Localization and functional expression of alternatively spliced forms of the GABAA receptor γ2 subunit

MOLECULAR

AND CELLULAR

Localization JAMES ‘Department

M. SIKELA,*

NEUROSCIENCES

2, 338-343

(1991)

and Functional Expression of Alternatively Forms of the GABAA Receptor y2 Subunit NANCY J. LEIDENHEIMER,* CARLA GAMBARANA,t KARI J. BUCK,* AKBAR S. KHAN,* DONNA WILSON-SHAW,* AND RUTH E. SIEGELt

of Pharmacology, University of Colorado Health School of Medicine, Case Western Reserve Oregon

Health

Sciences

Sciences University, University,

0 1991 Academic

Press, Inc.

INTRODUCTION

The GABAA receptor is the site of action of y-aminobutyric acid (GABA), the major inhibitory neurotransmitter in the brain, as well as of the benzodiazepines and 1044-7431/91$3.00 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.

338

LIE-HUEY

Center, Denver, Colorado 80262; TDepartment Cleveland, Ohio 44106; and $Vollum Institute, Portland, Oregon 97201-3098

Received for publication

Recent studies have identified two alternatively spliced forms of the GABA* receptor yz subunit that differ by the presence (y& or absence (yzs) of an eight-amino acid segment. This insert in the y2~ isoform exists in the proposed cytoplasmic loop region, between M3 and M4, and contains a consensus sequence for phosphorylation by protein kinase C. To examine the regional distribution of this novel receptor subunit in the brain, yzL subunit mRNA was detected using both in situ hybridization histochemistry and PCR amplification methods. Hybridization histochemistry with a yzL subunit-specific oligonucleotide probe revealed that the yzL subunit mRNA is widely distributed throughout the mouse brain. The highest levels of expression are found in the cerebral cortex, hippocampus, olfactory lobe, and cerebellum. The presence of the ySL subunit in these regions was confirmed using PCR. Additionally, PCR experiments detected yzs subunit mRNA in the cerebral cortex and hippocampus but not in the cerebellum. To examine the functional properties of the yz subunit isoforms, yzs and yzL subunit mRNAs were coexpressed with al/II subunit mRNAs in Xenopus oocytes. These experiments indicate that the yzL and yzs subunit variants exhibit similar pharmacological properties, including the ability of both isoforms to confer diazepam sensitivity to the receptor complex. In addition, potentiation of GABA responses by pentobarbital in oocytes expressing either subunit isoform is similar. These data indicate that the presence or absence of the additional eight amino acids in the yZ subunit isoforms does not appear to alter the response of the GABAA receptor complex to either benzodiazepines and barbiturates at the level of protein phosphorylation present in the oocyte.

Spliced LIN,*

of Pharmacology,

May 16, 1991

barbiturates (reviewed in (l-4)). Molecular biological studies have revealed that the receptor is composed of several subunits, each of which is encoded by a family of distinct but related genes (reviewed in (5, 6)). While the importance of the different subunits in mediating GABAA receptor function is not completely known, the yZ subunit (referred to here as yZs) appears to be necessary for benzodiazepine potentiation of GABA responses (7). Although initial studies suggested the existence of a single y2 subunit, recent reports indicate that the transcript encoding the yZ subunit can be alternatively spliced to generate two products (8,9). These subunits differ by the presence (y& or absence (yZs) of an eight-amino acid segment. The additional amino acids in y2L subunit are found in the large cytoplasmic loop region between putative transmembrane domains 3 and 4 and contain a protein kinase C consensus sequence that can be phosphorylated in vitro (9). In this study the regional distributions of the y2s and y2L subunit mRNAs in brain have been examined using both in situ hybridization histochemistry and polymerase chain reaction (PCR) methods. Additionally, we have studied the functional properties of the y2s and y2L subunits by coexpressing these subunit mRNAs with ai& subunit mRNAs in Xenopus oocytes. METHODS

