Localization of phosphatase inhibitor-1 mRNA in the developing and adult rat brain in comparison with that of protein phosphatase-1 mRNAs

MOLECULAR BRAIN RESEARCH ELSEVIER

Molecular Brain Research 25 (1994) 7-18

Research Report

Localization of phosphatase inhibitor-1 mRNA in the developing and adult rat brain in comparison with that of protein phosphatase-1 mRNAs Hiroyuki Sakagami a,,, Keiichi Ebina b, Hisatake Kondo

a

a Department of Anatomy, Tohoku University, School of Medicine, Seiryou-machi 2-1, Sendai 980, Japan b Department of Hygienic Chemistry, Tohoku College of Pharmacy, Sendai, Japan Accepted 1 March 1994

Abstract

The localization and ontogenic changes in the gene expression for phosphatase inhibitor-1 (I-1) were analyzed by in situ hybridization histochemistry, and they were compared with those for three catalytic subunits of protein phosphatase type 1 (PP-1). At the adult stage, intense expression signals for I-1 were detected in the hippocampal formation, piriform cortex, claustrum, dorsal endopiriform cortex, suprachiasmatic nucleus, choroid plexus, arachnoid membrane, and pineal body. Moderate expression signals for I-1 were observed in the olfactory neuronal layers, caudate putamen, layers II-IV, and VI of the neocortex, and cerebellar granule cells, whereas the expression levels were low in the thalamus, cerebellar Purkinje cells, and brain stem nuclei. Although the expression levels for the three PP-1 mRNAs varied notably in various brain regions, a relatively high and parallel expression of I-1 and PP-1 mRNAs was found in most regions of the forebrain. However, the dissociation in the expression levels between I-1 and PP-1 mRNAs was found in several loci: the laminar expression of I-1 mRNA versus the homogeneous expression of PP-1 mRNAs in the cerebral cortex; low levels of expression of I-1 mRNA versus relatively high expression of PP-1 mRNAs in the brain stem nuclei; high expression of I-1 mRNA in the arachnoid membrane versus low expression of PP-1 mRNAs in it. The unparallel expression was also seen in embryonic brain: No significant expression of I-1 mRNA versus substantial expression of PP-1 mRNAs in the ventricular zone and cerebellar external granular layer; transiently high expression of I-1 mRNA in developing thalamus versus constantly moderate to low expression of PP-1 mRNAs there. These findings suggest that I-1 may play some discrete roles independent of the regulation of PP-1 in certain regions and developing stages of the brain.

Key words: Protein phosphatase 1; Inhibitor-l; Central nervous system; Ontogeny; In situ hybridization

I. Introduction

Reversible addition or removal of phosphate esters on serine and threonine hydroxyls by protein kinases and phosphatases is an important mechanism in control of the activity of many intracellular proteins which contribute to the characteristic structures and functions of neurons as well as many other cells [11,13]. Protein phosphatases are subdivided into two groups, type-1 and -2 protein phosphatases (PP-1 and PP-2), depending on whether they are inhibited by, or insensitive to two small thermo- and acid-stable proteins,

* Corresponding author. Fax: (81) 22-272-7273. 0169-328X/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved

SSDI 0 1 6 9 - 3 2 8 X ( 9 4 ) 0 0 0 3 9 - H

termed phosphatase inhibitor-1 (I-1) and -2 (I-2), and whether they dephosphorylate the /3 subunit of phosphorylase kinase specifically or the a subunit preferentially. I-1 was originally identified and purified from rabbit skeletal muscle and has an apparent molecular weight of 26,000 in rabbit as estimated by S D S - P A G E [9,14]. I-1 is only effective as a specific and potent inhibitor of PP-1 when phosphorylated by cyclic AMPdependent protein kinase (A-kinase), whereas I-2 does not require phosphorylation to be an inhibitor of PP-1 [5]. Thus I-1 provides a mechanism to enhance the effect of cyclic A M P because many substrates for PP-1 are phosphorylated by A-kinase. In general, information concerning the detailed localization of given substances and their gene expres-

