- Email: [email protected]
FOXP2 axis
Journal Pre-proof lncRNA XIST attenuates hypoxia-induced H9c2 cardiomyocyte injury by targeting the miR-122-5p/FOXP2 axis Hui Peng, Yuxuan Luo, Yongjun Ying PII:
S0890-8508(19)30415-3
DOI:
https://doi.org/10.1016/j.mcp.2019.101500
Reference:
YMCPR 101500
To appear in:
Molecular and Cellular Probes
Received Date: 26 October 2019 Revised Date:
12 December 2019
Accepted Date: 25 December 2019
Please cite this article as: Peng H, Luo Y, Ying Y, lncRNA XIST attenuates hypoxia-induced H9c2 cardiomyocyte injury by targeting the miR-122-5p/FOXP2 axis, Molecular and Cellular Probes (2020), doi: https://doi.org/10.1016/j.mcp.2019.101500. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.
Author Contribution： ： Hui Peng：Data curation, Methodology, Formal analysis, Software，Writing – original draft Yuxuan Luo：Formal analysis, Software, Data curation, Visualization Yongjun Ying：Funding acquisition，Resources, Supervision;, Writing – review & editing.
lncRNA XIST attenuates hypoxia-induced H9c2 cardiomyocyte injury by targeting the miR-122-5p/FOXP2 axis Hui Peng1, Yuxuan Luo2, Yongjun Ying1* 1 Department of Cardiology, Tongde Hospital of Zhejiang Province, 234 Gucui Road, Hangzhou, Zhejiang, China 2 Department of Nephrology, Zhuji People's Hospital of Zhejiang province, Zhuji, Shaoxing, Zhejiang, China *Correspondence: [email protected] Abstract Objective: To investigate the effect of lncRNA XIST on apoptosis induced by hypoxia. Methods: We analyzed the expression levels of lncRNA XIST and miR-122-5p using RT-qPCR in hypoxia-induced cardiomyocytes. The mechanism by which lncRNA XIST affects myocardial ischemia was investigated using the cell transfection, CCK-8, and dual-luciferase reporter assays, as well as by flowcytometry, western blotting, and RNA immunoprecipitation. Results: Hypoxic H9c2 cells demonstrated a decrease in their migration and invasion abilities and XIST expression and an increase in the extent of their apoptosis and expression of microRNA-122-5p. Overexpression of XIST significantly increased the H9c2 cell viability, enhanced cell migration and invasion, and decreased cell apoptosis in a hypoxic environment. The luciferase activity of XIST-WT in H9c2 cells co-transfected with XIST-WT and microRNA-122-5p mimics had decreased. The results of RNA immunoprecipitation showed that XIST interacted directly with miRNA-122-5p. Overexpression of XIST decreased the level of miRNA-122-5p significantly. mi-122-5p mimics increased H9c2 cell apoptosis and downregulated FOXP2 expression. Overexpression of FOXP2 upregulated the expression of the Bcl-2 protein in H9c2 cells transfected with microRNA-122-5p mimics and inhibited the expression of HIF-alpha, Bax, and the cleaved-caspase 9 protein. Conclusion：lncRNA XIST could regulate the miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury. Keywords: lncRNA; XIST; hypoxia; cardiomyocyte injury; miR-122-5p; FOXP2. Ischemic cardiomyopathy is the leading cause of death in patients with cardiovascular diseases, worldwide[1]. Myocardial ischemia leads to an insufficient supply of oxygen and nutrients and causes functional damage to the cardiac myocytes. Myocardial cell injury, resulting in an expansion of the area of myocardial infarction, cardiac dysfunction, and even death, is the main reason for the development of ischemic cardiomyopathy[2] Therefore, understanding the mechanism of cardiomyocyte injury is the key to preventing cardiac injury and treating ischemic cardiomyopathy. MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules approximately 22 nucleotides in length encoded by endogenous genes involved in the regulation of ischemic cardiomyopathy by targeting the inhibition of mRNA transcription[3, 4]. The long-chain non-coding RNA (lncRNA) is a non-coding RNA over 200 nucleotides in length, which is mainly used to adsorb the miRNA-regulated target gene by the ceRNA mechanism[5-7]. The role of LncRNA is very wide. Many LncRNAs are currently known to be involved in the development of tumors[8-12]. While,there are 18,480 lncRNA expression abnormalities observed in patients with cardiovascular disease[13]. lncRNA ROR adsorbs miR-145 and activates the
PI3K/AKT pathway to inhibit hypoxia-induced cardiomyocyte apoptosis [14]. The lncRNA H19/miR-675 axis inhibits the expression of PPARα, promotes cardiomyocyte apoptosis, increases the area of myocardial infarction, and aggravates myocardial ischemic injury [15]. lncRNA MALAT1 adsorbs miR-320, relieves its inhibition downstream of the target gene PTEN, promotes cardiomyocyte apoptosis, and accelerates the development of myocardial infarction [16]. This indicates that the mechanism for the regulation of lncRNA-miRNA plays an important role in ischemic cardiomyopathy. lncRNA XIST has been extensively studied as a diagnostic marker for lung cancer, colorectal cancer and colorectal cancer [17-20]. Recent studies have shown that lncRNA XIST is involved in postischemia myocardial remodeling and significantly under-expressed in diabetic cardiomyopathy and cardiomyocyte hypertrophy[14-15]. However, its role in ischemic cardiomyopathy and its molecular mechanisms have still been reported -. miR-122-5p is highly expressed in cardiovascular diseases such as coronary arteriosclerosis, amyloid heart disease and myocardial ischemia, and is an important diagnostic marker for ischemic cardiomyopathy [21-23]. Analysis using the starBase database has revealed that lncRNA XIST and miR-122-5p have binding sequences. However, further confirmation is needed to determine whether lncRNA XIST negatively regulates miR-122-5p and affects the development of ischemic cardiomyopathy.
Methods Cell culture Rat H9c2 cells (ATCC, Rockville, MD) were cultured in Dulbecco's modified Eagle's medium (DMEM, Corning) containing 10% (v/v) fetal bovine serum (Gibco, 10099141C, Australia). The cells were incubated at 37°C in an atmosphere of 5% CO2.
CCK-8 assay The transfected cells were seeded in 96-well plates such that 1×104 cells were present per well. A Cell Counting Kit-8 (A311-01, Vazyme, Nanjing, China) was used to detect the viability of cells according to the manufacturer's instructions. The absorbance was measured at 450 nm. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from the cultured cells using the TRIzol reagent (15596026, Takara, Japan), as per the supplier's instructions. The PrimeScript RT Master Mix (TaKaRa, Dalian, China) was used to retrieve the extracted RNA into a cDNA. The PrimeScript RT kit and SYBR Premix Ex Taq (TaKaRa, Dalian, China) were used to perform the qRT-PCR and GAPDH was the internal control. The primers used were synthesized by Sangon (Shanghai, China). The primer sequence was as follows: XIST fw: 5′-AGGCTGGCTGGAATAAAGG-3′,rv: 5′-TATGAAAAGGGAGGCGTGGT-3′, rno-miR-122-5p fw: TGGAGTGTGACAATGGTGT, rv: CCAGTTTTTTTTTTTTTTTCAAACACC; FOXP2 Fw: 5'- AGTGTGCCCAATGTGGGAG -3', Rv: 5'CATGATAGCCTGCCTTATGAGTG -3'; GAPDH Fw: 5'GGAGCGAGATCCCTCCAAAAT-3'; Rv 5'-GGCTGTTGTCATACTTCTCATGG-3'. U6 Fw: 5'-GCGCGTCGTGAAGCGTTC-3', Rv: 5'-GTGCAGGGTCCGAGGT-3'. The conditions of PCR
reaction were as follows: 95oC, 95oC, and 60oC for 30 s, 5 s, and 34 s, respectively, for 40 cycles. The reaction was carried out on the ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The expression as the multiple of RNA relative to GAPDH was calculated using the formula 2-∆∆CT. Cell invasion and migration Invasion experiment: Matrigel was diluted to 1 mg/mL on ice using a pre-cooled serum-free medium and 40 µL per well was added to a Transwell chamber. This was incubated at 37°C for 2 h to allow the Matrigel to coagulate. Then, 100 µL and 600 µL of serum-free medium was added to the upper and lower chambers, respectively, and equilibrated overnight at 37°C. A cell suspension containing 1 × 106 cells/mL was prepared by resuspending in 100 µL of serum-free DMEM-F12, MEM. After this, 100 µL of the cell suspension and 600 µL of complete medium were added to the upper and lower chambers of a 24-well Transwell chamber, respectively, and the upper chamber was placed in the culture well. After incubating for 48 h at 37°C under conditions of 5% CO2, the upper chamber was removed, its cells were wiped with a tip, and the transwells were removed, inverted, and air-dried. Crystal violet at 0.1% concentration and 500 µL volume was added to the 24-well plate. The chamber was placed therein and the membrane was immersed in the medium at 37°C for 30 min, after which it was removed, and washed with