In Situ Hybridization

Histochemistry

Brains of C57 mice were rapidly removed and frozen on dry ice. Parasagittal sections (10 pm) were cut, mounted onto gelatin-coated slides, and stored at -80°C until use for hybridization histochemistry. Oligonucleotide probes were made by solid-phase synthesis on an Applied Biosystems DNA synthesizer (courtesy of Dr. Bruce Levison, Case Western Reserve University). The y2L subunit-specific probe was 32 bases in length (5’-GGGCCTTGAAGAAAAACATCCGAAGAAGAGGG-3’) and contained the 24-base sequence unique

LOCALIZATION

OF

GABA*

RECEPTOR

to this cDNA as well as 4 bases flanking the segment on either end. These nucleotides were added to facilitate hybridization of the probe while retaining specificity for the y2L mRNA. A second probe, y2s-yzL, which recognizes both y2s and yzL mRNAs was prepared. This probe was 40 bases in length (5’-GGTTGCTGATCTGGGACGAATATCAATGGTAGGGGCAGGG-3’) and was complementary to a sequence in the large cytoplasmic loop between transmembrane regions 3 and 4. Because the entire y2s sequence is also present in yzL, it was not possible to generate a probe of comparable length for hybridization histochemistry that would reliably allow the localization of the y2s mRNA exclusively. As a control for the specificity of hybridization, some sections in each experiment were hybridized with a bovine (Y~subunit sense probe (bases 809-848 (10)). All probes were labeled with [35S]deoxyadenosine 5’-(a-thio)triphosphate (NEN) and terminal deoxynucleotidyl transferase (Bethesda Research Labs) (11). Hybridization histochemistry was performed as previously described (12, 13). All slides were hybridized with buffer containing 7.5 X lo5 cpm of 35Slabeled oligonucleotide probe for 21-22 h at room temperature. Following hybridization, the slides were placed against Kodak X-AR film and exposed at room temperature for 3-4 weeks to allow the regional localization of the subunit mRNAs.

Polymerase Chain Reaction Poly(A)+ mRNA was isolated from cerebellum, cortex, and hippocampus of Long Sleep mice using the FASTTrack mRNA isolation kit (Invitrogen). Animals were sacrificed and the brain regions quickly dissected on ice, frozen and ground in liquid nitrogen, and immediately subjected to detergent lysis. Poly(A)+ mRNA was isolated by batch binding with oligo(dT)-cellulose. The mRNA was then extracted with phenol:chloroform and stored as a precipitate in 2 vol of 100% ethanol and 0.1 vol of 3 M sodium acetate. Prior to each experiment aliquots of mRNA were centrifuged, rinsed twice with 70% ethanol, and resuspended in sterile diethylpyrocarbonate-treated water. To prepare the cDNA from the mouse brain mRNA, first-strand cDNA was synthesized from 1 pg of mRNA using the cDNA cycle kit for reverse transcriptase-polymerase chain reaction (Invitrogen) and oligo(dT) priming. The reaction was incubated at 42°C for 1 h, heated to 95°C for 5 min, and immediately chilled on ice. One-tenth of the cDNA product was amplified by polymerase chain reaction in a Perkin-Elmer Cetus thermal cycler using primers MGy,-6 and MGr2-7, which were derived from sequences specific to the y2 subunit within the intracellular loop near the putative third and fourth membranespanning regions, respectively; MG-y2-6, 5’ A A TI’AACC CTCACTAAAGGGAACGGAAGCCAAGCAAGGAT AAAGAC 3’; and MGy,-7, 5’ TAATACGACT CACTATAGGGAGATATTCTTCATCCCTCTCTTG