8

H. Sakagami et al./Molecular Brain Research 25 (1994) 7-18

sion in tissues a n d cells is c r u c i a l to u n d e r s t a n d t h e i r f u n c t i o n a l s i g n i f i c a n c e a n d this is e s p e c i a l l y t r u e in b r a i n w h i c h is c o m p o s e d o f cells h a v i n g r e m a r k a b l e h e t e r o g e n e i t y in t e r m s o f s t r u c t u r e a n d f u n c t i o n . R e g a r d i n g I-1, p r e v i o u s i m m u n o h i s t o c h e m i c a l s t u d y has r e v e a l e d t h e o c c u r r e n c e o f n e u r o n s a n d n e r v e fibers i m m u n o r e a c t i v e for I-1 in a d u l t rat b r a i n [8]. H o w e v e r , t h e i m m u n o h i s t o c h e m i c a l f i n d i n g s a r e in g e n e r a l n o t s u f f i c i e n t a n d o f t e n r a t h e r d i s a d v a n t a g e o u s for t h e exact identification of neuronal somata synthesizing g i v e n s u b s t a n c e s in t h e b r a i n , a n d s i m u l t a n e o u s locali z a t i o n o f t h e i r m R N A s by in situ h y b r i d i z a t i o n analysis is c r u c i a l for t h e p u r p o s e . W e t h u s p e r f o r m e d a det a i l e d analysis o n t h e l o c a l i z a t i o n o f I-1 m R N A in m a t u r e a n d d e v e l o p i n g rat b r a i n s by in situ h y b r i d i z a tion. W e f u r t h e r l o c a l i z e d m R N A s o f t h r e e c a t a l y t i c s u b u n i t s o f PP-1 in t h e b r a i n a n d c o m p a r e d t h e localization o f g e n e e x p r e s s i o n for t h e s e s u b s t a n c e s in o r d e r to e l u c i d a t e f u r t h e r f u n c t i o n a l s i g n i f i c a n c e o f I-1 a n d PP-1 in t h e p h o s p h o r y l a t i o n / d e p h o s p h o r y l a t i o n cycle r e l e v a n t to t h e i n t r a c e l l u l a r signal t r a n s d u c t i o n .

and 3zP-labeled oligonucleotide probes. The filters were then washed twice in 2×SSC/0.1% SDS for 15 min, followed by washing in 1 x SSC/0.1% SDS for 30 min at 55°C four times. Radioactive bands were detected by film autoradiography.

11

A 28

I~

.....

2. M a t e r i a l s a n d m e t h o d s 2.1. Probe preparation

Antisense 45 mer oligonucleotides for I-1 and PP-ls were synthesized with DNA synthesizer (MilliGene/Biosearch Model 7500). The oligonucleotide probe for I-1 was complementary to nucleotides 536-580 of the 3' non-coding region of the rat I-1 cDNA [6l: 5'

O

B

AACATCCAGTGTCCATGAACTTCCACACTCACTGGCGATC-

CCCGG 3'. The oligonucleotide probes for a, 7 and 3 catalytic subunits of PP-I were complementary to nucleotides 1060-1104, 1905-1949, and 1337-1381 of the non-coding regions of cDNAs for a, 71 and ~5 catalytic subunits of rat PP-1 [18]: 5' GGCAGCATGATTTCTGTACAAATAATCCGTCATCTGGGGCAGAGG 3', 5' ATAATTTGAAGCTTTCTGAATGGACGGGTTCAGGCCTGATCCAAC 3', 5' GCCACATTACACAGATGGATCTTCATGCTCTCATCTGGGTAACTA 3', respectively. The oligonucleotide probes were 3' end-labeled with [a-32p] dATP or [a-3sS]dATP (New England Nuclear) by terminal deoxynucleotidyl transferase (Bethesda Research Labs, USA) for Northern blot analysis or in situ hybridization analysis, respectively.