PBS. Finally, 4 fields of view on the diameter were selected, imaged and counted. Migration experiment: The cells were incubated in the Transwell chamber for 24 h. The remaining steps were the same as those of the invasion experiment. Construction of the plasmid and cell transfection The XIST, XIST-WT, XIST-MT, and rno-miRNA-122-5p sequences were designed and synthesized by Tsingke (Nanjing, China), which were further subcloned into pcDNA3.1 (Invitrogen, Shanghai, China). Lipofectamine 3000 (Invitrogen, Shanghai, China) was used to transfect the plasmids containing XIST, XIST-WT, XIST-MT, rno-miRNA-122-5p sequences into the H9c2 cells. The sequences are shown in Figure 3B and Figure 5A. Western blot The cells were washed twice in ice-cold PBS and incubated on ice in 1X RIPA buffer (Beyotime, Shanghai), containing the 1X PhosSTOP protease inhibitor and 1X complete Protease Inhibitor Cocktail (Yeasen, Shanghai), for 30 min. The lysates were pre-cleared by centrifuging for 10 min and the protein was quantified using the Yeasen Protein Assay Kit (Yeasen, Shanghai). Then, 25 mg of protein lysate was resolved on an SDS-PAGE gel and transferred onto a PVDF membrane (Bio-Rad, Chicago, IL, USA). The blots were blocked using 5% skim milk, incubated with the primary antibody overnight at 4℃, after which, they were washed, and incubated with secondary antibody for 2 h at room temperature, followed by washing and visualization of the protein bands using an ECL chemiluminescence kit (Fude, Hangzhou, China). TUBULIN, GAPDH or histone H3 were used as the loading controls. The primary antibodies (RRID; dilution ratio) used were as follows: HIF-1α (Cat: 3434, 1:1000, CST), Bax (Cat:2272, 1:1000, CST), Bcl-2 (Cat: 2764, 1:1000, CST), cleaved caspase-9 (Cat: 7237, 1:1000, CST), pro caspase-9 ( Cat: 138412,1:1000, Abcam), Foxp2（Cat：16046，1:1000，Abcam), GAPDH (Cat: 307275, 1:2500,
Abcam). The secondary antibodies used were as follows: anti-mouse (Cat: 2340072, 1:10000, Abcam), anti-rabbit (Cat: 7074, 1:10000, CST). Luciferase reporter gene assay The H9c2 cells were seeded in 96-well plates and incubated at 37°C for 24 h. A XIST 3'-UTR-Luc vector with wild type (WT) or mutant (MT) was constructed at the miR-122-5p binding site of the 3' UTR region of lncRNA XIST. A FOXP2 3'-UTR-Luc vector with a wild type (WT) or a mutant (MT) gene was constructed at the miR-187-3p binding site of the 3'UTR region of the FOXP2. Using Lipofectamine 3000, the plasmids were co-transfected with the H9c2 cells and 48 h later, they were harvested and the luciferase activity was measured using a dual luciferase assay system (Promega, USA). Flowcytometry Apoptotic cells were detected using the Annexin V-FITC/propidium iodide (PI) Apoptosis Detection Kit after cell treatment. According to the manufacturer’s instructions, the stained cells were assayed by flow cytometry (FACS Calibur, BD Biosciences) after fixing them with a FACS fixed buffer (FACS buffer containing 1% paraformaldehyde). The positive cells were calculated and analyzed with the FlowJo software (Tree Star, Ashland, OR, USA). RNA immunoprecipitation The cells were lysed with the lysate containing the protease and RNA enzyme inhibitors, and then incubated with the Foxp2 antibody (Cat:16046, Abcam) coupled with magnetic beads. The purity and concentration of the immunoprecipitated RNA was measured by spectrophotometry, and the expressions of XIST and microRNA-122-5p were detected by qPCR. Statistical analysis Statistical analysis was performed using the GraphPad Prism7. The data are presented as the mean ± standard deviation. Statistical comparisons were performed using the paired t-test. P < 0.05 indicates that the difference is statistically significant.
Results Hypoxia induced H9c2 cell damage and downregulated XIST levels. When H9c2 cells were subjected to hypoxia at different time periods, we found that the cell viability decreased with respect to the time gradient (Figure 1A). Compared to the control group, hypoxia inhibited the migration and invasion ability of the H9c2 cells, while their apoptosis rates had increased (Figure 1B - Figure 1D). Furthermore, results of the western blot analysis revealed that the expressions of HIF-α, Bax, and the cleaved-caspase9 protein had increased, whereas those of the anti-apoptotic protein Bcl-2 had decreased (Fig. 1E). Additionally, we found that low oxygen significantly down-regulated the levels of XIST (Fig. 1F). These results suggested that XIST may be associated with hypoxia-induced H9c2 cell damage. Figure 1A: 1×105 cells were seeded in 96-well plates, 94% N2, 5% CO2, and 1% O2 at
different time points (0, 6, 12, 24, 48 h). Cell viability was measured by the MTT assay. B-C: H9c2 cells were subjected to hypoxic conditions for 48 h and Transwell was used to detect cell invasion and migration. D: H9c2 cells were subjected to hypoxic conditions for 48 h and the extent of apoptosis was detected using flow cytometry. E: H9c2 cells were subjected to hypoxic conditions for 48 h and the expression of related proteins was detected using western blotting. F: The H9c2 cells were cultured under conditions of hypoxia for 0, 6, 12, 24, and 48 h and qTP-PCR was used to detect the XIST levels. *p < 0.05, **p < 0.01, ***p < 0.001. Overexpression of XIST attenuates hypoxia-induced cardiomyocyte injury To investigate the role of XIST in hypoxia-induced cardiomyocyte injury, we successfully constructed the XIST overexpression plasmid (Fig. 2A). Overexpression of XIST significantly increased the viability of H9c2 cells under hypoxic conditions and enhanced their migration and invasion (Fig. 2B-2D). Additionally, the overexpression of XIST significantly downregulated the extent of apoptosis, which was accompanied by an increased expression of the anti-apoptotic protein Bcl-2 and decreased expression of HIF-α, Bax, and cleaved-caspase 9 proteins (Fig. 2E and Fig. 2F). We observed that the overexpression of XIST attenuated hypoxia-induced cardiomyocyte injury. Figure 2A: The lncRNA XIST overexpression plasmid and control plasmid were constructed and transfected into the H9C2 cells for 48 h. The XIST levels were detected using qRT-PCR. B: The XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia, and CCK8 was used to detect the cell viability. C-D: The XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia and Transwell was used to detect the cell invasion and migration. E: XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia and the extent of apoptosis was detected by flow cytometry. F: The XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia and the expressions of related proteins were detected by western blotting. *p < 0.05, **p < 0.01, ***p < 0.001.
XIST inhibits miR-122-5p levels High expression of miR-122-5p is a diagnostic marker of ischemic cardiomyopathy [21]. Firstly, we found that the levels of miR-122-5p were significantly elevated in hypoxic H9c2 cells (Fig. 3A). The starBase database analysis revealed that miR-122-5p is a potential target for XIST and a binding sequence is present (Fig. 3B). In order to further determine the regulatory relationship between XIST and miR-122-5p, we validated using luciferase reporter assay and RNA immunoprecipitation. We found that the XIST-WT luciferase activity was reduced in H9c2 cells co-transfected with XIST-WT and miR-122-5p mimics (Fig. 3C). The results of RNA immunoprecipitation showed that XIST interacted directly with miR-122-5p (Fig. 3D). As shown in Figure 3E, overexpression of XIST significantly downregulated the miR-122-5p levels compared to those of the control group. The above results indicated that XIST had downregulated miR-122-5p levels. Figure 3A: H9c2 cells were cultured in a hypoxic environment for 0, 6, 12, 24, 48 h and
miR-122-5p expression was detected by qRT-PCR. B: The starBase database predicts the binding sequence of miR-122-5p to XIST. C: The luciferase reporter gene detection system detects luciferase activity after co-transfection of the XIST wild-type or mutant reporter plasmid with Scramble or miR-122-5p mimics for 48 h according to Lipo3000 manufacturer’s instructions. D: After lysis, the collected H9c2 cells were incubated with A/G beads containing AgO2 or the IgG antibody and the levels of miR-122-5p and XIST were detected by qRT-PCR. E: XIST and control plasmids were transfected into H9C2 cells and cultured under conditions of hypoxia for 48 h, following which, the miR-122-5p levels were detected by qRT-PCR. *p < 0.05, **p < 0.01, ***p < 0.001.
