sacrifice times. Mean weight of the liver was: 5 g on
a b Fig.2 – a) PCR technical conditions: the PCR products were separated by electrophoresis in 2% agarose gel during one hour with 150 Volts and stained with ethidium bromide to determine the genomic DNA quantity to amplify. The strongest clear signal was obtained at the time of 50 ng genomic DNA. b) PCR products (identical condition appears 3A) obtained with liver tissue at D56 after bone marrow male derived cells injection via portal vein. No male cell was detected in spite of favorable amplification conditions (strong clear pilot positive signal). a) Mise au point technique (PCR) : image d’électrophorèse sur un gel d’agarose à 2 % en présence de bromure d’éthidium pendant une heure à 150 Volts, pour déterminer la quantité d’ADN génomique à amplifier. Le meilleur signal était obtenu lors de l’amplification de 50 ng d’ADN. b) Image du gel de PCR (conditions identiques figure 3a) à partir des prélèvements hépatiques à J56 de l’injection intraportale de cellules médullaires provenant de rats mâles. Aucune cellule mâle n’a été détectée, malgré des conditions favorables à l’amplification (témoin positif fortement amplifié).
455
N. Kohneh-Shahri et al.
as well as rare clusters of small hepatocytes (figure 3). At day 14, hepatocyte necrosis predominated with areas of inflammation and persistence of numerous apoptotic bodies. At this time, rare DPP IV+ cells were observed around the portal spaces (figure 4). At day 28, several DPP IV+ cells were observed in the hepatic parenchyma. On days 42 and 56, major hepatic regeneration had developed from several foci of small hepatocytes situated within pathological hepatic parenchyma (figure 5), but none of which expressed DDP IV+ activity. No DDP IV+ cells could be detected among the hepatocytes and the bone marrow cells of DDP IV- rats (negative controls). Hepatocytes and bone marrow cells from DDP IV+ rats strongly expressed DDP IV+ activity (positive controls).
day 7, 6.3 g on day 14, 6.7 g on day 28 and day 56 and 8 g on day 84 after injection of bone marrow cells.
DETECTION OF TRANSPLANTED BONE MARROW CELLS Despite technical improvements, no male cells could be detected with PCR at days 14, 28, 56, and 84 (figure 2b). Concomitant examination of the female rat liver which had been injected with bone marrow cells coming from syngenic animals of the same sex (negative controls), demonstrated the absence of contamination during the manipulations. Chromosome Y was detected in hepatocytes and in bone marrow cells of male rats.
Retrorsine group and two-thirds hepatectomy (group RH)
CHARACTERIZATION
Mortality in the experimental group (N = 19 rats) was 58% (eight deaths during the first 48 postoperative hours and three deaths from the third to ninth postoperative day). Four rats were still alive at the end of the protocol.
OF THE SMALL HEPATOCYTES
Hepatic regeneration was observed in both groups of animals (R and RH) either as an increase in the hepatic mass (group R) or as the presence of regeneration foci (group RH). Our cell labeling technique did not allow identification of the origin of cells regenerating in group R but did in group RH. In group RH, hepatic regeneration did not originate from injected cells, but from small native hepatocytes. Secondary characterization of the small hepatocytes observed in group RH by Professer Coleman’s team enabled the demonstration that these small hepatocytes expressed certain markers of mature hepatocytes (albumin and transferin), and of embryonic and fetal hepatocytes (HNF 1, 4, and 6). This co-expression of hepatocyte markers of different developmental stages, which produced a specific phenotype, enabled confirmation that the small hepatocytes observed in group RH were the same as previously described by this team [34-36] (figure 6).
INTRAOPERATIVE OBSERVATIONS There were no signs of liver disease (ascites, collateral circulation) at hepatectomy and at injection on day 0; there were no adhesions. At sacrifice (after hepatectomy and injection of bone marrow cells) the following observations were made: ascites and collateral circulation on the abdominal wall as well as strong perihepatic adhesions on day 14; presence of collateral circulation without associated ascites and persistent strong perihepatic adhesions on day 28; presence of strong perihepatic adhesions on days 42 and 56. No tumor formations were observed at any of the sacrifice times. Mean weight of the liver at sacrifice was 5.7 g at day 28, 4.2 g and 4 g at days 42 and 56 respectively after hepatecomy and injection of bone marrow cells.
Discussion The purpose of this study was to test the capacity of bone marrow cells to colonize and repopulate rat livers in a model favorable for such repopulation. The experimental protocol for this study was designed after the protocol published by Laconi et al. [26, 27] but using bone marrow cells instead of hepato-
DETECTION OF BONE MARROW CELLS Examination of the histological slides of specimens taken at hepatectomy and injection of bone marrow cells (day 0) demonstrated the presence of several apoptotic bodies and megalocytes
3 4 Fig. 3 – Histological analysis from a F344 DPP IV- rat’s liver tissue (group RH) (fixed sections, HES coloration) at D0: note the necrosis area (fine black arrow) and many apoptotic bodies (white arrow) (x 400). Examen histologique d’un prélèvement hépatique d’un rat Fischer F344 DPP IV- (groupe RH) (tissu formolé, coloration HES) à J0 : à noter la présence d’un aspect de nécrose hépatocytaire (flèche noire fine) et de nombreux corps apoptotiques (flèche blanche) (x 400). Fig. 4 – Histochemical analysis from a Fischer F344 DPP IV- rat’s liver tissue (groupe RH) at D14 after 2/3 hepatectomy and bone marrow DPP IV+ cells infusion. (cryosections, fast blue BB coloration). Note two DPP IV+ cells presence in periportal area (fine black arrow) (x 400). Examen par histochimie d’un prélèvement hépatique d’un rat Fischer F344 DPP IV- (groupe RH) à J14 après hépatectomie 2/3 et injection de cellules médullaires DPP IV+ (tissu congelé, coloration fast blue BB). Présence de deux cellules DPP IV+ autour d’un espace porte (flèche noire fine) (x 400).
456
Liver repopulation trial
rare positive cells were detected in the liver lobes which might suggest the bone marrow cells had migrated into the hepatic parenchyma as has been described after transplantation of mature hepatocytes [27]. At six weeks, there were several clusters of regeneration composed of small hepatocytes. However, none of these regeneration clusters was labeled for DPP IV+ activity. Moreover, no DDP IV+ cell could be demonstrated in the liver at this time. We do not know what happened to the injected cells and thus cannot determine whether they integrated the bone marrow or circulating cells or whether they were simply eliminated. The hypothesis of elimination is not very likely since the injected cells were bone marrow cells coming from syngenic animals so immunological rejection would be unlikely. For the two groups in this study, with and without hepatectomy, hepatic regeneration occurred either by increased hepatic mass (retrorsine group) or by presence of several clusters of regeneration (retrorsine hepatectomy group). This regeneration could be explained either by ineffective retrorsine blockade of native hepatocytes or by hepatic regeneration from native liver stem cells or from injected bone marrow cells, or both. There is no reason to retain the hypothesis of retrorsine inefficacy since this injury model has been used at the same dose and in similar conditions in experiments reported by several other teams. In addition, the presence of apoptotic bodies, megalocytes, and small clusters of hepatoctyes (group RH) at the histological examination is on the contrary in favor of the efficacy of retrorsine. Laconi et al. [27] were able to demonstrated preferential liver regeneration from transplanted mature hepatocytes compared with native liver stem cells, but there is no reason to extrapolate these results to transplantation of bone marrow cells. This is the main reason for using two labeling methods for injected cells to distinguish between the origin of the regeneration observed in this study.