y2 SUBUNIT

mRNAs

339

AAG 3’. The y2s and yzL subunit cDNAs were amplified in a final volume of 100 ~11X PCR buffer containing 200 PM of each dNTP, 65 pmol MGy,-6 sense primer, 65 pmol MGy,-7 antisense primer, 1.5 mM MgC12, 2.5 Units of AmpliTaq DNA polymerase, and 4 PCi [w~‘P]~ATP (3000 Ci/mmol). AmpliTaq DNA polymerase and dNTPs were from the GENEAMP kit (Perkin-Elmer Cetus). The samples were denatured at 94°C for 1 min. The primers were annealed at 60°C for 2 min and extended at 72°C for 3 min. After 50 cycles, the PCR product was incubated at 72°C for 10 min to extend incomplete products. After PCR amplification, y2s and yzL subunit cDNAs were resolved by polyacrylamide gel electrophoresis in an 8% acrylamide gel. Two products, 223 bp (yzL) and 199 bp (y2s), were visualized by autoradiography.

Expression of Subunit mRNAs in Xenopus Oocytes The yzL cDNA was cloned by screening a Balb/C mouse brain cDNA library using an oligonucleotide derived from the N-terminal region of the human y2 sequence (7). A positive clone containing a 2231-bp insert was isolated and sequenced. This clone is identical to the sequence recently reported by Kofuji et al. (8) except that the Balb/ C cDNA contains an additional 200 bases of the 5’ untranslated sequence. The sequence of this clone has been deposited with the EMBL/GenBank Data Libraries under Accession No. M62374. To synthesize mRNAs for expression studies, recombinant plasmids containing cDNA inserts were first linearized with appropriate restriction enzymes and treated with proteinase K and transcription reactions were carried out with either T7 or T3 RNA polymerase using the mCAP RNA capping kit as directed by the supplier (Stratagene). The mRNAs were then extracted with phenol, precipitated with ethanol, and stored at -20°C. Prior to injection into the oocytes, the mRNAs were pelleted, washed, and resuspended in sterile diethylpyrocarbonatetreated water. Each oocyte was injected with a 50-nl solution of mRNA (50-75 ng), incubated for 2-3 days, and then tested for drug responses. The mRNAs used included those encoding the (Yesubunit (14), the yzL subunit (see above), and the & and y2s subunits (generously provided by Dr. David Burt, Univ. of Maryland). The response characteristics of oocytes coexpressing the &ll, &y2s, or a&yzL subunit mRNA combinations were assessed using standard two-electrode voltage-clamp techniques (15). For electrophysiological recordings, oocytes were placed, animal pole up, in a 50-~1 volume bath and continually perfused with modified Barth’s solution (MBS) containing 88 mM NaCl, 1 miV KCl, 2.4 n&f NaHC03, 10 mM Hepes, 0.82 n&f MgSO,, 0.33 mM Ca(N03), and 0.91 mit4 CaC12. GABA responses were assessed by application of GABA (30 PM, Sigma) for 30 s in the perfusate. The modulation of GABA responses by diazepam and pentobarbital was examined by perfusing the oocytes with either diazepam (100 nM, gift from Dr.

340

SIKELA

ET

AL.

Peter Sorter, Hoffman-LaRoche Co., Nutley, NJ) or pentobarbital (100 PM, Sigma) for 30 s followed by a 30-s coapplication of GABA (30 @CLM) and the test drug. RESULTS