XIST downregulated miR-122-5p to attenuate hypoxia-induced H9c2 cell injury In order to confirm whether XIST downregulates the levels of miR-122-5p by ceRNA, thereby affecting hypoxia-induced myocardial injury, we first transfected H9c2 cells with the synthesized miR-122-5p mimics and found that the levels of miR-122-5p had significantly elevated (Fig. 4A). Immediately after treatment of the H9c2 cells overexpressing XIST by the miR-122-5p mimics, their viability, migration and invasion ability had decreased (Fig. 4B - Fig. 4D). Similarly, we found that the miR-122-5p mimics could significantly increase the extent of apoptosis, accompanied by a decreased expression of the Bcl-2 protein and an increased expression of HIF-α, Bax and the cleaved-caspase9 proteins (Fig. 4E and Fig. 4F). These results indicated that the downregulation of miR-122-5p by XIST could attenuate hypoxia-induced H9c2 cell injury. Figure 4A: Scramble or miR-122-5p mimics, each, were transfected into the H9c2 cells. The miR-122-5p levels were detected by qRT-PCR after transfection for 48 h. B: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, and cultured under conditions of hypoxia for 48 h, after which, CCK8 was used to detect cell viability. C-D: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, cultured under conditions of hypoxia for 48 h, and cell invasion and migration were detected by Transwell. E: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, cultured under conditions of hypoxia for 48 h, and the extent of apoptosis was detected by flow cytometry. F: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, cultured under conditions of hypoxia for 48 h, and the expression of related proteins was detected by western blotting. *p < 0.05, **p < 0.01, ***p < 0.001. XIST promotes FOXP2 expression by adsorbing miR-122-5p TargetScan online tools were used to screen downstream target genes for miR-122-5p in order to determine the mechanism by which they are regulated by adsorption of miR-122-5p by XIST. As shown in Figure 5A, we determined that FOXP2 is a potential target gene for miR-122-5p. Results of the luciferase reporter assay revealed that the miR-122-5p mimics significantly reduced the FOXP2-WT luciferase activity (Fig. 5B). The miR-122-5p mimics significantly downregulated and miR-122-5p inhibitor significantly upregulated the FOXP2 mRNA and protein levels (Fig. 5C and Fig. 5D). Additionally, expression of the FOXP2 protein in
H9c2 cells subjected to hypoxic conditions had decreased whereas its expression had increased after the overexpression of XIST, and was found to be normal after treatment with the miR-122-5p mimics (Fig. 5E). In summary, XIST promoted FOXP2 expression by adsorbing miR-122-5p. Figure 5A: TargetScan predicts the binding sequence of FOXP2 to miR-122-5p. B: The luciferase reporter gene detection system detects luciferase activity after co-transfection of the FOXP2 wild-type or mutant reporter plasmid with Scramble or miR-122-5p mimics for 48 h according to Lipo3000 manufacturer’s instructions. C and D: Scramble, after treatment with miR-122-5p mimics or miR-122-5p inhibitor for 48 h. FOXP2 levels and the protein was detected by qRT-PCR and western blotting, respectively. E: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids according to the instructions provided by Lipo3000, and cultured under conditions of hypoxia for 48 h. Western blot was used to detect FOXP2 protein expression. *p < 0.05, **p < 0.01, ***p < 0.001.
XIST regulates miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury To verify that XIST regulates miR-122-5p/FOXP2 axis-mediated hypoxia-induced myocardial injury, we constructed a FOXP2 overexpression vector (Fig. 6A). Subsequently, we determined that overexpression of FOXP2 inhibits the apoptosis of H9c2 cells induced by transfection of the miR-122-5p mimics and enhances viability, migration and invasion ability of the cells (Fig. 6B - Fig. 6E). Additionally, FOXP2 overexpression had upregulated the expression of the Bcl-2 protein in H9c2 cells transfected with the miR-122-5p mimics and inhibited the expressions of HIF-α, Bax and the cleaved-caspase 9 protein (Fig. 6F). These results indicated that XIST had regulated the miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury. Figure 6A: The FOXP2 overexpression plasmid and control plasmid were transfected into H9C2 cells for 48 h and the expression of the FOXP2 protein was detected by western blotting. B-E: FOXP2 and its control plasmid were co-transfected with Scramble or miR-122-5p mimics for 48 h under hypoxia according to the manufacturer’s instructions for Lipo3000. CCK8, Transwell and flow cytometry were used to detect cell viability, cell invasion and migration, and the extent of apoptosis, respectively. F: FOXP2 and its control plasmid were co-transfected with Scram or miR-122-5p mimics in H9c2 under hypoxia for 48 h according to the instructions of Lipo3000. Expression of the apoptosis-related protein was detected by western blotting. *p < 0.05, **p < 0.01, ***p < 0.001. Discussion Many patients in the world are suffering from ischemic heart disease. The key to effective treatment of ischemic cardiomyopathy is to restore cardiac function and the blood perfusion of the ischemic myocardium as soon as possible, and reduce apoptosis and necrosis of the cardiomyocytes [24]. However, ischemic myocardial tissue damages are aggravated after restoration of the blood supply and even cause irreversible damage [25]. Overproduction of reactive oxygen species, intracellular calcium overload and inflammatory cell infiltration are the most important features of a myocardial ischemia-reperfusion injury [26]. At present, many drugs
are used in combination or alone to prevent myocardial ischemia-reperfusion injury, but the extent of progress of these studies still cannot meet the clinical requirements [26, 27]. Therefore, the research on drugs to prevent and treat hypoxia-induced myocardial injury is very important clinically. In this work, H9c2 cells were subjected to hypoxia and it was observed that their viability had reduced, migration and invasion ability was inhibited, extent of apoptosis had increased, and XIST levels were significantly downregulated. By overexpressing lncRNA XIST in the H9c2 cells, we found that XIST could enhance the viability of H9c2 cells in a hypoxic environment, enhance cell migration and invasion, and reduce apoptosis. High levels of miR-122-5p is a prognostic marker of early ischemic cardiomyopathy [21]. Xin-Liang Yao et al. found that circulating miR-122-5p is a novel biomarker that could potentially be used for the diagnosis of acute myocardial infarction [28]. Analysis using the starBase database revealed that miR-122-5p is a potential target of lncRNA XIST and its level in H9c2 cells subjected to hypoxia increases significantly. Using the luciferase reporter assay and RNA immunoprecipitation, we found that XIST and miR-122-5p interact directly and XIST downregulates miR-122-5p levels, thereby attenuating hypoxia-induced H9c2 cell damage. This study provides new preventive and therapeutic clues for the countering ischemic cardiomyopathy. However, few shortcomings still exist. Firstly, the conclusions of this study have not been confirmed by conducting in vivo studies. Secondly, FOXP2 could play other roles in ischemic cardiomyopathy, which needs to be studied further. Finally, the specific localization of the role of lncRNA XIST in the cells has not been confirmed in this study. FOXP2 is an important transcriptional regulator in cells involved in processes like apoptosis, epithelial-mesenchymal transition, and migration [29, 30]. We found that FOXP2 is a potential target gene for miR-122-5p and is downregulated by it. Overexpression of FOXP2 inhibits hypoxia-induced expression of apoptotic proteins. Additionally, the expression of FOXP2 had increased after the overexpression of XIST; hence, we believe that XIST regulates the miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury. Conflict of interest The authors declare no conflicts of interest. Funding This work was supported by grants from Traditional Chinese Medical science and technology plan of Zhejiang Province (2019ZA025) References [1] M. Li, W. Ding, M.A. Tariq, W. Chang, X. Zhang, W. Xu, L. Hou, Y. Wang, J. Wang, A circular transcript of ncx1 gene mediates ischemic myocardial injury by targeting miR-133a-3p, THERANOSTICS/8.854 8(21) (2018) 5855-5869. [2] D. Han, Y. Wang, J. Chen, J. Zhang, P. Yu, R. Zhang, S. Li, B. Tao, Y. Wang, Y. Qiu, M. Xu,
E. Gao, F. Cao, Activation of melatonin receptor 2 but not melatonin receptor 1 mediates melatonin-conferred cardioprotection against myocardial ischemia/reperfusion injury, J PINEAL RES/9.314 67(1) (2019) e12571. [3] M. Harada, X. Luo, T. Murohara, B. Yang, D. Dobrev, S. Nattel, MicroRNA regulation and cardiac calcium signaling: role in cardiac disease and therapeutic potential, CIRC RES/11.551 114(4) (2014) 689-705. [4] M.A. Song, A.N. Paradis, M.S. Gay, J. Shin, L. Zhang, Differential expression of microRNAs in ischemic heart disease, Drug Discov. Today 20(2) (2015) 223-35. [5] B.D. Adams, C. Parsons, L. Walker, W.C. Zhang, F.J. Slack, Targeting noncoding RNAs in disease, J. Clin. Invest. 127(3) (2017) 761-771. [6] B. Cai, W. Ma, F. Ding, L. Zhang, Q. Huang, X. Wang, B. Hua, J. Xu, J. Li, C. Bi, S. Guo, F. Yang, Z. Han, Y. Li, G. Yan, Y. Yu, Z. Bao, M. Yu, F. Li, Y. Tian, Z. Pan, B. Yang, The Long Noncoding RNA CAREL Controls Cardiac Regeneration, J. Am. Coll. Cardiol. 72(5) (2018) 534-550. [7] S.B. Ong, K. Katwadi, X.Y. Kwek, N.I. Ismail, S.G. Ong, K. Chinda, D.J. Hausenloy, Non-coding RNAs as therapeutic targets for preventing myocardial ischemia-reperfusion injury, Expert Opin. Ther. Targets
(2018).