Fig. 5 – Histological analysis from a F344 DPP IV- rat’s liver tissue (group RH) at D42 after 2/3 hepatectomy and bone marrow DPP IV+ cells infusion (fixed sections, HES coloration). Note small hepatocytes (fine black arrow) regenerative clusters (white arrow) in an abnormal parenchyma (x200). None of these cells expressed dipeptidyl peptidase activity. Examen histologique d’un prélèvement hépatique d’un rat Fischer F344 DPP IV- (groupe RH) à J42 après hépatectomie 2/3 et injection de cellules médullaires DPP IV+ (tissu formolé, coloration HES), présence de nombreux nodules de régénération (flèche blanche) constitués de petits hépatocytes (flèche noire fine) au milieu d’un parenchyme d’aspect pathologique (x 200 ). Aucune de ces cellules n’exprimait l’activité DPP IV+.
cytes. Hepatic regeneration was observed in both groups of animals, either as an increase in hepatic mass or as the presence of regeneration clusters. In the retrorsine group, PCR failed to recognize any male cells in the multiple liver samples. In the retrorsine hepatectomy group, two and four weeks after their injection, DPP IV+ cells were visible in the periportal zone and in the hepatic parenchyma, but without a cluster aspect. These cells could not be identified in later samples which exhibited several regenerating foci composed of hepatocytes. Hepatic regeneration thus occurred not from the injected bone marrow cells but from small hepatocytes. These hepatocytes are the same as were observed in the experiments reported by Gordon et al. [34-36] as the origin of complete liver regeneration.
It is known that complete liver regeneration from mature native hepatocytes can occur after hepatectomy. Laconi et al. [26, 27] demonstrated that by blocking the capacity of native hepatocytes to divide, with or without hepatectomy, the largest part of the regeneration occurs from transplanted mature hepatocytes. In this experiment, and without irradiation the bone marrow, hepatic regeneration occurred exclusively from small native hepatocytes. This absence of irradiation is important because hepatic regeneration from small hepatocytes has not been observed after radiotherapy [22, 38]. Gordon et al. [34] observed the presence of small hepatocytes after two injections of retrorsine and hepatectomy. These small hepatocytes were the source of complete hepatic regeneration with no cell therapy. The small hepatocytes observed in the present study are the same as studied by this team: they have the particular marking of fetal hepatocytes (EA 18 — EA 20), hepatoblasts (EA 14), oval cells (OC2, OC) and mature hepatocytes (antigen H, albumin and transferin) [35]. They do not express markers of bone marrow cells (CD34 and Thy1). They would also be resistant to retrorsine due to the lack of or weak expression of their P450 hepatic cytochrome enzymes (CYP 2E1 and CYP 3A1) which transform retrorsine into its active toxic form [34, 35]. The origin of these small hepatoctyes is not known. However, given their site of emergence and their cell labeling characteristics, it can be assumed that they do not come from oval cells (because they are OV6-) nor bone marrow stem cells (because they are CD34and Thy1-). A recent study designated mature hepatocytes as the source of these small hepatoctyes: labeling mature heaptocytes with the beta galactosidase gene enabled Avril et al. [39] to observe the expression of this gene by small hepatocytes after injection of retrorsine and hepatectomy. Gordon et al. [36] successfully isolated these small hepatocytes and were able to maintain them in culture for 30 days. They then transplanted them into the hepatic parenchyma where they were capable of integration and division among other mature hepatocytes after hepatectomy. The expression of these small hepatocytes is not
In the retrorsine model, PCR was used to identify the injected bone marrow cells. In situ hybridization with immunofluorescence would have enabled identifying the exact localization of transplanted cells and any differentiation of these cell by double labeling but, to our knowledge, this technique is not available in France. All PCR amplifications (35 cycles) were negative. The absence of hepatic regeneration from injected bone marrow cells could be explained either by the absence of a selection advantage for transplanted cells compared with native stem cells, or by a lack of a sufficiently powerful stimulus for regeneration. In this model derived from the model described by Laconi et al. [26] the absence of hepatectomy, ensures that repopulation occurs later after hepatocyte transplantation and is less massive. For future studies, the stimulus might be amplified by stimulating injected cells capable of division (not blocked by retrorsine) with thyroxine and accelerated cell death by apoptosis of blocked cells [37]. The risk of false negatives is low because of the sensitivity of the PCR technique which can detect one cell in one million. The retrorsine hepatectomy model differs from the preceding model not only because the labeled cells can be identified but also because their localization can be recognized with characterization by immunolabeling. In this model, stimulation of the regeneration is amplified by two-thirds hepatectomy in addition to retrorsine injection. Two weeks after the injection, DPP IV+ cells were observed around the portal spaces. At four weeks, 457
N. Kohneh-Shahri et al.
a b c Fig.6 – Characterization of small hepatocytes (Pr. Coleman): co expression by small hepatocytes of Hnf 1,6 and albumin (phenotype of a hepatic cell between embryonic and fetal phase). (ABC) Caractérisation des petits hépatocytes (Pr.Coleman) Mise en évidence d’une coexpression par les petits hépatocytes de l’Hnf 1,6 et l’albumine (phénotype d’une cellule hépatique entre la phase embryonnaire et fœtale).
constant since there was no hepatic regeneration in the work reported by Dahkle et al. [38], despite treatment with retrorsine but with radiation and after bone marrow grafting and CCL4 hepatic injury.
hepatocytes for regeneration and the probable existence of certain subpopulations of hepatocytes which are less sensitive to chemical injury. One of the possible avenues for future research would be to isolate these specific subpopulations of hepatocytes and cultivate them for use with cell therapy strategies.
After the initial enthusiasm raised by the first experimental results on hepatic repopulation using transplanted bone marrow cells for fuaryl acetoacetate hydrolase deficient mice using the Lagasse et al. model [19], further work demonstrated that bone marrow cell hepatic repopulation is only a possible but rare event, even in the presence of very strong selection pressure [22]. Similarly, in humans, the chimerism of hepatocytes observed during bone marrow or hepatic transplantation demonstrated by sex-crossing appears to be an inconstant phenomenon which regresses over the years [24]. This point is also being re-examined for other organisms, particularly for the myocardium: recent experimental work questioned the differentiation of bone marrow cells into myocytes during myocardial infarction [40, 41] in contrast with earlier encouraging results reported by Ferrari [15] and Orlic [16]. It would thus appear that bone marrow cells are less plastic than expected and that although they can differentiate, the phenomenon is rare, making it a difficult tool for exploitation with the current state of the art.
REFERENCES
1. Bismuth
H, Houssin D. Reduced — sized orthotopic liver graft in hepatic transplantation in children. Surgery 1984;95:367-70.
2. Houssin D, Soubrane O, Boillot O, Dousset B, Ozier Y, Devictor D, et al. Orthotopic liver transplantation with a reduced-size graft: An ideal compromise in pediatrics? Surgery 1992;111:532-42.
3. Raia
S, Nery JR, Mies S. Liver transplantation from liver donors. Lancet 1989;2:497.
4. Boillot O, Dawahra M, Porcheron J, Houssin D, Boucaud C, Gille D, et al. Transplantation hépatique pédiatrique et donneur vivant apparenté. Ann Chir 1993;47:577-85.
5. White SA, Nicholson ML. Xenotransplantation. Br J Surg 1999;86: 1499-514.
6. Regimbeau JM, Mallet VO, Bralet MP, Gilgenkrantz H, Houssin D, Soubrane O. Transplantation d’hépatocytes isolés : principes, mécanismes, applications expérimentales chez l’homme. Gastroenterol Clin Biol 2002;26:591-601.
In this experimental model where transplanted bone marrow cells and native hepatic stem cells are in competition, only endogenous hepatic cells participated in liver regeneration seen as clusters of small hepatocytes. While these small hepatocyts arise from mature hepatocytes, as was demonstrated by Avril et al. [39], it is also possible, in the present model, to consider that hepatic regeneration occurred from a specific set of hepatocytes. This model again favors a very strong capacity of native
7. Eguchi S,
Rozga J, Lebow LT, Chen SC, Wang CC, Rosenthal R, et al. Treatment of hypercholesterolemia in the Watanabe rabbit using allogeneic hepatocellular transplantation under a regeneration stimulus. Transplantation 1996;62:588-93.