2B'~

13

2.2. Northern blot analysis

Total RNAs were isolated from rat brains at stages of the embryonic days 15 (El5), 18 (El8), 20 (E20), and postnatal days 0 (P0), 7 (P7), 14 (PI4), 21 (P21), 49 (P49) using the acid guanidinium/phenol/chloroform extraction [4]. The day of insemination was counted as E0. Total RNAs (25 /xg) from rat brains on various stages were electrophoresed on 1.5% agarose/2.2 M formaldehyde gel and transferred onto nylon filter membranes for 15-18 h. Blots were prehybridized at 42°C in a solution containing 50% formamide, 5xSSC ( I x S S C = 1 5 0 mM NaCI and 15 mM sodium citrate), 1 x Denhardt's solution (0.02% Ficol, 0.02% polyvinylpyrrolidone and 0.02% bovine serum albumin), 50 mM phosphate buffer (PB) (pH 7.2), and 250 /xg/ml heat-denatured salmon sperm DNA. Hybridization was performed at 42°C overnight in a solution containing 50% formamide, 6 x SSC, 1% sodium dodecyl sulfate (SDS), 250 /xg/ml heat-denatured salmon sperm DNA,

Fig. 1. Northern blot analysis of mRNAs for I-1 (A) and PP-1 a (B), y (C), 3 (D) catalytic subunits in the developing rat brains. The position of the 18S and 28S ribosomal RNA subunits are shown on the left.

H. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18 2.3. In situ hybridization histochemistry Tissue specimens were obtained from Wister-Imamichi rats at El5, El8, E20, P0, P7, P14, P21, and P49 under ether anesthesia. Fresh frozen sections were made on a cryostat at a thickness of 30 ~m in either sagittal or coronal planes, and mounted on silane-coated glass slides. After the sections were fixed in 4% paraformaldehyde/ 0.1 M PB (pH 8.0) for 10 min at room temperature, the sections were acetylated in 0.25% acetic anhydrate/0.1 M triethanolamine (pH 8.0) for 10 min. Following dehydration through graded ethanol (50, 75, 100%) and air-drying, the sections were subjected to incubation in a prehybridization solution containing 50% deionized formamide, 4× SSC, 1 ×Denhardt's solution, 1% sodium N-lauroyl sarcosinate (Sarkosyl), 0.1 M PB (pH 7.2), and 250 /zg/ml heat-denatured salmon sperm DNA for 1 h at room temperature. Hybridization was performed at 42°C overnight in the solution containing 50% deionized formamide, 4xSSC, l×Denhardt's solution, 1% Sarkosyl, 0.1 M PB (pH 7.2), and 250 # g / m l heat-denatured salmon sperm DNA, 100 mM dithiothreitol, 10% dextran sulfate, and 35S-labeled oligonucleotide probe (5-10×10 s cpm/50 /~1). After hybridization, the sections were washed in 1 x SSC at 55°C four times for 30 min. The sections were exposed to Hyperfilm fl-max (Amersham) for 5-15 days at room temperature and were then dipped in NTB2 nuclear track emulsion (Kodak) diluted at 1:1 with distilled water. After exposure for 2-3 weeks at 4°C, the dipped sections were developed in D-19 developer (Kodak), fixed, and counter-stained with hematoxylen or Cresyl violet. For specificity control, hybridization was performed in the presence of 100-fold excess of the unlabelled oligonucleotide probe.

9

3. R e s u l t s

3.1. Northern blot analysis Each oligonucleotide probe for I-1 or PP-ls hybridized to discrete species of brain mRNAs whose sizes were individually consistent with those of cDNAs for corresponding proteins reported in the previous studies [6,18]: 0.7 and 1.8 kilobases (kb) for I-1, and 1.5, 2.6, 3.2 kb for a, 7, ~ subunits of PP-1, respectively (Fig. 1). This indicates that each oligonucleotide probe is specific to the corresponding mRNA under the hybridization and washing stringency adopted for the present hybridization study. During the prenatal development, a substantial, though low, level of gene expression for I-1 was detected in the brain on El5, which is the earliest stage examined for the present Northern blot analysis. Thereafter, the expression level for I-1 mRNAs increased progressively during the pre- and early postnatal development. The gene expression for I-1 reached the maximum on P7-14 and decreased slightly on P21-49 (Fig. 1A). On the other hand, the expression levels for PP-ls were already high at El5 and remained

o

t, Fig. 2. General expression patterns of mRNAs for I-1 (A) and PP-1 a (B), 3' (C), 8 (D) catalytic subunits in sagittal sections of the adult rat brain. Note that differential expression patterns of I-1 and PP-1 mRNAs were in the adult rat brain. OB, olfactory bulb; CP, caudate putamen; H, hippocampal formation; Th, thalamus; SC, superior colliculus; IC, inferior colliculus; Pn, pontine nuclei; Cb, cerebellar cortex. Bars = 5 mm.