[8] Y. Xu, Y. Li, J. Jin, G. Han, C. Sun, M.P. Pizzi, L. Huo, A. Scott, Y. Wang, L. Ma, J.H. Lee, M.S. Bhutani, B. Weston, C. Vellano, L. Yang, C. Lin, Y. Kim, A.R. MacLeod, L. Wang, Z. Wang, S. Song, J.A. Ajani, LncRNA PVT1 up-regulation is a poor prognosticator and serves as a therapeutic target in esophageal adenocarcinoma, MOL CANCER/5.888 18(1) (2019) 141. [9] C. Sun, S. Li, F. Zhang, Y. Xi, L. Wang, Y. Bi, D. Li, Long non-coding RNA NEAT1
promotes non-small cell lung cancer progression through regulation of miR-377-3p-E2F3 pathway, ONCOTARGET/5.008 7(32) (2016) 51784-51814. [10] Z.W. Zhang, J.J. Chen, S.H. Xia, H. Zhao, J.B. Yang, H. Zhang, B. He, J. Jiao, B.T. Zhan, C.C. Sun, Long intergenic non-protein coding RNA 319 aggravates lung adenocarcinoma carcinogenesis by modulating miR-450b-5p/EZH2, GENE/2.319 650 (2018) 60-67. [11] C.C. Sun, L. Zhang, G. Li, S.J. Li, Z.L. Chen, Y.F. Fu, F.Y. Gong, T. Bai, D.Y. Zhang, Q.M. Wu, D.J. Li, The lncRNA PDIA3P Interacts with miR-185-5p to Modulate Oral Squamous Cell Carcinoma Progression by Targeting Cyclin D2, Mol Ther Nucleic Acids 9 (2017) 100-110. [12] C.C. Sun, S.J. Li, G. Li, R.X. Hua, X.H. Zhou, D.J. Li, Long Intergenic Noncoding RNA 00511 Acts as an Oncogene in Non-small-cell Lung Cancer by Binding to EZH2 and Suppressing p57, Mol Ther Nucleic Acids 5(11) (2016) e385. [13] K.C. Yang, K.A. Yamada, A.Y. Patel, V.K. Topkara, I. George, F.H. Cheema, G.A. Ewald, D.L. Mann, J.M. Nerbonne, Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support, CIRCULATION/17.047 129(9) (2014) 1009-21. [14]
P.
Wang,
Y.
Yuan,
LncRNA-ROR
alleviates
hypoxia-triggered
downregulating miR-145 in rat cardiomyocytes H9c2 cells, J. Cell. Physiol.
damages
by
(2019).
[15] H. Luo, J. Wang, D. Liu, S. Zang, N. Ma, L. Zhao, L. Zhang, X. Zhang, C. Qiao, The lncRNA H19/miR-675 axis regulates myocardial ischemic and reperfusion injury by targeting PPARα, Mol. Immunol. 105 (2018) 46-54. [16] H. Hu, J. Wu, D. Li, J. Zhou, H. Yu, L. Ma, Knockdown of lncRNA MALAT1 attenuates acute myocardial infarction through miR-320-Pten axis, Biomed. Pharmacother. 106 (2018)
738-746. [17] L. Feng, J.R. Houck, P. Lohavanichbutr, C. Chen, Transcriptome analysis reveals differentially expressed lncRNAs between oral squamous cell carcinoma and healthy oral mucosa, ONCOTARGET/5.008
(2017).
[18] F. Luan, W. Chen, M. Chen, J. Yan, H. Chen, H. Yu, T. Liu, L. Mo, An autophagy-related long non-coding RNA signature for glioma, FEBS OPEN BIO/2.101 9(4) (2019) 653-667. [19] J. Lu, J. Wu, Z. Zhao, J. Wang, Z. Chen, Circulating LncRNA Serve as Fingerprint for Gestational Diabetes Mellitus Associated with Risk of Macrosomia, CELL PHYSIOL BIOCHEM/4.652 48(3) (2018) 1012-1018. [20] J. Fang, C.C. Sun, C. Gong, Long noncoding RNA XIST acts as an oncogene in non-small cell lung cancer by epigenetically repressing KLF2 expression, Biochem Biophys Res Commun 478(2) (2016) 811-7. [21] N. Cortez-Dias, M.C. Costa, P. Carrilho-Ferreira, D. Silva, C. Jorge, C. Calisto, T. Pessoa, S. Robalo Martins, J.C. de Sousa, P.C. da Silva, M. Fiúza, A.N. Diogo, F.J. Pinto, F.J. Enguita, Circulating miR-122-5p/miR-133b Ratio Is a Specific Early Prognostic Biomarker in Acute Myocardial Infarction, Circ. J. 80(10) (2016) 2183-91. [22] A.A. Derda, A. Pfanne, C. Bär, K. Schimmel, P.J. Kennel, K. Xiao, P.C. Schulze, J. Bauersachs, T. Thum, Blood-based microRNA profiling in patients with cardiac amyloidosis, PLOS ONE/3.057 13(10) (2018) e0204235. [23] X. Liu, H. Meng, C. Jiang, S. Yang, F. Cui, P. Yang, Differential microRNA Expression and Regulation in the Rat Model of Post-Infarction Heart Failure, PLOS ONE/3.057 11(8) (2016) e0160920.
[24] K. Pryds, R.R. Nielsen, C.M. Hoff, L.P. Tolbod, K. Bouchelouche, J. Li, M.R. Schmidt, A.N. Redington, J. Frokiaer, H.E. Botker, Effect of remote ischemic conditioning on myocardial perfusion in patients with suspected ischemic coronary artery disease, J NUCL CARDIOL/2.929 25(3) (2018) 887-896. [25] M.Y. Wu, G.T. Yiang, W.T. Liao, A.P. Tsai, Y.L. Cheng, P.W. Cheng, C.Y. Li, C.J. Li, Current Mechanistic Concepts in Ischemia and Reperfusion Injury, CELL PHYSIOL BIOCHEM/4.652 46(4) (2018) 1650-1667. [26] K.Y. Chin, C. Qin, L. May, R.H. Ritchie, O.L. Woodman, New Pharmacological Approaches to the Prevention of Myocardial Ischemia- Reperfusion Injury, CURR DRUG TARGETS/3.029 18(15) (2017) 1689-1711. [27] A. Krzywonos-Zawadzka, A. Franczak, G. Sawicki, M. Wozniak, I. Bil-Lula, Multidrug prevention or therapy of ischemia-reperfusion injury of the heart-Mini-review, Environ Toxicol Pharmacol 55 (2017) 55-59. [28] X.L. Yao, X.L. Lu, C.Y. Yan, Q.L. Wan, G.C. Cheng, Y.M. Li, Circulating miR-122-5p as a potential novel biomarker for diagnosis of acute myocardial infarction, Int J Clin Exp Pathol 8(12) (2015) 16014-9. [29] D.M. DeLaughter, D.C. Christodoulou, J.Y. Robinson, C.E. Seidman, H.S. Baldwin, J.G. Seidman, J.V. Barnett, Spatial transcriptional profile of the chick and mouse endocardial cushions identify novel regulators of endocardial EMT in vitro, J. Mol. Cell. Cardiol. 59 (2013) 196-204. [30] H. Dietz, K. Haeussermann, G. Young, P. Kukura, Dissecting FOXP2 oligomerization and DNA binding, Angew. Chem. Int. Ed. Engl.
(2019).
Overexpression of XIST significantly increased the H9c2 cell viability, enhanced cell migration and invasion, and decreased cell apoptosis in a hypoxic environment. XIST interacted directly with miRNA-122-5p. Overexpression of XIST decreased the level of miRNA-122-5p significantly. mi-122-5p mimics increased H9c2 cell apoptosis and downregulated FOXP2 expression. Overexpression of FOXP2 upregulated the expression of the Bcl-2 protein in H9c2 cells transfected with microRNA-122-5p mimics and inhibited the expression of HIF-alpha, Bax, and the cleaved-caspase 9 protein. lncRNA
XIST
could
regulate
the
hypoxia-induced H9c2 cardiomyocyte injury
miR-122-5p/FOXP2
axis
to
attenuate
S0890-8508(19)30415-3
DOI:
https://doi.org/10.1016/j.mcp.2019.101500
Reference:
YMCPR 101500
To appear in:
Molecular and Cellular Probes
Received Date: 26 October 2019 Revised Date:
12 December 2019
Accepted Date: 25 December 2019
Please cite this article as: Peng H, Luo Y, Ying Y, lncRNA XIST attenuates hypoxia-induced H9c2 cardiomyocyte injury by targeting the miR-122-5p/FOXP2 axis, Molecular and Cellular Probes (2020), doi: https://doi.org/10.1016/j.mcp.2019.101500. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier Ltd.