8. Moscioni AD, Rozga J, Chen S, Naim A, Scott HS et Demetriou A. Long-term correction of albumin levels in the Nagase analbuminemic
458
Liver repopulation trial
26. Laconi S, Pillai S, Porcu PP, Shafritz DA, Pani P, Laconi E. Massive
rat: repopulation of the liver by transplanted normal hepatocytes under a regeneraion response. Cell Transplantation 1996;5: 499-503.
liver replacement by transplanted hepatocytes in the absence of exogenous growth stimuli in rats treated with retrorsine. Am J Pathol 2001;158:771-7.
9. Kobayashi N, Ito M, Nakamura J, Cai J, Gao C, Hammel JM, et al. Hepatocyte transplantation in rats with decompensated cirrhosis. Hepatology 2000;31:851-7.
27. Laconi E, Oren R, Mukhopadhyay DK, Hurston E, Laconi S, Pani P, et al. Long- term, near-total liver replacement by transplantation of isolated hepatocytes in rats treated with retrorsine. Am J Pathol 1998; 153:319-29.
10. Malhi H, Irani AN, Volenberg I, Schilsky ML, Gupta S. Early cell transplantation in LEC rats modeling Wilson’s disease eliminates hepatic copper with reversal of liver disease. Gastroenterology 2002; 122:438-47.
28. Laconi S, Curreli F, Diana S, Pasciu D, De Filippo G, Sarma DS, et al.
11. Bilir BM, Guinette D, Karrer F, Kumpe DA, Krysl J, Stephens J, et al.
Liver regeneration in response to partial hepatectomy in rats treated with retrorsine: a kinetic study. J Hepatol 1999;31:1069-74.
Hepatocyte transplantation in acute liver failure. Liver Transplatation 2000; 6:32-40.
29. Gordon GJ, Coleman WB, Grisham JW. Bax-mediated apoptosis in
12. Fox IJ, Chowdhury JR, Kaufman SS, Goertzen TC, Chowdhury NR,
the livers of rats after partial hepatectomy in the retrorsine model of hepatocellular injury. Hepatology 2000;32:312-20.
Warkentin PI, et al. Treatement of the Crigler-Najjar syndrome type I with hepatocyte transplantation. N Engl J Med 1998;338:1422-6.
30. Laconi E, Sarma DSR, Pani P. Transplantation of normal hepatocytes
13. Muraca M, Gerunda G, Neri D, Vilei MT, Granato A, Feltracco P,
modulates the development of chronic liver lesions induced by a pyrrolizidine alkaloid lasiocarpine. Carcinogenesis 1995;16:139-42.
et al. Hepatocyte transplantation as a treatment for glycogen storage disease type 1a. Lancet. 2002;359:317-8.
31. Higgins GM, Anderson RM. Experimental pathology of the liver: restoration of the liver of the wright rat following partial surgical removal. Arch Pathol 1931;12:186-202.
14. Krause
DS, Theise ND, Collector MI, Henegariu O, Hwang S, Gardner R, et al. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 2001;105:369-77.
32. An J, Beauchemin N, Albanese J, Abney TO, Sullivan AK. Use of a rat cDNA probe specific for the Y chromosome to detect male-derived cells. J Androl 1997;18:289-93.
15. Ferrari
G, Cusella-De Angelis G, Coletta M, Paolucci E, Stornaiuolo Cossu G, Mavilio F. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998;279:1528-30.
33. Rajvanshi P, Kerr A, Bhargava KK, Burk RD, Gupta S. Studies of liver repopulation using the dipeptidyl peptidase IV — deficient rat and other rodent recipient cell size and structure relationships regulate capacity for increased transplanted hepatocyte mass in the liver lobule. Hepatology 1996;23:482-96.
16. Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701-5.
17. Theise
ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, et al. Liver from bone marrow in humans. Hepatology 2000;32:11-16.
34. Gordon GJ, Coleman WB, Hixson C, Grisham JW. Liver regeneration in rats with retrorsine-induced hepatocellular injury proceeds through a novel cellular response. Am J Pathol 2000;156:607-19.
18. Alison MR, Poulsom R, Jeffery R, Dhillon AP, Quaglia A, Jacob J,
35. Gordon GJ, Coleman WB, Grisham GW. Temporal analysis of hepa-
et al. Hepatocytes from non hepatic adulte stem cells. Nature 2000; 406:257.
19. Lagasse E, Connors H, Aldhalimy M, Reitsma M, Dohse M, Osborne L,
tocyte differentiation by small hepatocyte-like progenitor cells during liver regeneration in retrorsine — exposed rats. Am J Pathol 2000; 157:771-86.
et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nature 2000;6:1229-34.
36. Gordon GJ, Butz GM, Grisham GW, Coleman WB. Isolation, shortterm culture, and transplantation of small hepatocyte like prognitor cells from retrorsine-exposed rats. Transplantation 2002;73:1236-43.
20. Theise ND, Badve S, Saxena R, Henegariu O, Sell S, Crawford JM, et al. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 2000;31:235-40.
37. Oren
R, Dabeva MD, Karnezis AN, Petkov PM, Rosencrantz R, Sandhu JP, et al. Role of thyroid hormone in stimulating liver repopulation in the rat by transplanted hepatocytes. Hepatology 1999; 30:903-13.
21. Petersen
B, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, et al. Bone marrow as a potential source of hepatic oval cells. Science 1999;284:1168-70.
38. Dahlke MH, Popp FC, Bahlmann FH, Aselmann H, Jager MD, Neipp M,
22. Mallet VO, Mitchell C, Mezey E, Fabre M, Guidotti JE, Renia L, et al.
et al. Liver regeneration in a retrorsine/CCL4 — induced acute liver failure model: do bone marrow-derived cells contribute? J Hepatol 2003;39:365-73.
Bone marrow transplantation in mice leads to a minor population of hepatocytes that can be selectively amplified in vivo. Hepatology 2002;35:799-804.
39. Avril A, Pichard V, Bralet MP, Ferry N. Mature hepatocytes are the
23. Mallet
source of small hepatocyte-like progenitor cells in the retrorsine model of liver injury. J Hepatol 2004;41:737- 43.
VO, Regimbeau JM, Mitchell C, Guidotti JE, Soubrane O, Gilgenkrantz H. Stratégies de repeuplement du foie par avantage sélectif. Gastroenterol Clin Biol 2002;26:480-5.
40. Murry CE, Soonpaa MH, Reinecke H, Nakajima H, Nakajima HO,
24. Fogt F, Beyser KH, Poremba C, Zimmerman RL, Khettry U, Ruschoff J.
Rubart M, et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 2004;428:664-8.
Recipient- derived hepatocytes in liver transplants: a rare event in sexmismatched transplants. Hepatology 2002;36:173-6.
41. Balsam
LB, Wagers AJ, Christensen JL, Kofidis T, Weissman IL, Robbins RC. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 2004;428:668-73.
25. Terada. Bone marrow cell adapt the phenotype of other cells by spontaneous cell fusion. Nature 2002;416:542.
459
ORIGINAL ARTICLE
Gastroenterol Clin Biol 2006;30:453-459
Liver repopulation trial using bone marrow cells in a retrorsine-induced chronic hepatocellular injury model
Niaz KOHNEH-SHAHRI (1), Jean-Marc REGIMBEAU (1), Benoît TERRIS (2), Valérie PARADIS (3), Marie-Pierre BRALET (4), William COLEMAN (5), Genelle BUTZ (5), Sandrine CHOUZENOUX (1), Didier HOUSSIN (1), Olivier SOUBRANE (1) (1) Laboratoire des Thérapeutiques Innovantes des Maladies du Foie (EA 1833), Université René Descartes Paris V ; (2) Service d’Anatomopathologie, Hôpital Cochin Port Royal, Paris ; (3) Service d’Anatomopathologie, Hôpital Beaujon, Clichy ; (4) Service d’Anatomopathologie, Hôpital Paul Brousse, Villejuif, France ; (5) Department of Pathology and Laboratory Medicine, University of North Carolina School of Medicine, Chapel Hill, USA.