Localization

of the mRNA Encoding the yzL Subunit

Hybridization histochemistry with the y2L subunitspecific probe revealed that the y2L subunit mRNA was abundant and widely distributed throughout the mouse brain (Fig. 1). The highest levels of expression were observed in the cerebellar cortex, mitral cell layer of the olfactory bulb (not shown), and hippocampus. In the latter region, the mRNA was present in the granule cell layer of the dentate gyrus and in the pyramidal cell layer of the CAl-CA3 regions. In addition, the mRNA was abundant in the neocortex and inferior colliculus, while somewhat lower levels of expression were apparent in the thalamic nucleus, caudate-putamen, and brain stem. While this regional pattern of distribution was similar to that observed following hybridization with the y2s-y2L mRNA probe, some differences were apparent. In particular, the y2L subunit mRNA appeared to be unevenly distributed in the cortex, whereas a more homogeneous pattern was observed with the y2s-y2~ mRNA probe. In contrast to the patterns observed following hybridization with the y2 subunit probes, only a background signal of uniform intensity was found with a sense probe, thus confirming the specificity of hybridization (not shown). The expression of the y2L subunit mRNA was further examined at higher resolution in the cerebellum. In the cerebellar cortex, where individual cell populations are easily identified, virtually all Purkinje neurons were labeled (not shown). In addition, positive cells were observed in the granule and molecular cell layers. Finally, cells expressing the y2L subunit mRNA were also found in the deep cerebellar nuclei. The same pattern was observed following hybridization with the ~~s--y~~probe. To further study the brain distribution of the y2 subunit isoforms we have used the PCR amplification method. Using this approach we were able to specifically detect y2s and y2L subunit mRNAs in several brain regions. Autoradiographic resolution of PCR-amplified cDNA products generated from mouse brain mRNAs is shown in Fig. 2. The presence of y2L subunit mRNA was detected in cortex, cerebellum, and hippocampus. In contrast, yzs subunit mRNA was visualized in cortex and hippocampus but not in cerebellum. Functional Expression of the yzL and y2s Subunit mRNAs in Xenopus Oocytes Representative recordings of GABA-activated chloride currents in oocytes expressing GABAA receptor subunit mRNAs are presented in Fig. 3. Coexpression of the q and & subunit mRNAs (Fig. 3A) resulted in GABA-stim-

FIG. 1. Localization of GABA* receptor y2 subunit mRNAs in the mouse brain following in situ hybridization histochemistry. Sagittal sections of adult brain were hybridized with ‘%labeled yzL-yzs (top) and yzL (bottom) probes and exposed 3 weeks for film autoradiography. Abbreviations: CX, cortex; HI, hippocampus; IC, inferior colliculus; GR, granule cell layer of the cerebellum. Bar = 3 mm. Similar results were obtained in several experiments using brain sections prepared from different animals.

ulated chloride currents that were potentiated by 100 PM pentobarbital. Consistent with previous studies, diazepam did not potentiate GABA responses in cells expressing only ai& subunit mRNAs (7). In contrast, coexpression of the (pi and & subunit mRNAs with either y2s (Fig. 3B) or y2L (Fig. 3C) subunit mRNAs resulted in GABA responses that were potentiated by both pentobarbital(lO0 PM) and diazepam (100 nM). Average values (percentage of GABA control responses + SEM) for pentobarbital potentiation of GABA responses in oocytes expressing al/3iy2s and q/3iypL subunit mRNAs were 337 (n = 2) and 380 + 38 (n = 5), respectively. Average values for diazepam

LOCALIZATION

OF

GABA*

RECEPTOR

-223 -199

FIG. 2. Detection of mouse brain GABAA receptor y2s subunit mRNA isoforms using the polymerase chain reaction technique. After reverse transcription from mouse brain mRNAs 3ZP-labeled cDNAs specific for yzL and yzs subunits were amplified by PCR using yz isoformspecific oligonucleotide primers. The 223- and 199-bp products correspond to y2L and y2s subunit mRNAs, respectively.

y1 SUBUNIT

showing that a y2 subunit probe recognizes y2 subunit mRNAs throughout the rat brain (17). Since this study was performed prior to the discovery of the alternatively spliced variant, the distribution of the two y2 subunit isoforms was not distinguished by the use of isoform-specific probes. High resolution examination of subunit mRNAs indicates that y2L subunit mRNA is expressed in many hippocampal cell populations including granule cells of the dentate gyrus and pyramidal cells of the CAl-CA3 regions. Using PCR amplification methods we have confirmed the presence of y2L subunit mRNA in the hippocampus and have also detected y2s subunit mRNA in this region. In contrast to our results, Whiting et al. demonstrated the presence of y2s, but not y2L, subunit mRNA in rat hippocampus (9). The disparity between these findings may reflect differences in subunit expression between these two rodent species. In the cerebellum, high resolution in situ hybridization studies show the presence of y2L subunit mRNA in Pur-