Author Contribution： ： Hui Peng：Data curation, Methodology, Formal analysis, Software，Writing – original draft Yuxuan Luo：Formal analysis, Software, Data curation, Visualization Yongjun Ying：Funding acquisition，Resources, Supervision;, Writing – review & editing.
lncRNA XIST attenuates hypoxia-induced H9c2 cardiomyocyte injury by targeting the miR-122-5p/FOXP2 axis Hui Peng1, Yuxuan Luo2, Yongjun Ying1* 1 Department of Cardiology, Tongde Hospital of Zhejiang Province, 234 Gucui Road, Hangzhou, Zhejiang, China 2 Department of Nephrology, Zhuji People's Hospital of Zhejiang province, Zhuji, Shaoxing, Zhejiang, China *Correspondence: [email protected] Abstract Objective: To investigate the effect of lncRNA XIST on apoptosis induced by hypoxia. Methods: We analyzed the expression levels of lncRNA XIST and miR-122-5p using RT-qPCR in hypoxia-induced cardiomyocytes. The mechanism by which lncRNA XIST affects myocardial ischemia was investigated using the cell transfection, CCK-8, and dual-luciferase reporter assays, as well as by flowcytometry, western blotting, and RNA immunoprecipitation. Results: Hypoxic H9c2 cells demonstrated a decrease in their migration and invasion abilities and XIST expression and an increase in the extent of their apoptosis and expression of microRNA-122-5p. Overexpression of XIST significantly increased the H9c2 cell viability, enhanced cell migration and invasion, and decreased cell apoptosis in a hypoxic environment. The luciferase activity of XIST-WT in H9c2 cells co-transfected with XIST-WT and microRNA-122-5p mimics had decreased. The results of RNA immunoprecipitation showed that XIST interacted directly with miRNA-122-5p. Overexpression of XIST decreased the level of miRNA-122-5p significantly. mi-122-5p mimics increased H9c2 cell apoptosis and downregulated FOXP2 expression. Overexpression of FOXP2 upregulated the expression of the Bcl-2 protein in H9c2 cells transfected with microRNA-122-5p mimics and inhibited the expression of HIF-alpha, Bax, and the cleaved-caspase 9 protein. Conclusion：lncRNA XIST could regulate the miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury. Keywords: lncRNA; XIST; hypoxia; cardiomyocyte injury; miR-122-5p; FOXP2. Ischemic cardiomyopathy is the leading cause of death in patients with cardiovascular diseases, worldwide[1]. Myocardial ischemia leads to an insufficient supply of oxygen and nutrients and causes functional damage to the cardiac myocytes. Myocardial cell injury, resulting in an expansion of the area of myocardial infarction, cardiac dysfunction, and even death, is the main reason for the development of ischemic cardiomyopathy[2] Therefore, understanding the mechanism of cardiomyocyte injury is the key to preventing cardiac injury and treating ischemic cardiomyopathy. MicroRNAs (miRNAs) are a class of non-coding single-stranded RNA molecules approximately 22 nucleotides in length encoded by endogenous genes involved in the regulation of ischemic cardiomyopathy by targeting the inhibition of mRNA transcription[3, 4]. The long-chain non-coding RNA (lncRNA) is a non-coding RNA over 200 nucleotides in length, which is mainly used to adsorb the miRNA-regulated target gene by the ceRNA mechanism[5-7]. The role of LncRNA is very wide. Many LncRNAs are currently known to be involved in the development of tumors[8-12]. While,there are 18,480 lncRNA expression abnormalities observed in patients with cardiovascular disease[13]. lncRNA ROR adsorbs miR-145 and activates the
PI3K/AKT pathway to inhibit hypoxia-induced cardiomyocyte apoptosis [14]. The lncRNA H19/miR-675 axis inhibits the expression of PPARα, promotes cardiomyocyte apoptosis, increases the area of myocardial infarction, and aggravates myocardial ischemic injury [15]. lncRNA MALAT1 adsorbs miR-320, relieves its inhibition downstream of the target gene PTEN, promotes cardiomyocyte apoptosis, and accelerates the development of myocardial infarction [16]. This indicates that the mechanism for the regulation of lncRNA-miRNA plays an important role in ischemic cardiomyopathy. lncRNA XIST has been extensively studied as a diagnostic marker for lung cancer, colorectal cancer and colorectal cancer [17-20]. Recent studies have shown that lncRNA XIST is involved in postischemia myocardial remodeling and significantly under-expressed in diabetic cardiomyopathy and cardiomyocyte hypertrophy[14-15]. However, its role in ischemic cardiomyopathy and its molecular mechanisms have still been reported -. miR-122-5p is highly expressed in cardiovascular diseases such as coronary arteriosclerosis, amyloid heart disease and myocardial ischemia, and is an important diagnostic marker for ischemic cardiomyopathy [21-23]. Analysis using the starBase database has revealed that lncRNA XIST and miR-122-5p have binding sequences. However, further confirmation is needed to determine whether lncRNA XIST negatively regulates miR-122-5p and affects the development of ischemic cardiomyopathy.
Methods Cell culture Rat H9c2 cells (ATCC, Rockville, MD) were cultured in Dulbecco's modified Eagle's medium (DMEM, Corning) containing 10% (v/v) fetal bovine serum (Gibco, 10099141C, Australia). The cells were incubated at 37°C in an atmosphere of 5% CO2.
CCK-8 assay The transfected cells were seeded in 96-well plates such that 1×104 cells were present per well. A Cell Counting Kit-8 (A311-01, Vazyme, Nanjing, China) was used to detect the viability of cells according to the manufacturer's instructions. The absorbance was measured at 450 nm. RNA extraction and quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from the cultured cells using the TRIzol reagent (15596026, Takara, Japan), as per the supplier's instructions. The PrimeScript RT Master Mix (TaKaRa, Dalian, China) was used to retrieve the extracted RNA into a cDNA. The PrimeScript RT kit and SYBR Premix Ex Taq (TaKaRa, Dalian, China) were used to perform the qRT-PCR and GAPDH was the internal control. The primers used were synthesized by Sangon (Shanghai, China). The primer sequence was as follows: XIST fw: 5′-AGGCTGGCTGGAATAAAGG-3′,rv: 5′-TATGAAAAGGGAGGCGTGGT-3′, rno-miR-122-5p fw: TGGAGTGTGACAATGGTGT, rv: CCAGTTTTTTTTTTTTTTTCAAACACC; FOXP2 Fw: 5'- AGTGTGCCCAATGTGGGAG -3', Rv: 5'CATGATAGCCTGCCTTATGAGTG -3'; GAPDH Fw: 5'GGAGCGAGATCCCTCCAAAAT-3'; Rv 5'-GGCTGTTGTCATACTTCTCATGG-3'. U6 Fw: 5'-GCGCGTCGTGAAGCGTTC-3', Rv: 5'-GTGCAGGGTCCGAGGT-3'. The conditions of PCR
reaction were as follows: 95oC, 95oC, and 60oC for 30 s, 5 s, and 34 s, respectively, for 40 cycles. The reaction was carried out on the ABI 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). The expression as the multiple of RNA relative to GAPDH was calculated using the formula 2-∆∆CT. Cell invasion and migration Invasion experiment: Matrigel was diluted to 1 mg/mL on ice using a pre-cooled serum-free medium and 40 µL per well was added to a Transwell chamber. This was incubated at 37°C for 2 h to allow the Matrigel to coagulate. Then, 100 µL and 600 µL of serum-free medium was added to the upper and lower chambers, respectively, and equilibrated overnight at 37°C. A cell suspension containing 1 × 106 cells/mL was prepared by resuspending in 100 µL of serum-free DMEM-F12, MEM. After this, 100 µL of the cell suspension and 600 µL of complete medium were added to the upper and lower chambers of a 24-well Transwell chamber, respectively, and the upper chamber was placed in the culture well. After incubating for 48 h at 37°C under conditions of 5% CO2, the upper chamber was removed, its cells were wiped with a tip, and the transwells were removed, inverted, and air-dried. Crystal violet at 0.1% concentration and 500 µL volume was added to the 24-well plate. The chamber was placed therein and the membrane was immersed in the medium at 37°C for 30 min, after which it was removed, and washed with PBS. Finally, 4 fields of view on the diameter were selected, imaged and counted. Migration experiment: The cells were incubated in the Transwell chamber for 24 h. The remaining steps were the same as those of the invasion experiment. Construction of the plasmid and cell transfection The XIST, XIST-WT, XIST-MT, and rno-miRNA-122-5p sequences were designed and