SUMMARY
RÉSUMÉ
Objectives — The aim of this study was to determine the potential of bone marrow derived cells to participate in liver repopulation. In this model, the injected cells had a "selective growth advantage" compared to the native hepatocytes whose proliferation was blocked by retrorsine.
Tentative de repopulation hépatique par des cellules médullaires dans un modèle d’hépatopathie chronique (rétrorsine) Niaz KOHNEH-SHAHRI, Jean-Marc REGIMBEAU, Benoît TERRIS, Valérie PARADIS, Marie-Pierre BRALET, William COLEMAN, Genelle BUTZ, Sandrine CHOUZENOUX, Didier HOUSSIN, Olivier SOUBRANE
Methods — Total bone marrow cells were isolated from male Fisher 344 rats not deficient in dipeptidyl peptidase activity (F344, DPP IV+). The animals were given an injection of retrorsine and were divided in 2 groups: 1/group R (N = 13): female F344 rats received 4.106 male cells at day 0 (labeled by chromosome Y). 2/group RH (N = 19): Male F344 DPP IV- rats received 4.106 male DPP IV+ cells after hepatectomy at day 0 (labelled by DPP IV activity).
(Gastroenterol Clin Biol 2006;30:453-459)
Objectifs — Le but de ce travail était de tester la capacité de cellules médullaires provenant de moelle osseuse totale à repeupler un foie de rat. Les cellules médullaires injectées avaient un avantage sélectif par rapport aux hépatocytes natifs dont la prolifération était bloquée par la rétrorsine. Méthodes — La moelle totale provenait de rats mâles Fisher 344 non déficient en dipeptidyl peptidase (F344, DPP IV+). Les animaux receveurs étaient divisés en 2 groupes et recevaient de la rétrorsine : 1/groupe R (N = 13) : des rats femelles F344 recevaient 4.106 cellules mâles à J0 (marquage par chromosome Y) ; 2/groupe RH (N = 19) : des rats mâles F344 DPP IV- recevaient après hépatectomie, 4.106 cellules mâles DPP IV+ à J0 (marquage par l’activité DPP IV).
Results — Group R: no male cell was detected by PCR at day 14, 28, 56 and 84. Group RH: isolated DPP IV+ transplanted cells were observed at days 14 and 28 in the periportal areas. Later, these cells were no longer visible. Liver regeneration occurred by proliferation of small clusters of hepatocytes. Conclusions — In this experimental model the capacity of transplanted bone marrow cells to repopulate the liver was tested against the same capacity of native liver stem cells. Liver regeneration occurred via native liver cells seen as small hepatocytes. In this model the small hepatocytes may be considered as hepatic stem cells.
Résultats — Dans le groupe R, aucune cellule mâle n’a été retrouvée par PCR à J14, J28, J56 et J84. Dans le groupe RH des cellules DPP IV+ étaient visibles à J14 et J28 en zone périportale. Ces cellules n’étaient plus visibles ultérieurement. Il existait de nombreux foyers de régénération constitués de petits hépatocytes. Conclusions — Dans ce modèle, des cellules médullaires et des cellules souches hépatiques natives potentielles ont été mises en compétition. La régénération hépatique s’est faite exclusivement à partir de cellules natives, sous forme de petits hépatocytes. Ces derniers, ont été considérés dans ce modèle comme des cellules souches pour les hépatocytes.
For certain indications, transplantation of isolated hepatocytes has been proposed as an alternative to whole organ transplantation [6]. Animal experiments [7-10] and clinical trials with isolated liver cell transplantation [11-13] have produced encouraging results. There have been however very few trials because of the technical problems involved: imperfect control of hepatocyte cryopreservation, small number of transplantable cells, requirement for immunosuppression. Recent work has demonstrated that hematopoietic stem cells isolated from murine bone marrow can differentiate in vivo into different cell types including myocytes, endothelial cells, and hepatocytes [14-16]. In humans, cells coming from the donor bone marrow expressing characteristic features of hepatocytes have been demonstrated in the liver of patients with a liver or bone marrow graft [17, 18]. Several animal studies [19, 20] have also shown than bone marrow cells can differentiate into hepatocytes which can repopulate the liver partially. However, for these models, particular conditions had been created by sublethal radiation of the host and bone marrow graft or by hepatic
Introduction Allogenic liver transplantation is the gold-standard treament for chronic liver disease and fulminant hepatitis but its application is limited by organ shortage which persists despite the development of split-organ and living donor techniques [1-4]. Xenografting and cell therapy are two avenues of research offering potential alternatives or complementary solutions to the problem of graft procurement. At the present time, xenografts using swine organs has not reached the clinical phase due to acute xenogenic rejection and the risk of retroviral infection [5]. Cell therapy by transplanted isolated hepatocytes or bone marrow cells is also an attractive solution. Reprints: J.-M. REGIMBEAU, , Service de Chirurgie Digestive, Hôpital Nord Amiens, Université de Picardie, Place Victor Pauchet, 80054 Amiens Cedex 01. E-mail : [email protected]
453
N. Kohneh-Shahri et al.
injury induced with carbon tetrachloride [21] or a Fas receptor agonist antibody [22] to amplify differentiation. The differentiation of bone marrow cells into hepatocytes is a rare phenomenon and limited to a very small proportion of cells which remain to be characterized. To observe even partial repopulation of the liver with transplanted cells, i.e. either with hepatocytes or stem cells, such cells appears to require a selective growth advantage over native hepatocytes [23]. Stem cells would be better than hepatocytes because the use of an autograft avoids the risk of rejection and enables repeated grafts if required.
were washed twice in DMEM before intraportal injection to avoid immune reaction against the FCS. A total of 4.106 cells were injected. Anesthesia was performed with ether to enable a two-thirds hepatectomy, intraportal injection of bone marrow cells and animal sacrifice. The liver was removed and weighed and several liver samples were obtained. Hepatectomy used the standard method for two-third resection [31]. Briefly, after ligation of the pedicule and resection of the two largest lobes, the median and the left, the remaining liver was composed of the caudate and epiploic lobes. Intraportal injections of bone marrow cells from wild (DDP IV+) Fischer F344 male rats were performed on all animals. Injections were made immediately after hepatectomy when performed and during the same laparotomy. Retrorsine (RS, Sigma, France) was supplied as a powder and dissolved in 10 ml sterile water with HCl (pH 2.5) then neutralized with NaOH (0.1 N) to pH 7, followed by addition of 0.15 mol/L NaCl prepared separately with distilled water to obtain a final solution of 6 mg/mL retrorsine [28, 29]. Retrorsine blocks hepatocyte division between phase "S" and "G2" of the cell cycle. Cells remain blocked after DNA synthesis and before phase "M" division [28]. The effect of retrorsine persists for several months in treated hepatocytes, particularly after partial hepatectomy, and the hepatocytes disappear progressively by apoptosis [29]. Thirteen female F344 rats (group R) and nineteen male F344 DPP IV- rats (group RH) were given two intraperitoneal injections of 30 mg/kg retrorsine two weeks apart.
Complementary studies have examined the degree of hepatic repopulation and the origin of the repopulating stem cells. In the long-term, the hepatocyte population expresses an inconstant chimerism, which can be identified in the liver or bone marrow graft by cross sexing or fusion of bone marrow cells then differentiation of embryonic cells [24, 25]. The purpose of this study was to test the capacity of bone marrow cells to repopulate livers in a rat model favorable for such repopulation. The experimental protocol was designed after the model reported by Laconi et al. [26, 27] but bone marrow cells were transplanted instead of hepatocytes. In the present work, the selective growth advantage of injected cells was induced by blocking cell division of native hepatocytes with retrorsine, a pyrrolizidine alkaloid [28-30].