GABA 30UM

GABA

GABA

GABA

GABA

30&l +DZ

30lJM

30f.M +PB

30uM

1OOnM

potentiation in oocytes expressing c&y2s and al&yzL subunit mRNAs were 167 + 18 (n = 5) and 159 f 8 (n = 7), respectively. The ability of these compounds to potentiate GABA responses was not significantly different between (~i&yz~ and c&yZs subunit mRNAs when analyzed by the unpaired t test. For these experiments, the series of drug applications was performed only once per oocyte (n values refer to the number of oocytes tested).

341

mRNAs

1OOuM

4 min

DISCUSSION

The GABA* receptor is postulated to be a heteropentameric complex for which multiple (>14) subunits have been cloned and sequenced. Each subunit is encoded by distinct, but related, genes. Although the exact subunit composition of GABA, receptors is unknown, the differential combination of subunits provides a mechanism for generating GABA* receptor diversity. Recently, an additional mechanism for creating diversity, the alternative splicing of gene transcripts encoding GABAA receptor subunits, has been described (16, 17). In the present report, we have examined the brain localization and functional properties of the yzL subunit, an alternatively spliced variant of the subunit previously termed y2. Localization of yz isoform mRNAs using in situ hybridization histochemistry shows that a y2L subunit-specific probe and a y2s-y2L subunit probe (which recognizes both y2 subunit mRNAs) produce similar hybridization patterns, suggesting that most brain regions express both isoforms. Our data are in agreement with previous results

4 min

FIG. 3. Two-electrode voltage-clamp recordings of GABA-gated Clcurrents in Xenopus oocytes coexpressing GABA* receptor subunit mRNAs. Pharmacological profiles of GABA responses were recorded from oocytes expressing (A) u#i, (B) al&y=, and (C) al&yzL subunit combinations. Oocytes were voltage-clamped at -90 mV and drugs were applied as described in the text. Time intervals between drug applications were greater than 5 min to allow recovery from receptor desensitization. DZ, diazepam; PB, pentobarbital.

342

SIKELA

kinje neurons, in the deep cerebellar nuclei, and in cells of the granule and molecular layers. Consistent with these data, yzL subunit mRNA was detected in the cerebellum using PCR. Interestingly, under our conditions, we have failed to detect the presence of yzs subunit mRNA in the cerebellum. It is possible that y2s subunit mRNA is present in low abundance in this region and would be detected using a greater number of PCR amplification cycles. Expression of y2L subunit mRNA was also examined in the cortex. In this brain region the y2L subunit-specific probe produced a more heterogeneous hybridization pattern than the y2s-y2L subunit probe, indicating that perhaps the two subunit isoforms are differentially localized in this region. The presence of both y2 isoforms in the cortex was confirmed using PCR. In the cortex, as well as in other brain regions, it remains to be determined whether yzs and y2L subunit mRNAs are expressed in the same cell. To investigate the functional properties of the yeL subunit we have used the Xenopus oocyte expression system. Consistent with the literature, our findings demonstrate that the coexpression of the (Y~and pi subunit mRNAs produces GABA* receptors that are insensitive to the benzodiazepines (7, U-20). In the present study, we show that the alternatively spliced y2L subunit, similar to the yzs subunit (7, 20), confers benzodiazepine sensitivity to the complex. Furthermore, responses of the oocytes to GABA, pentobarbital, and diazepam appear to be similar for both the yzs and y2L subunit variants. Our studies, therefore, suggest that the presence (y2L) or absence (y2s) of a PKC phosphorylation site in the y2 subunit isoforms does not appear to alter benzodiazepine and barbiturate sensitivity, at least at the level of protein phosphorylation found in the Xenopus oocyte. These initial results, however, do not rule out the possibility that the y2L subunit variant confers distinct pharmacological properties on the GABA* receptor complex. In this regard, recent studies indicate that coexpression of c$i subunits with the y2L, but not the yzs, subunit confers ethanol sensitivity to the GABA* receptor (21). Given the novel function of this receptor subunit it is possible that the ethanol insensitivity of some GABA* receptors in certain brain regions and cell populations (reviewed in (22)) is due to the absence of the y2L subunit. Here, we have detected y2L subunit mRNA in a variety of neurons including the Purkinje cells of the cerebellum and pyramidal cell layers of the CA1 and CA3 regions of the hippocampus. Some, but not all, studies have shown the presence of ethanol-sensitive GABA* receptors in these neuronal populations (22). Interestingly, site-directed mutagenesis of the serine residue found in the PKC consensus sequence of the y2L subunit converts the receptor to an ethanol-insensitive form (23), suggesting that the phosphorylation state of the y2~ subunit may determine the ethanol sensitivity of the receptor. Thus, ethanol modulation of GABA* recep-