synthesized by Tsingke (Nanjing, China), which were further subcloned into pcDNA3.1 (Invitrogen, Shanghai, China). Lipofectamine 3000 (Invitrogen, Shanghai, China) was used to transfect the plasmids containing XIST, XIST-WT, XIST-MT, rno-miRNA-122-5p sequences into the H9c2 cells. The sequences are shown in Figure 3B and Figure 5A. Western blot The cells were washed twice in ice-cold PBS and incubated on ice in 1X RIPA buffer (Beyotime, Shanghai), containing the 1X PhosSTOP protease inhibitor and 1X complete Protease Inhibitor Cocktail (Yeasen, Shanghai), for 30 min. The lysates were pre-cleared by centrifuging for 10 min and the protein was quantified using the Yeasen Protein Assay Kit (Yeasen, Shanghai). Then, 25 mg of protein lysate was resolved on an SDS-PAGE gel and transferred onto a PVDF membrane (Bio-Rad, Chicago, IL, USA). The blots were blocked using 5% skim milk, incubated with the primary antibody overnight at 4℃, after which, they were washed, and incubated with secondary antibody for 2 h at room temperature, followed by washing and visualization of the protein bands using an ECL chemiluminescence kit (Fude, Hangzhou, China). TUBULIN, GAPDH or histone H3 were used as the loading controls. The primary antibodies (RRID; dilution ratio) used were as follows: HIF-1α (Cat: 3434, 1:1000, CST), Bax (Cat:2272, 1:1000, CST), Bcl-2 (Cat: 2764, 1:1000, CST), cleaved caspase-9 (Cat: 7237, 1:1000, CST), pro caspase-9 ( Cat: 138412,1:1000, Abcam), Foxp2（Cat：16046，1:1000，Abcam), GAPDH (Cat: 307275, 1:2500,
Abcam). The secondary antibodies used were as follows: anti-mouse (Cat: 2340072, 1:10000, Abcam), anti-rabbit (Cat: 7074, 1:10000, CST). Luciferase reporter gene assay The H9c2 cells were seeded in 96-well plates and incubated at 37°C for 24 h. A XIST 3'-UTR-Luc vector with wild type (WT) or mutant (MT) was constructed at the miR-122-5p binding site of the 3' UTR region of lncRNA XIST. A FOXP2 3'-UTR-Luc vector with a wild type (WT) or a mutant (MT) gene was constructed at the miR-187-3p binding site of the 3'UTR region of the FOXP2. Using Lipofectamine 3000, the plasmids were co-transfected with the H9c2 cells and 48 h later, they were harvested and the luciferase activity was measured using a dual luciferase assay system (Promega, USA). Flowcytometry Apoptotic cells were detected using the Annexin V-FITC/propidium iodide (PI) Apoptosis Detection Kit after cell treatment. According to the manufacturer’s instructions, the stained cells were assayed by flow cytometry (FACS Calibur, BD Biosciences) after fixing them with a FACS fixed buffer (FACS buffer containing 1% paraformaldehyde). The positive cells were calculated and analyzed with the FlowJo software (Tree Star, Ashland, OR, USA). RNA immunoprecipitation The cells were lysed with the lysate containing the protease and RNA enzyme inhibitors, and then incubated with the Foxp2 antibody (Cat:16046, Abcam) coupled with magnetic beads. The purity and concentration of the immunoprecipitated RNA was measured by spectrophotometry, and the expressions of XIST and microRNA-122-5p were detected by qPCR. Statistical analysis Statistical analysis was performed using the GraphPad Prism7. The data are presented as the mean ± standard deviation. Statistical comparisons were performed using the paired t-test. P < 0.05 indicates that the difference is statistically significant.
Results Hypoxia induced H9c2 cell damage and downregulated XIST levels. When H9c2 cells were subjected to hypoxia at different time periods, we found that the cell viability decreased with respect to the time gradient (Figure 1A). Compared to the control group, hypoxia inhibited the migration and invasion ability of the H9c2 cells, while their apoptosis rates had increased (Figure 1B - Figure 1D). Furthermore, results of the western blot analysis revealed that the expressions of HIF-α, Bax, and the cleaved-caspase9 protein had increased, whereas those of the anti-apoptotic protein Bcl-2 had decreased (Fig. 1E). Additionally, we found that low oxygen significantly down-regulated the levels of XIST (Fig. 1F). These results suggested that XIST may be associated with hypoxia-induced H9c2 cell damage. Figure 1A: 1×105 cells were seeded in 96-well plates, 94% N2, 5% CO2, and 1% O2 at
different time points (0, 6, 12, 24, 48 h). Cell viability was measured by the MTT assay. B-C: H9c2 cells were subjected to hypoxic conditions for 48 h and Transwell was used to detect cell invasion and migration. D: H9c2 cells were subjected to hypoxic conditions for 48 h and the extent of apoptosis was detected using flow cytometry. E: H9c2 cells were subjected to hypoxic conditions for 48 h and the expression of related proteins was detected using western blotting. F: The H9c2 cells were cultured under conditions of hypoxia for 0, 6, 12, 24, and 48 h and qTP-PCR was used to detect the XIST levels. *p < 0.05, **p < 0.01, ***p < 0.001. Overexpression of XIST attenuates hypoxia-induced cardiomyocyte injury To investigate the role of XIST in hypoxia-induced cardiomyocyte injury, we successfully constructed the XIST overexpression plasmid (Fig. 2A). Overexpression of XIST significantly increased the viability of H9c2 cells under hypoxic conditions and enhanced their migration and invasion (Fig. 2B-2D). Additionally, the overexpression of XIST significantly downregulated the extent of apoptosis, which was accompanied by an increased expression of the anti-apoptotic protein Bcl-2 and decreased expression of HIF-α, Bax, and cleaved-caspase 9 proteins (Fig. 2E and Fig. 2F). We observed that the overexpression of XIST attenuated hypoxia-induced cardiomyocyte injury. Figure 2A: The lncRNA XIST overexpression plasmid and control plasmid were constructed and transfected into the H9C2 cells for 48 h. The XIST levels were detected using qRT-PCR. B: The XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia, and CCK8 was used to detect the cell viability. C-D: The XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia and Transwell was used to detect the cell invasion and migration. E: XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia and the extent of apoptosis was detected by flow cytometry. F: The XIST and control plasmids were transfected into H9C2 cells for 48 h under conditions of hypoxia and the expressions of related proteins were detected by western blotting. *p < 0.05, **p < 0.01, ***p < 0.001.
XIST inhibits miR-122-5p levels High expression of miR-122-5p is a diagnostic marker of ischemic cardiomyopathy [21]. Firstly, we found that the levels of miR-122-5p were significantly elevated in hypoxic H9c2 cells (Fig. 3A). The starBase database analysis revealed that miR-122-5p is a potential target for XIST and a binding sequence is present (Fig. 3B). In order to further determine the regulatory relationship between XIST and miR-122-5p, we validated using luciferase reporter assay and RNA immunoprecipitation. We found that the XIST-WT luciferase activity was reduced in H9c2 cells co-transfected with XIST-WT and miR-122-5p mimics (Fig. 3C). The results of RNA immunoprecipitation showed that XIST interacted directly with miR-122-5p (Fig. 3D). As shown in Figure 3E, overexpression of XIST significantly downregulated the miR-122-5p levels compared to those of the control group. The above results indicated that XIST had downregulated miR-122-5p levels. Figure 3A: H9c2 cells were cultured in a hypoxic environment for 0, 6, 12, 24, 48 h and
miR-122-5p expression was detected by qRT-PCR. B: The starBase database predicts the binding sequence of miR-122-5p to XIST. C: The luciferase reporter gene detection system detects luciferase activity after co-transfection of the XIST wild-type or mutant reporter plasmid with Scramble or miR-122-5p mimics for 48 h according to Lipo3000 manufacturer’s instructions. D: After lysis, the collected H9c2 cells were incubated with A/G beads containing AgO2 or the IgG antibody and the levels of miR-122-5p and XIST were detected by qRT-PCR. E: XIST and control plasmids were transfected into H9C2 cells and cultured under conditions of hypoxia for 48 h, following which, the miR-122-5p levels were detected by qRT-PCR. *p < 0.05, **p < 0.01, ***p < 0.001.