Experimental protocol for labeling cells injected via the portal vein
Methods
In this model, because of the predictable problems in identifying injected cells, two methods were used to characterize transplanted cells within native liver:
Recipient animals were wild 6-week-old female Fischer F344 rats (Iffa Credo, France) (mean weight 120 g) and 6-week-old male Fischer 344 rats deficient in dipeptidyl peptidase (DPPIV-) (Charles River, Japan) (mean weight 100 g). DDP IV- rats have a point mutation blocking expression of dipeptidyl peptidase; this deficiency labels injected cells. DDP is a membrane enzyme which, in the hepatocytes of wild animals, is found on the apical border. The animals had access to water and feed at all times and were raised in compliance with the European Council Directives of November 24th 1986. Bone marrow cells were harvested from donor animals and prepared extemporaneously using total bone marrow extracted from the femurs and tibias of male Fischer F344 rats not deficient in DDP IV (DPP IV+). Total bone marrow was obtained by purging the medullary canal of long bones with a 26 G needle. Cells were then suspended in Dulbecco’s Modified Eagle’s Medium (DMEM) + 10% fetal calf serum (FCS) + % antibiotics (10000 IU/mL penicillin and 10000 µg/mL streptomycin). Cells were filtered and centrifuged twice at 1400 rpm for ten minutes at 4°C before typan blue staining for counting on a Malassez slide. Bone marrow cells
RETRORSINE PROTOCOL – SEARCH FOR CHROMOSOME Y (GROUP R) (figure 1a) Two weeks after the last injection of retrorsine, the thirteen female F344 rats received, during lapraotomy, an intraportal injection of 4.106 bone marrow cells harvested from male F344 rats. Groups of three rats were sacrificed on days 7, 14, 28, and 56 after surgery and one rat on day 84. Liver samples were submitted to polymerase chain reaction (PCR) to search for chromosome Y in transplanted cells.
RETRORSINE PROTOCOL AND TWO-THIRDS HEPATECTOMY — DDP ACTIVITY (GROUP RH) (figure 1b) Four weeks after the last retrorsine injection, the time necessary to avoid unacceptable post-hepatectomy mortality, nineteen male DPP IV- rats
B Retrorsine two-third hepatectomy protocol (group RH) Recipient animals: male Fischer F344 DPP IV– rats
A Retrorsine protocol (group R)
Animal sacrifice DPP IV activity on liver samples
Recipient animals : female F344 DPP IV+ rats Animal sacrifice PCR of liver samples
day 1 an 14 : injection of retrorsine (30 mg/kg)
day 1 and 14 : injection of retrorsine (30 mg/kg) 42 (d0) 1
28 (d0) 1
14
35 (d7)
42 (d14)
56 (d28)
84 (d56) 112 (d84) Time (days)
Day 0 : intraportal injection of bone marrow cells from male Fischer F344 DPP IV+ rats labeled by chromosome Y
a b
14
56 (d14)
70 (d28)
84 (d42)
98 (d56) time (days)
d0 : two-third hepatectomy and intraportal injection of bone marrow cells from male Fischer F344 DPP IV+ rats labeled by their DPP IV activity
Fig.1 – a) Diagram group R: retrorsine injection intraperitoneally at day 1 and 14, laparotomy and bone marrow cell injection via portal vein at day 28 (D0), animal sacrifices within regular intervals. b) Diagram group RH: retrorsine injection intraperitoneally at day 1 and 14, laparotomy, 2/3 hepatectomy and bone marrow cell injection via portal vein at day 42 (D0), animal sacrifices within regular intervals. a) Schéma groupe R : injection intrapéritonéale de rétrorsine au 1er et 14ème jour, laparotomie et injection intraportale des cellules médullaires au 28ème jour (J0), sacrifice des animaux à intervalle régulier. b) Schéma groupe RH : injection intrapéritonéale de rétrorsine au 1er et 14ème jour, laparotomie, hépatectomie des 2/3 et injection intraportale des cellules médullaires au 42ème jour (J0), sacrifice des animaux à intervalle régulier.
454
Liver repopulation trial
underwent two-thirds hepatectomy followed by intraportal injection of 4.10 bone marrow cells which had been harvested from wild male Fischer F344 rats (DPP IV+). These cells could be identified by their dipeptidyl peptidase activity. The animals were sacrificed at days 14, 28, 42, and 56 after surgery (one animal at each date because of the high mortality with this protocol, N = 11 rats). Transplanted cells were demonstrated by search for dipeptidyl peptidase activity using histochemistry methods on liver slices.
Migration of the final product took place on 2% aragose gel in the presence of ethidium bromide for one hour at 150V. Each PCR series included a blank sample (without DNA), a positive control (male rat liver) and a negative control (female rat liver). PCR was performed on two liver samples from each sacrificed rat. Complementary experiments were also conducted, particularly to determine the quantity of DNA necessary to obtain the best amplification. This quantity was 50 ng (figure 2a).
SEARCH FOR DIPEPTIDYL PEPTIDASE ACTIVITY (GROUP RH)
Control groups
DPP IV activity was demonstrated on 5 µm slices of tissue frozen at -70°C after immersion in methyl butane (Sigma Aldrich, France). Tissues were fixed in acetone chloroform for 10 min then incubated with glycyl L praline 4 methoxy 2 naphthylamide (Sigma Aldrich, France) and 1 mg/mL fast blue B (Sigma Aldrich, France) for 30 min [33]. Histological analysis was not possible in group R because of the cyropreservation of the samples.
RETRORSINE PROTOCOL (GROUP R) Chromosome Y detected in hepatocytes and bone marrow cells in male rats was the positive control for this cell labeling method. The negative control consisted of the absence of chromosome Y in liver samples from four female rats which had received injections of bone marrow cells from syngenic female rats.
DEMONSTRATION OF SMALL HEPATOCYTES In this study, hepatic regeneration in group RH occurred not from injected bone marrow cells but from small hepatocytes, described previously by Prof. Coleman’s team. A study of tissues frozen in liquid nitrogen and preserved at -80°C was conducted according to the technique described by this team [34-36] to determine whether the small hepatocytes observed were the same as previously described.
RETRORSINE PROTOCOL AND TWO-THIRDS HEPATECTOMY (GROUP RH) DPP IV activity present in liver and bone marrow cells of DDP IV+ rats was the positive control for this labeling method. The absence of this activity in liver and bone marrow samples of DPP IV- rats was the negative control.
Results
POLYMERASE CHAIN REACTION (PCR) IN THE PRESENCE OF CHROMOSOME Y (GROUP R)
Retrorsine group (group R)
Chromosome Y was detected by PCR of the sry fragment situated on the short arm of chromosome Y [32]. DNA was extracted with the DNeasy Tissue kit (Qiagen, France). The quantity of DNA was estimated by measuring the absorbance at 260 nm. The DNA obtained was preserved at -20°C until PCR amplification. Fifty ng DNA were mixed in 37.5 µL sterile water, 5 µL 10X buffer (Gibco, France), 1.5 µL MgCL2 (50 mM) (Gibco, France), 1 µL DNTP (2.5 mM), 1.5 µL oligo-sense at 100 ng/µL and 1.5 µL nonsense at 100 ng/µL (Genst Oligos, France) and 0.5 µL Taq polymerase (Promega, France). The oligo-sense and nonesense sequence used were: 5’ GATTTTTAGTGTTCAGCCCT 3’ and 5’ TGCAGCTCTACTCCAGTCT 3’. The amplified sequence had 459 base pairs. Heat cycle conditions were: 1 min at 95°C then 35 1-min amplification cycles with denaturation at 94°C, 30s hybridization at 53°C, and 1 min elongation at 72°C, followed by a final step of 1 min at 72°C.
There were no deaths among the 13 rats in group R during the experimental protocol.