ET

AL.

tor function may require not only the presence of the y2L subunit, but also a specific posttranslational state. In this regard, ethanol potentiation of GABAA receptors in cerebellum Purkinje cells appears to be dependent on a phosphorylation pathway (22). Studies are currently under way to investigate whether changes in the phosphorylation state of the GABA, receptor can influence its modulation by ethanol and other pharmacological agents such as benzodiazepines. ACKNOWLEDGMENTS We thank Dr. R. A. Harris for providing oocyte expression facilities and for helpful discussions and Dr. D. Burt for providing the mouse & cDNA clone. We extend our grateful appreciation to Misi Robinson and Jan Hopkins for excellent technical assistance. Thii work was supported by USPHS Grants AA03527, AA06399, and NS27322 (J.M.S.) and grants from NIMH (MH42173), NSF (BNS-9021230), and the Mathers Foundation (R.E.S.). C.G. is a Research Fellow of the American Heart Association, Northeast Ohio Affiliate, Inc.

REFERENCES 1.

Harris, channels

2.

Olsen, R. W. (1982). Drug interactions at the GABA receptorionophore complex. Annu. Rev. Phurmacol. Toxicol. 22: 245-271. Stephenson, F. A. (1988). Understanding the GABA* receptor: A chemically gated ion channel. Biochem. J. 249: 21-32. Tallman, J. F., and D. W. Gallager (1985). The GABA-ergic system: A locus of benzodiazepine action. Annu. Rev. Neurosci. 8: 21-44.

3. 4. 5. 6. 7.

8.

R. A., and A. M. Allan and genetics. FASEB

(1989). Alcohol J. 3: 1689-1695.

Olsen, R. W., and A. J. Tobin (1990). Molecular receptors. FASEB J. 4: 1469-1480. Schofield, P. R. (1989). The GABAA receptor: reveals a complex picture. Trends Phurmacol.

intoxication:

Ion

biology

of GABA*

Molecular Sci. 10:

476-478.

biology

Pritchett, D. B., H. Sontheimer, B. D. Shivers, S. Ymer, H. Kettenmann, P. R. Schofield, and P. Seeburg (1989). Importance of a novel GABAA receptor subunit for benzodiazepine pharmacology. Nature 338: 582-585. Kofuji, P., J. G. Wang, S. J. Moss, R. L. Huganir, and D. R. Burt (1991). Generation of two forms of the y-aminobutyric acid* receptor y,-subunit in mice by alternative splicing. J. Neumchem. 56: 713-715.

9.

Whiting, P., R. M. McKernan, and L. L. Iversen (1990). Another mechanism for creating diversity in y-aminobutyrate type A receptors: RNA splicing directs expression of two forms of yz subunit, one of which contains a protein kinase C phosphorylation site. Proc. Natl. Acad. Sci. USA 87: 9966-9970.

10.