XIST downregulated miR-122-5p to attenuate hypoxia-induced H9c2 cell injury In order to confirm whether XIST downregulates the levels of miR-122-5p by ceRNA, thereby affecting hypoxia-induced myocardial injury, we first transfected H9c2 cells with the synthesized miR-122-5p mimics and found that the levels of miR-122-5p had significantly elevated (Fig. 4A). Immediately after treatment of the H9c2 cells overexpressing XIST by the miR-122-5p mimics, their viability, migration and invasion ability had decreased (Fig. 4B - Fig. 4D). Similarly, we found that the miR-122-5p mimics could significantly increase the extent of apoptosis, accompanied by a decreased expression of the Bcl-2 protein and an increased expression of HIF-α, Bax and the cleaved-caspase9 proteins (Fig. 4E and Fig. 4F). These results indicated that the downregulation of miR-122-5p by XIST could attenuate hypoxia-induced H9c2 cell injury. Figure 4A: Scramble or miR-122-5p mimics, each, were transfected into the H9c2 cells. The miR-122-5p levels were detected by qRT-PCR after transfection for 48 h. B: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, and cultured under conditions of hypoxia for 48 h, after which, CCK8 was used to detect cell viability. C-D: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, cultured under conditions of hypoxia for 48 h, and cell invasion and migration were detected by Transwell. E: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, cultured under conditions of hypoxia for 48 h, and the extent of apoptosis was detected by flow cytometry. F: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids, respectively, cultured under conditions of hypoxia for 48 h, and the expression of related proteins was detected by western blotting. *p < 0.05, **p < 0.01, ***p < 0.001. XIST promotes FOXP2 expression by adsorbing miR-122-5p TargetScan online tools were used to screen downstream target genes for miR-122-5p in order to determine the mechanism by which they are regulated by adsorption of miR-122-5p by XIST. As shown in Figure 5A, we determined that FOXP2 is a potential target gene for miR-122-5p. Results of the luciferase reporter assay revealed that the miR-122-5p mimics significantly reduced the FOXP2-WT luciferase activity (Fig. 5B). The miR-122-5p mimics significantly downregulated and miR-122-5p inhibitor significantly upregulated the FOXP2 mRNA and protein levels (Fig. 5C and Fig. 5D). Additionally, expression of the FOXP2 protein in
H9c2 cells subjected to hypoxic conditions had decreased whereas its expression had increased after the overexpression of XIST, and was found to be normal after treatment with the miR-122-5p mimics (Fig. 5E). In summary, XIST promoted FOXP2 expression by adsorbing miR-122-5p. Figure 5A: TargetScan predicts the binding sequence of FOXP2 to miR-122-5p. B: The luciferase reporter gene detection system detects luciferase activity after co-transfection of the FOXP2 wild-type or mutant reporter plasmid with Scramble or miR-122-5p mimics for 48 h according to Lipo3000 manufacturer’s instructions. C and D: Scramble, after treatment with miR-122-5p mimics or miR-122-5p inhibitor for 48 h. FOXP2 levels and the protein was detected by qRT-PCR and western blotting, respectively. E: Scramble or miR-122-5p mimics were transfected into H9C2 cells with XIST and control plasmids according to the instructions provided by Lipo3000, and cultured under conditions of hypoxia for 48 h. Western blot was used to detect FOXP2 protein expression. *p < 0.05, **p < 0.01, ***p < 0.001.
XIST regulates miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury To verify that XIST regulates miR-122-5p/FOXP2 axis-mediated hypoxia-induced myocardial injury, we constructed a FOXP2 overexpression vector (Fig. 6A). Subsequently, we determined that overexpression of FOXP2 inhibits the apoptosis of H9c2 cells induced by transfection of the miR-122-5p mimics and enhances viability, migration and invasion ability of the cells (Fig. 6B - Fig. 6E). Additionally, FOXP2 overexpression had upregulated the expression of the Bcl-2 protein in H9c2 cells transfected with the miR-122-5p mimics and inhibited the expressions of HIF-α, Bax and the cleaved-caspase 9 protein (Fig. 6F). These results indicated that XIST had regulated the miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury. Figure 6A: The FOXP2 overexpression plasmid and control plasmid were transfected into H9C2 cells for 48 h and the expression of the FOXP2 protein was detected by western blotting. B-E: FOXP2 and its control plasmid were co-transfected with Scramble or miR-122-5p mimics for 48 h under hypoxia according to the manufacturer’s instructions for Lipo3000. CCK8, Transwell and flow cytometry were used to detect cell viability, cell invasion and migration, and the extent of apoptosis, respectively. F: FOXP2 and its control plasmid were co-transfected with Scram or miR-122-5p mimics in H9c2 under hypoxia for 48 h according to the instructions of Lipo3000. Expression of the apoptosis-related protein was detected by western blotting. *p < 0.05, **p < 0.01, ***p < 0.001. Discussion Many patients in the world are suffering from ischemic heart disease. The key to effective treatment of ischemic cardiomyopathy is to restore cardiac function and the blood perfusion of the ischemic myocardium as soon as possible, and reduce apoptosis and necrosis of the cardiomyocytes [24]. However, ischemic myocardial tissue damages are aggravated after restoration of the blood supply and even cause irreversible damage [25]. Overproduction of reactive oxygen species, intracellular calcium overload and inflammatory cell infiltration are the most important features of a myocardial ischemia-reperfusion injury [26]. At present, many drugs
are used in combination or alone to prevent myocardial ischemia-reperfusion injury, but the extent of progress of these studies still cannot meet the clinical requirements [26, 27]. Therefore, the research on drugs to prevent and treat hypoxia-induced myocardial injury is very important clinically. In this work, H9c2 cells were subjected to hypoxia and it was observed that their viability had reduced, migration and invasion ability was inhibited, extent of apoptosis had increased, and XIST levels were significantly downregulated. By overexpressing lncRNA XIST in the H9c2 cells, we found that XIST could enhance the viability of H9c2 cells in a hypoxic environment, enhance cell migration and invasion, and reduce apoptosis. High levels of miR-122-5p is a prognostic marker of early ischemic cardiomyopathy [21]. Xin-Liang Yao et al. found that circulating miR-122-5p is a novel biomarker that could potentially be used for the diagnosis of acute myocardial infarction [28]. Analysis using the starBase database revealed that miR-122-5p is a potential target of lncRNA XIST and its level in H9c2 cells subjected to hypoxia increases significantly. Using the luciferase reporter assay and RNA immunoprecipitation, we found that XIST and miR-122-5p interact directly and XIST downregulates miR-122-5p levels, thereby attenuating hypoxia-induced H9c2 cell damage. This study provides new preventive and therapeutic clues for the countering ischemic cardiomyopathy. However, few shortcomings still exist. Firstly, the conclusions of this study have not been confirmed by conducting in vivo studies. Secondly, FOXP2 could play other roles in ischemic cardiomyopathy, which needs to be studied further. Finally, the specific localization of the role of lncRNA XIST in the cells has not been confirmed in this study. FOXP2 is an important transcriptional regulator in cells involved in processes like apoptosis, epithelial-mesenchymal transition, and migration [29, 30]. We found that FOXP2 is a potential target gene for miR-122-5p and is downregulated by it. Overexpression of FOXP2 inhibits hypoxia-induced expression of apoptotic proteins. Additionally, the expression of FOXP2 had increased after the overexpression of XIST; hence, we believe that XIST regulates the miR-122-5p/FOXP2 axis to attenuate hypoxia-induced H9c2 cardiomyocyte injury. Conflict of interest The authors declare no conflicts of interest. Funding This work was supported by grants from Traditional Chinese Medical science and technology plan of Zhejiang Province (2019ZA025) References [1] M. Li, W. Ding, M.A. Tariq, W. Chang, X. Zhang, W. Xu, L. Hou, Y. Wang, J. Wang, A circular transcript of ncx1 gene mediates ischemic myocardial injury by targeting miR-133a-3p, THERANOSTICS/8.854 8(21) (2018) 5855-5869. [2] D. Han, Y. Wang, J. Chen, J. Zhang, P. Yu, R. Zhang, S. Li, B. Tao, Y. Wang, Y. Qiu, M. Xu,
E. Gao, F. Cao, Activation of melatonin receptor 2 but not melatonin receptor 1 mediates melatonin-conferred cardioprotection against myocardial ischemia/reperfusion injury, J PINEAL RES/9.314 67(1) (2019) e12571. [3] M. Harada, X. Luo, T. Murohara, B. Yang, D. Dobrev, S. Nattel, MicroRNA regulation and cardiac calcium signaling: role in cardiac disease and therapeutic potential, CIRC RES/11.551 114(4) (2014) 689-705. [4] M.A. Song, A.N. Paradis, M.S. Gay, J. Shin, L. Zhang, Differential expression of microRNAs in ischemic heart disease, Drug Discov. Today 20(2) (2015) 223-35. [5] B.D. Adams, C. Parsons, L. Walker, W.C. Zhang, F.J. Slack, Targeting noncoding RNAs in disease, J. Clin. Invest. 127(3) (2017) 761-771. [6] B. Cai, W. Ma, F. Ding, L. Zhang, Q. Huang, X. Wang, B. Hua, J. Xu, J. Li, C. Bi, S. Guo, F. Yang, Z. Han, Y. Li, G. Yan, Y. Yu, Z. Bao, M. Yu, F. Li, Y. Tian, Z. Pan, B. Yang, The Long Noncoding RNA CAREL Controls Cardiac Regeneration, J. Am. Coll. Cardiol. 72(5) (2018) 534-550. [7] S.B. Ong, K. Katwadi, X.Y. Kwek, N.I. Ismail, S.G. Ong, K. Chinda, D.J. Hausenloy, Non-coding RNAs as therapeutic targets for preventing myocardial ischemia-reperfusion injury, Expert Opin. Ther. Targets
(2018).