INTRAOPERATIVE OBSERVATIONS The liver presented a congestive aspect but no signs of chronic disease (ascites, portal hypertension) at injection of bone marrow cells on day 0 then at sacrifice on days 7, 14, 28, 56 and 84. Inflammatory adhesions tightly connected the liver with neighboring organs. There were no detectable tumor formations at any of the sacrifice times. Mean weight of the liver was: 5 g on
a b Fig.2 – a) PCR technical conditions: the PCR products were separated by electrophoresis in 2% agarose gel during one hour with 150 Volts and stained with ethidium bromide to determine the genomic DNA quantity to amplify. The strongest clear signal was obtained at the time of 50 ng genomic DNA. b) PCR products (identical condition appears 3A) obtained with liver tissue at D56 after bone marrow male derived cells injection via portal vein. No male cell was detected in spite of favorable amplification conditions (strong clear pilot positive signal). a) Mise au point technique (PCR) : image d’électrophorèse sur un gel d’agarose à 2 % en présence de bromure d’éthidium pendant une heure à 150 Volts, pour déterminer la quantité d’ADN génomique à amplifier. Le meilleur signal était obtenu lors de l’amplification de 50 ng d’ADN. b) Image du gel de PCR (conditions identiques figure 3a) à partir des prélèvements hépatiques à J56 de l’injection intraportale de cellules médullaires provenant de rats mâles. Aucune cellule mâle n’a été détectée, malgré des conditions favorables à l’amplification (témoin positif fortement amplifié).
455
N. Kohneh-Shahri et al.
as well as rare clusters of small hepatocytes (figure 3). At day 14, hepatocyte necrosis predominated with areas of inflammation and persistence of numerous apoptotic bodies. At this time, rare DPP IV+ cells were observed around the portal spaces (figure 4). At day 28, several DPP IV+ cells were observed in the hepatic parenchyma. On days 42 and 56, major hepatic regeneration had developed from several foci of small hepatocytes situated within pathological hepatic parenchyma (figure 5), but none of which expressed DDP IV+ activity. No DDP IV+ cells could be detected among the hepatocytes and the bone marrow cells of DDP IV- rats (negative controls). Hepatocytes and bone marrow cells from DDP IV+ rats strongly expressed DDP IV+ activity (positive controls).
day 7, 6.3 g on day 14, 6.7 g on day 28 and day 56 and 8 g on day 84 after injection of bone marrow cells.
DETECTION OF TRANSPLANTED BONE MARROW CELLS Despite technical improvements, no male cells could be detected with PCR at days 14, 28, 56, and 84 (figure 2b). Concomitant examination of the female rat liver which had been injected with bone marrow cells coming from syngenic animals of the same sex (negative controls), demonstrated the absence of contamination during the manipulations. Chromosome Y was detected in hepatocytes and in bone marrow cells of male rats.
Retrorsine group and two-thirds hepatectomy (group RH)
CHARACTERIZATION
Mortality in the experimental group (N = 19 rats) was 58% (eight deaths during the first 48 postoperative hours and three deaths from the third to ninth postoperative day). Four rats were still alive at the end of the protocol.
OF THE SMALL HEPATOCYTES
Hepatic regeneration was observed in both groups of animals (R and RH) either as an increase in the hepatic mass (group R) or as the presence of regeneration foci (group RH). Our cell labeling technique did not allow identification of the origin of cells regenerating in group R but did in group RH. In group RH, hepatic regeneration did not originate from injected cells, but from small native hepatocytes. Secondary characterization of the small hepatocytes observed in group RH by Professer Coleman’s team enabled the demonstration that these small hepatocytes expressed certain markers of mature hepatocytes (albumin and transferin), and of embryonic and fetal hepatocytes (HNF 1, 4, and 6). This co-expression of hepatocyte markers of different developmental stages, which produced a specific phenotype, enabled confirmation that the small hepatocytes observed in group RH were the same as previously described by this team [34-36] (figure 6).
INTRAOPERATIVE OBSERVATIONS There were no signs of liver disease (ascites, collateral circulation) at hepatectomy and at injection on day 0; there were no adhesions. At sacrifice (after hepatectomy and injection of bone marrow cells) the following observations were made: ascites and collateral circulation on the abdominal wall as well as strong perihepatic adhesions on day 14; presence of collateral circulation without associated ascites and persistent strong perihepatic adhesions on day 28; presence of strong perihepatic adhesions on days 42 and 56. No tumor formations were observed at any of the sacrifice times. Mean weight of the liver at sacrifice was 5.7 g at day 28, 4.2 g and 4 g at days 42 and 56 respectively after hepatecomy and injection of bone marrow cells.
Discussion The purpose of this study was to test the capacity of bone marrow cells to colonize and repopulate rat livers in a model favorable for such repopulation. The experimental protocol for this study was designed after the protocol published by Laconi et al. [26, 27] but using bone marrow cells instead of hepato-
DETECTION OF BONE MARROW CELLS Examination of the histological slides of specimens taken at hepatectomy and injection of bone marrow cells (day 0) demonstrated the presence of several apoptotic bodies and megalocytes
3 4 Fig. 3 – Histological analysis from a F344 DPP IV- rat’s liver tissue (group RH) (fixed sections, HES coloration) at D0: note the necrosis area (fine black arrow) and many apoptotic bodies (white arrow) (x 400). Examen histologique d’un prélèvement hépatique d’un rat Fischer F344 DPP IV- (groupe RH) (tissu formolé, coloration HES) à J0 : à noter la présence d’un aspect de nécrose hépatocytaire (flèche noire fine) et de nombreux corps apoptotiques (flèche blanche) (x 400). Fig. 4 – Histochemical analysis from a Fischer F344 DPP IV- rat’s liver tissue (groupe RH) at D14 after 2/3 hepatectomy and bone marrow DPP IV+ cells infusion. (cryosections, fast blue BB coloration). Note two DPP IV+ cells presence in periportal area (fine black arrow) (x 400). Examen par histochimie d’un prélèvement hépatique d’un rat Fischer F344 DPP IV- (groupe RH) à J14 après hépatectomie 2/3 et injection de cellules médullaires DPP IV+ (tissu congelé, coloration fast blue BB). Présence de deux cellules DPP IV+ autour d’un espace porte (flèche noire fine) (x 400).
456
Liver repopulation trial
rare positive cells were detected in the liver lobes which might suggest the bone marrow cells had migrated into the hepatic parenchyma as has been described after transplantation of mature hepatocytes [27]. At six weeks, there were several clusters of regeneration composed of small hepatocytes. However, none of these regeneration clusters was labeled for DPP IV+ activity. Moreover, no DDP IV+ cell could be demonstrated in the liver at this time. We do not know what happened to the injected cells and thus cannot determine whether they integrated the bone marrow or circulating cells or whether they were simply eliminated. The hypothesis of elimination is not very likely since the injected cells were bone marrow cells coming from syngenic animals so immunological rejection would be unlikely. For the two groups in this study, with and without hepatectomy, hepatic regeneration occurred either by increased hepatic mass (retrorsine group) or by presence of several clusters of regeneration (retrorsine hepatectomy group). This regeneration could be explained either by ineffective retrorsine blockade of native hepatocytes or by hepatic regeneration from native liver stem cells or from injected bone marrow cells, or both. There is no reason to retain the hypothesis of retrorsine inefficacy since this injury model has been used at the same dose and in similar conditions in experiments reported by several other teams. In addition, the presence of apoptotic bodies, megalocytes, and small clusters of hepatoctyes (group RH) at the histological examination is on the contrary in favor of the efficacy of retrorsine. Laconi et al. [27] were able to demonstrated preferential liver regeneration from transplanted mature hepatocytes compared with native liver stem cells, but there is no reason to extrapolate these results to transplantation of bone marrow cells. This is the main reason for using two labeling methods for injected cells to distinguish between the origin of the regeneration observed in this study.