Schofield, P. R., M. G. Darlison, N. Fujita, D. R. Burt, F. A. Stephenson, H. Rodriguez, L. M. Rhee, J. Ramachandran, V. Reale, T. A. Glencourse, P. H. Seeburg, and E. A. Barnard (1987). Sequence and functional expression of the GARA-A receptor shows a ligand-gated receptor superfamily. Nature 328: 221-117. Siegel, R. (1989). Localization of neuronal mRNAs by hybridization histochemistry. In Methods in Neurosciences (P. Conn, Rd.), Vol. 1, pp. 136-150. Academic Press, San Diego.

11.

12.

Siegel, R. (1988). receptor subunits bovine cerebellum.

The mRNAs encoding are localized in different Neuron 1: 579-584.

GABA&enzodiazepine cell populations

of the

13.

Gambarana, C., R. Pittman, Z. Rodriguez, and R. E. Siegel (1990). Developmental expression of the GABA, receptor al subunit mRNA in the rat brain. J. Neumbiol. 21: 1169-1179.

14.

Keir,

W. J., C. A. Kozak,

A. Chakraborti,

R. A. Deitrich,

and

LOCALIZATION

OF

GABA*

RECEPTOR

J. M. Sikela (1991). The cDNA sequence and chromosomal location of the murine GABAA (~1 receptor gene. Genomics 9: 390-395. 15.

16.

Wafford, D. A., D. M. Burnett, T. V. Dunwiddie, and R. A. Harris (1990). Genetic differences in the ethanol sensitivity of GABA* receptors expressed in Xerwpus oocytes. Science 249: 291-293. Bateson, A. N., A. Lesham, M. G. Darlinson (1991). y-Aminohutyric acidA receptor heterogeneity is increased by alternative splicing of a novel P-subunit gene transcript. J. Neurochem. 66: 1437-1440.

17.

Shivers, B. D., I. Killishch, R. Sprengel, H. Sontheimer, P. R. Schofield, and P. H. Seeburg (1989). Two novel ceptor subunits exist in distinct neuronal subpopulations. 3: 327-337.

18.

Levitan, E. S., P. R. Schofield, D. R. Burt, L. M. Rhee, W. Wisden, M. Kohler, N. Fugita, H. F. Rodriguez, A. Stephenson, M. G. Darlinson, E. A. Barnard, and P. H. Seeburg (1988). Structural and functional basis for GABAA receptor heterogeneity. Nature 335: 76-79.

y2 SUBUNIT

mRNAs

343

19.

Levitan, E. S., L. A. Blair, V. E. Dionne, and E. A. Barnard (1988). Biophysical and pharmacological properties of cloned GABA,, receptor subunits expressed in Xenopus oocytes. Neuron 1: 773-781.

20.

Moss, S. J., A. Ravindran, L. Mei, J. B. Wang, Huganir, and D. R. Burt (1991). Characterization GABA* receptors produced in transfected cells 81 and y2 subunit cDNAs. Neurosci. Lett. 123:

21.

Wafford, K. A., D. M. Burnett, N. J. Leidenheimer, D. R. Burt, J. B. Wang, P. Kofuji, T. V. Dunwiddie, R. A. Harris, and J. M. Sikela (1991). Ethanol sensitivity of the GABAA receptor expressed in Xenopua oocytes requires 8 amino acids contained in the ysL subunit. Neuron 7: 27-33.

22.

Leidenheimer, N. J., and R. A. Harris (1992). ethanol on GABA* receptor function: Molecular determinants. Adv. Biochem. Psychopharmacol.,

23.

Wafford, K. A., P. Whiting, and J. A. Kemp (1992). Functional modulation of cloned GABA* receptors expressed in Xenopus oocytes. Adv. Biochem. Psychopharmacol., in press.

M. Kohler, GABA, reNeuron

P. Kofugi, R. L. of recombinant from murine (~1, 265-268.

Acute effects and physiological in press.

of