[8] Y. Xu, Y. Li, J. Jin, G. Han, C. Sun, M.P. Pizzi, L. Huo, A. Scott, Y. Wang, L. Ma, J.H. Lee, M.S. Bhutani, B. Weston, C. Vellano, L. Yang, C. Lin, Y. Kim, A.R. MacLeod, L. Wang, Z. Wang, S. Song, J.A. Ajani, LncRNA PVT1 up-regulation is a poor prognosticator and serves as a therapeutic target in esophageal adenocarcinoma, MOL CANCER/5.888 18(1) (2019) 141. [9] C. Sun, S. Li, F. Zhang, Y. Xi, L. Wang, Y. Bi, D. Li, Long non-coding RNA NEAT1
promotes non-small cell lung cancer progression through regulation of miR-377-3p-E2F3 pathway, ONCOTARGET/5.008 7(32) (2016) 51784-51814. [10] Z.W. Zhang, J.J. Chen, S.H. Xia, H. Zhao, J.B. Yang, H. Zhang, B. He, J. Jiao, B.T. Zhan, C.C. Sun, Long intergenic non-protein coding RNA 319 aggravates lung adenocarcinoma carcinogenesis by modulating miR-450b-5p/EZH2, GENE/2.319 650 (2018) 60-67. [11] C.C. Sun, L. Zhang, G. Li, S.J. Li, Z.L. Chen, Y.F. Fu, F.Y. Gong, T. Bai, D.Y. Zhang, Q.M. Wu, D.J. Li, The lncRNA PDIA3P Interacts with miR-185-5p to Modulate Oral Squamous Cell Carcinoma Progression by Targeting Cyclin D2, Mol Ther Nucleic Acids 9 (2017) 100-110. [12] C.C. Sun, S.J. Li, G. Li, R.X. Hua, X.H. Zhou, D.J. Li, Long Intergenic Noncoding RNA 00511 Acts as an Oncogene in Non-small-cell Lung Cancer by Binding to EZH2 and Suppressing p57, Mol Ther Nucleic Acids 5(11) (2016) e385. [13] K.C. Yang, K.A. Yamada, A.Y. Patel, V.K. Topkara, I. George, F.H. Cheema, G.A. Ewald, D.L. Mann, J.M. Nerbonne, Deep RNA sequencing reveals dynamic regulation of myocardial noncoding RNAs in failing human heart and remodeling with mechanical circulatory support, CIRCULATION/17.047 129(9) (2014) 1009-21. [14]
P.
Wang,
Y.
Yuan,
LncRNA-ROR
alleviates
hypoxia-triggered
downregulating miR-145 in rat cardiomyocytes H9c2 cells, J. Cell. Physiol.
damages
by
(2019).
[15] H. Luo, J. Wang, D. Liu, S. Zang, N. Ma, L. Zhao, L. Zhang, X. Zhang, C. Qiao, The lncRNA H19/miR-675 axis regulates myocardial ischemic and reperfusion injury by targeting PPARα, Mol. Immunol. 105 (2018) 46-54. [16] H. Hu, J. Wu, D. Li, J. Zhou, H. Yu, L. Ma, Knockdown of lncRNA MALAT1 attenuates acute myocardial infarction through miR-320-Pten axis, Biomed. Pharmacother. 106 (2018)
738-746. [17] L. Feng, J.R. Houck, P. Lohavanichbutr, C. Chen, Transcriptome analysis reveals differentially expressed lncRNAs between oral squamous cell carcinoma and healthy oral mucosa, ONCOTARGET/5.008
(2017).
[18] F. Luan, W. Chen, M. Chen, J. Yan, H. Chen, H. Yu, T. Liu, L. Mo, An autophagy-related long non-coding RNA signature for glioma, FEBS OPEN BIO/2.101 9(4) (2019) 653-667. [19] J. Lu, J. Wu, Z. Zhao, J. Wang, Z. Chen, Circulating LncRNA Serve as Fingerprint for Gestational Diabetes Mellitus Associated with Risk of Macrosomia, CELL PHYSIOL BIOCHEM/4.652 48(3) (2018) 1012-1018. [20] J. Fang, C.C. Sun, C. Gong, Long noncoding RNA XIST acts as an oncogene in non-small cell lung cancer by epigenetically repressing KLF2 expression, Biochem Biophys Res Commun 478(2) (2016) 811-7. [21] N. Cortez-Dias, M.C. Costa, P. Carrilho-Ferreira, D. Silva, C. Jorge, C. Calisto, T. Pessoa, S. Robalo Martins, J.C. de Sousa, P.C. da Silva, M. Fiúza, A.N. Diogo, F.J. Pinto, F.J. Enguita, Circulating miR-122-5p/miR-133b Ratio Is a Specific Early Prognostic Biomarker in Acute Myocardial Infarction, Circ. J. 80(10) (2016) 2183-91. [22] A.A. Derda, A. Pfanne, C. Bär, K. Schimmel, P.J. Kennel, K. Xiao, P.C. Schulze, J. Bauersachs, T. Thum, Blood-based microRNA profiling in patients with cardiac amyloidosis, PLOS ONE/3.057 13(10) (2018) e0204235. [23] X. Liu, H. Meng, C. Jiang, S. Yang, F. Cui, P. Yang, Differential microRNA Expression and Regulation in the Rat Model of Post-Infarction Heart Failure, PLOS ONE/3.057 11(8) (2016) e0160920.
[24] K. Pryds, R.R. Nielsen, C.M. Hoff, L.P. Tolbod, K. Bouchelouche, J. Li, M.R. Schmidt, A.N. Redington, J. Frokiaer, H.E. Botker, Effect of remote ischemic conditioning on myocardial perfusion in patients with suspected ischemic coronary artery disease, J NUCL CARDIOL/2.929 25(3) (2018) 887-896. [25] M.Y. Wu, G.T. Yiang, W.T. Liao, A.P. Tsai, Y.L. Cheng, P.W. Cheng, C.Y. Li, C.J. Li, Current Mechanistic Concepts in Ischemia and Reperfusion Injury, CELL PHYSIOL BIOCHEM/4.652 46(4) (2018) 1650-1667. [26] K.Y. Chin, C. Qin, L. May, R.H. Ritchie, O.L. Woodman, New Pharmacological Approaches to the Prevention of Myocardial Ischemia- Reperfusion Injury, CURR DRUG TARGETS/3.029 18(15) (2017) 1689-1711. [27] A. Krzywonos-Zawadzka, A. Franczak, G. Sawicki, M. Wozniak, I. Bil-Lula, Multidrug prevention or therapy of ischemia-reperfusion injury of the heart-Mini-review, Environ Toxicol Pharmacol 55 (2017) 55-59. [28] X.L. Yao, X.L. Lu, C.Y. Yan, Q.L. Wan, G.C. Cheng, Y.M. Li, Circulating miR-122-5p as a potential novel biomarker for diagnosis of acute myocardial infarction, Int J Clin Exp Pathol 8(12) (2015) 16014-9. [29] D.M. DeLaughter, D.C. Christodoulou, J.Y. Robinson, C.E. Seidman, H.S. Baldwin, J.G. Seidman, J.V. Barnett, Spatial transcriptional profile of the chick and mouse endocardial cushions identify novel regulators of endocardial EMT in vitro, J. Mol. Cell. Cardiol. 59 (2013) 196-204. [30] H. Dietz, K. Haeussermann, G. Young, P. Kukura, Dissecting FOXP2 oligomerization and DNA binding, Angew. Chem. Int. Ed. Engl.
(2019).
Overexpression of XIST significantly increased the H9c2 cell viability, enhanced cell migration and invasion, and decreased cell apoptosis in a hypoxic environment. XIST interacted directly with miRNA-122-5p. Overexpression of XIST decreased the level of miRNA-122-5p significantly. mi-122-5p mimics increased H9c2 cell apoptosis and downregulated FOXP2 expression. Overexpression of FOXP2 upregulated the expression of the Bcl-2 protein in H9c2 cells transfected with microRNA-122-5p mimics and inhibited the expression of HIF-alpha, Bax, and the cleaved-caspase 9 protein. lncRNA
XIST
could
regulate
the
hypoxia-induced H9c2 cardiomyocyte injury
miR-122-5p/FOXP2
axis
to
attenuate