Fig. 5 – Histological analysis from a F344 DPP IV- rat’s liver tissue (group RH) at D42 after 2/3 hepatectomy and bone marrow DPP IV+ cells infusion (fixed sections, HES coloration). Note small hepatocytes (fine black arrow) regenerative clusters (white arrow) in an abnormal parenchyma (x200). None of these cells expressed dipeptidyl peptidase activity. Examen histologique d’un prélèvement hépatique d’un rat Fischer F344 DPP IV- (groupe RH) à J42 après hépatectomie 2/3 et injection de cellules médullaires DPP IV+ (tissu formolé, coloration HES), présence de nombreux nodules de régénération (flèche blanche) constitués de petits hépatocytes (flèche noire fine) au milieu d’un parenchyme d’aspect pathologique (x 200 ). Aucune de ces cellules n’exprimait l’activité DPP IV+.
cytes. Hepatic regeneration was observed in both groups of animals, either as an increase in hepatic mass or as the presence of regeneration clusters. In the retrorsine group, PCR failed to recognize any male cells in the multiple liver samples. In the retrorsine hepatectomy group, two and four weeks after their injection, DPP IV+ cells were visible in the periportal zone and in the hepatic parenchyma, but without a cluster aspect. These cells could not be identified in later samples which exhibited several regenerating foci composed of hepatocytes. Hepatic regeneration thus occurred not from the injected bone marrow cells but from small hepatocytes. These hepatocytes are the same as were observed in the experiments reported by Gordon et al. [34-36] as the origin of complete liver regeneration.
It is known that complete liver regeneration from mature native hepatocytes can occur after hepatectomy. Laconi et al. [26, 27] demonstrated that by blocking the capacity of native hepatocytes to divide, with or without hepatectomy, the largest part of the regeneration occurs from transplanted mature hepatocytes. In this experiment, and without irradiation the bone marrow, hepatic regeneration occurred exclusively from small native hepatocytes. This absence of irradiation is important because hepatic regeneration from small hepatocytes has not been observed after radiotherapy [22, 38]. Gordon et al. [34] observed the presence of small hepatocytes after two injections of retrorsine and hepatectomy. These small hepatocytes were the source of complete hepatic regeneration with no cell therapy. The small hepatocytes observed in the present study are the same as studied by this team: they have the particular marking of fetal hepatocytes (EA 18 — EA 20), hepatoblasts (EA 14), oval cells (OC2, OC) and mature hepatocytes (antigen H, albumin and transferin) [35]. They do not express markers of bone marrow cells (CD34 and Thy1). They would also be resistant to retrorsine due to the lack of or weak expression of their P450 hepatic cytochrome enzymes (CYP 2E1 and CYP 3A1) which transform retrorsine into its active toxic form [34, 35]. The origin of these small hepatoctyes is not known. However, given their site of emergence and their cell labeling characteristics, it can be assumed that they do not come from oval cells (because they are OV6-) nor bone marrow stem cells (because they are CD34and Thy1-). A recent study designated mature hepatocytes as the source of these small hepatoctyes: labeling mature heaptocytes with the beta galactosidase gene enabled Avril et al. [39] to observe the expression of this gene by small hepatocytes after injection of retrorsine and hepatectomy. Gordon et al. [36] successfully isolated these small hepatocytes and were able to maintain them in culture for 30 days. They then transplanted them into the hepatic parenchyma where they were capable of integration and division among other mature hepatocytes after hepatectomy. The expression of these small hepatocytes is not
In the retrorsine model, PCR was used to identify the injected bone marrow cells. In situ hybridization with immunofluorescence would have enabled identifying the exact localization of transplanted cells and any differentiation of these cell by double labeling but, to our knowledge, this technique is not available in France. All PCR amplifications (35 cycles) were negative. The absence of hepatic regeneration from injected bone marrow cells could be explained either by the absence of a selection advantage for transplanted cells compared with native stem cells, or by a lack of a sufficiently powerful stimulus for regeneration. In this model derived from the model described by Laconi et al. [26] the absence of hepatectomy, ensures that repopulation occurs later after hepatocyte transplantation and is less massive. For future studies, the stimulus might be amplified by stimulating injected cells capable of division (not blocked by retrorsine) with thyroxine and accelerated cell death by apoptosis of blocked cells [37]. The risk of false negatives is low because of the sensitivity of the PCR technique which can detect one cell in one million. The retrorsine hepatectomy model differs from the preceding model not only because the labeled cells can be identified but also because their localization can be recognized with characterization by immunolabeling. In this model, stimulation of the regeneration is amplified by two-thirds hepatectomy in addition to retrorsine injection. Two weeks after the injection, DPP IV+ cells were observed around the portal spaces. At four weeks, 457
N. Kohneh-Shahri et al.
a b c Fig.6 – Characterization of small hepatocytes (Pr. Coleman): co expression by small hepatocytes of Hnf 1,6 and albumin (phenotype of a hepatic cell between embryonic and fetal phase). (ABC) Caractérisation des petits hépatocytes (Pr.Coleman) Mise en évidence d’une coexpression par les petits hépatocytes de l’Hnf 1,6 et l’albumine (phénotype d’une cellule hépatique entre la phase embryonnaire et fœtale).
constant since there was no hepatic regeneration in the work reported by Dahkle et al. [38], despite treatment with retrorsine but with radiation and after bone marrow grafting and CCL4 hepatic injury.
hepatocytes for regeneration and the probable existence of certain subpopulations of hepatocytes which are less sensitive to chemical injury. One of the possible avenues for future research would be to isolate these specific subpopulations of hepatocytes and cultivate them for use with cell therapy strategies.
After the initial enthusiasm raised by the first experimental results on hepatic repopulation using transplanted bone marrow cells for fuaryl acetoacetate hydrolase deficient mice using the Lagasse et al. model [19], further work demonstrated that bone marrow cell hepatic repopulation is only a possible but rare event, even in the presence of very strong selection pressure [22]. Similarly, in humans, the chimerism of hepatocytes observed during bone marrow or hepatic transplantation demonstrated by sex-crossing appears to be an inconstant phenomenon which regresses over the years [24]. This point is also being re-examined for other organisms, particularly for the myocardium: recent experimental work questioned the differentiation of bone marrow cells into myocytes during myocardial infarction [40, 41] in contrast with earlier encouraging results reported by Ferrari [15] and Orlic [16]. It would thus appear that bone marrow cells are less plastic than expected and that although they can differentiate, the phenomenon is rare, making it a difficult tool for exploitation with the current state of the art.
REFERENCES
1. Bismuth
H, Houssin D. Reduced — sized orthotopic liver graft in hepatic transplantation in children. Surgery 1984;95:367-70.
2. Houssin D, Soubrane O, Boillot O, Dousset B, Ozier Y, Devictor D, et al. Orthotopic liver transplantation with a reduced-size graft: An ideal compromise in pediatrics? Surgery 1992;111:532-42.
3. Raia
S, Nery JR, Mies S. Liver transplantation from liver donors. Lancet 1989;2:497.
4. Boillot O, Dawahra M, Porcheron J, Houssin D, Boucaud C, Gille D, et al. Transplantation hépatique pédiatrique et donneur vivant apparenté. Ann Chir 1993;47:577-85.
5. White SA, Nicholson ML. Xenotransplantation. Br J Surg 1999;86: 1499-514.
6. Regimbeau JM, Mallet VO, Bralet MP, Gilgenkrantz H, Houssin D, Soubrane O. Transplantation d’hépatocytes isolés : principes, mécanismes, applications expérimentales chez l’homme. Gastroenterol Clin Biol 2002;26:591-601.
In this experimental model where transplanted bone marrow cells and native hepatic stem cells are in competition, only endogenous hepatic cells participated in liver regeneration seen as clusters of small hepatocytes. While these small hepatocyts arise from mature hepatocytes, as was demonstrated by Avril et al. [39], it is also possible, in the present model, to consider that hepatic regeneration occurred from a specific set of hepatocytes. This model again favors a very strong capacity of native
7. Eguchi S,
Rozga J, Lebow LT, Chen SC, Wang CC, Rosenthal R, et al. Treatment of hypercholesterolemia in the Watanabe rabbit using allogeneic hepatocellular transplantation under a regeneration stimulus. Transplantation 1996;62:588-93.
8. Moscioni AD, Rozga J, Chen S, Naim A, Scott HS et Demetriou A. Long-term correction of albumin levels in the Nagase analbuminemic
458
Liver repopulation trial
26. Laconi S, Pillai S, Porcu PP, Shafritz DA, Pani P, Laconi E. Massive
rat: repopulation of the liver by transplanted normal hepatocytes under a regeneraion response. Cell Transplantation 1996;5: 499-503.
liver replacement by transplanted hepatocytes in the absence of exogenous growth stimuli in rats treated with retrorsine. Am J Pathol 2001;158:771-7.
9. Kobayashi N, Ito M, Nakamura J, Cai J, Gao C, Hammel JM, et al. Hepatocyte transplantation in rats with decompensated cirrhosis. Hepatology 2000;31:851-7.
27. Laconi E, Oren R, Mukhopadhyay DK, Hurston E, Laconi S, Pani P, et al. Long- term, near-total liver replacement by transplantation of isolated hepatocytes in rats treated with retrorsine. Am J Pathol 1998; 153:319-29.
10. Malhi H, Irani AN, Volenberg I, Schilsky ML, Gupta S. Early cell transplantation in LEC rats modeling Wilson’s disease eliminates hepatic copper with reversal of liver disease. Gastroenterology 2002; 122:438-47.
28. Laconi S, Curreli F, Diana S, Pasciu D, De Filippo G, Sarma DS, et al.
11. Bilir BM, Guinette D, Karrer F, Kumpe DA, Krysl J, Stephens J, et al.
Liver regeneration in response to partial hepatectomy in rats treated with retrorsine: a kinetic study. J Hepatol 1999;31:1069-74.
Hepatocyte transplantation in acute liver failure. Liver Transplatation 2000; 6:32-40.
29. Gordon GJ, Coleman WB, Grisham JW. Bax-mediated apoptosis in
12. Fox IJ, Chowdhury JR, Kaufman SS, Goertzen TC, Chowdhury NR,
the livers of rats after partial hepatectomy in the retrorsine model of hepatocellular injury. Hepatology 2000;32:312-20.
Warkentin PI, et al. Treatement of the Crigler-Najjar syndrome type I with hepatocyte transplantation. N Engl J Med 1998;338:1422-6.
30. Laconi E, Sarma DSR, Pani P. Transplantation of normal hepatocytes
13. Muraca M, Gerunda G, Neri D, Vilei MT, Granato A, Feltracco P,
modulates the development of chronic liver lesions induced by a pyrrolizidine alkaloid lasiocarpine. Carcinogenesis 1995;16:139-42.
et al. Hepatocyte transplantation as a treatment for glycogen storage disease type 1a. Lancet. 2002;359:317-8.
31. Higgins GM, Anderson RM. Experimental pathology of the liver: restoration of the liver of the wright rat following partial surgical removal. Arch Pathol 1931;12:186-202.
14. Krause
DS, Theise ND, Collector MI, Henegariu O, Hwang S, Gardner R, et al. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 2001;105:369-77.
32. An J, Beauchemin N, Albanese J, Abney TO, Sullivan AK. Use of a rat cDNA probe specific for the Y chromosome to detect male-derived cells. J Androl 1997;18:289-93.
15. Ferrari
G, Cusella-De Angelis G, Coletta M, Paolucci E, Stornaiuolo Cossu G, Mavilio F. Muscle regeneration by bone marrow-derived myogenic progenitors. Science 1998;279:1528-30.
33. Rajvanshi P, Kerr A, Bhargava KK, Burk RD, Gupta S. Studies of liver repopulation using the dipeptidyl peptidase IV — deficient rat and other rodent recipient cell size and structure relationships regulate capacity for increased transplanted hepatocyte mass in the liver lobule. Hepatology 1996;23:482-96.
16. Orlic D, Kajstura J, Chimenti S, Jakoniuk I, Anderson SM, Li B, et al. Bone marrow cells regenerate infarcted myocardium. Nature 2001;410:701-5.
17. Theise
ND, Nimmakayalu M, Gardner R, Illei PB, Morgan G, Teperman L, et al. Liver from bone marrow in humans. Hepatology 2000;32:11-16.
34. Gordon GJ, Coleman WB, Hixson C, Grisham JW. Liver regeneration in rats with retrorsine-induced hepatocellular injury proceeds through a novel cellular response. Am J Pathol 2000;156:607-19.
18. Alison MR, Poulsom R, Jeffery R, Dhillon AP, Quaglia A, Jacob J,
35. Gordon GJ, Coleman WB, Grisham GW. Temporal analysis of hepa-
et al. Hepatocytes from non hepatic adulte stem cells. Nature 2000; 406:257.
19. Lagasse E, Connors H, Aldhalimy M, Reitsma M, Dohse M, Osborne L,
tocyte differentiation by small hepatocyte-like progenitor cells during liver regeneration in retrorsine — exposed rats. Am J Pathol 2000; 157:771-86.
et al. Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nature 2000;6:1229-34.
36. Gordon GJ, Butz GM, Grisham GW, Coleman WB. Isolation, shortterm culture, and transplantation of small hepatocyte like prognitor cells from retrorsine-exposed rats. Transplantation 2002;73:1236-43.
20. Theise ND, Badve S, Saxena R, Henegariu O, Sell S, Crawford JM, et al. Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 2000;31:235-40.
37. Oren
R, Dabeva MD, Karnezis AN, Petkov PM, Rosencrantz R, Sandhu JP, et al. Role of thyroid hormone in stimulating liver repopulation in the rat by transplanted hepatocytes. Hepatology 1999; 30:903-13.
21. Petersen
B, Bowen WC, Patrene KD, Mars WM, Sullivan AK, Murase N, et al. Bone marrow as a potential source of hepatic oval cells. Science 1999;284:1168-70.
38. Dahlke MH, Popp FC, Bahlmann FH, Aselmann H, Jager MD, Neipp M,
22. Mallet VO, Mitchell C, Mezey E, Fabre M, Guidotti JE, Renia L, et al.
et al. Liver regeneration in a retrorsine/CCL4 — induced acute liver failure model: do bone marrow-derived cells contribute? J Hepatol 2003;39:365-73.
Bone marrow transplantation in mice leads to a minor population of hepatocytes that can be selectively amplified in vivo. Hepatology 2002;35:799-804.
39. Avril A, Pichard V, Bralet MP, Ferry N. Mature hepatocytes are the
23. Mallet
source of small hepatocyte-like progenitor cells in the retrorsine model of liver injury. J Hepatol 2004;41:737- 43.
VO, Regimbeau JM, Mitchell C, Guidotti JE, Soubrane O, Gilgenkrantz H. Stratégies de repeuplement du foie par avantage sélectif. Gastroenterol Clin Biol 2002;26:480-5.
40. Murry CE, Soonpaa MH, Reinecke H, Nakajima H, Nakajima HO,
24. Fogt F, Beyser KH, Poremba C, Zimmerman RL, Khettry U, Ruschoff J.
Rubart M, et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature 2004;428:664-8.
Recipient- derived hepatocytes in liver transplants: a rare event in sexmismatched transplants. Hepatology 2002;36:173-6.
41. Balsam
LB, Wagers AJ, Christensen JL, Kofidis T, Weissman IL, Robbins RC. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature 2004;428:668-73.
25. Terada. Bone marrow cell adapt the phenotype of other cells by spontaneous cell fusion. Nature 2002;416:542.
459