10

11. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

high during the pre- and early postnatal development, whereas the expression levels decreased on P49 (Fig. 1B,C,D). 3.2. In situ hybridization analysis

Fig. 2 shows overall expression patterns of I-1 and three catalytic subunits of PP-1 mRNA throughout the adult rat brain in sagittal sections. In general, the gene expression for the I-1 was distributed in more restricted brain areas than those of three subunits of PP-1. The relative expression levels of each protein mRNA by visual comparison of the extent of silver grain accumulation are summarized in Table 1. In the control experiment, no significant expression signals were detected when a 100-fold excess of the unlabeled probe for each protein was coincubated with the labeled one in the hybridization buffer. 3.3. I-1 m R N A in the adult brain

In the olfactory bulb, moderate expression signals for I-1 mRNA were detected in the internal granule cells, mitral cells, and periglomerular cells of the olfactory bulb (Fig. 3A). Intense expression signals were detected in the piriform cortex, dorsal endopiriform cortex and tenia tecta. In the neocortex, moderate expression signals for I-1 mRNA were detected in layers II-IV, and VI, with layer VI most intensely, whereas weak expression signals were detected in layer V (Fig. 3B,C). In the basal ganglia, moderate expression signals were also detected in the caudate putamen, accumbens nucleus, ventral pallidus, and olfactory tubercle, whereas no significant expression signals were detected in the globus pallidus (Fig. 3B). In the hippocampal formation, the hippocampal pyramidal cells and the dentate granule cells expressed I-1 mRNA intensely, with the pyramidal cells less intensely (Fig. 3C,D). Weak expression signals were detected in the septal nuclei. The amygdaloid nuclei expressed I-1 mRNA moderately. In the thalamic nuclei, weak expression signals were observed in the anterior nuclear groups (anteriodorsal, anteroventral, and anteromedial nuclei), intralaminar nuclear group (central medial, paracentral, centrolateral, and parafascicular nuclei), midline nuclear group (paraventricular, paratenial, interanteromedial, and intermediodorsal nuclei), and reticular nucleus, while no significant expression signals were detected in the other thalamic nuclei. Weak expression of the gene was also detected in the zona incerta and subthalamic nucleus (Fig. 3C,D). Medial habenular nucleus showed intense expression signals, whereas lateral habenular nucleus did not show any expression signals. In the hypothalamus, the suprachiasmatic nucleus expressed I-1 mRNA

intensely, with the lateral part less intensely (Fig. 3B). The other hypothalamic nuclei expressed I-1 mRNA weakly. Intense expression signals were detected in the claustrum and pineal body (Fig. 3B,E). In the brain stem, weak expression signals were detected in the superficial gray layer of the superior colliculus, substantia nigra, central gray, dorsal tegmental nucleus, and parabrachial nucleus (Fig. 3E). Weak expression signals were also observed in the pontine nuclei, inferior colliculus, mesencephalic trigeminal nucleus, locus ceruleus, dorsal cochlear nucleus, inferior olive, and hypoglossal nucleus (Fig. 3E,F). In the cerebellum, moderate expression signals for I-1 were detected in the granule cells, whereas weak but distinct expression signals were detected in the Purkinje cells and deep cerebellar nuclei (Fig. 3I). In the spinal cord, no significant expression signals for I-1 mRNA were detected in either gray or white matter. Intense expression signals for I-1 mRNA were detected in cells of the arachnoid membrane and choroid plexus (Fig. 3G,H). 3.4. PP-ls in adult brain 3.4.1 PP-1 a subunit

In the olfactory bulb, the gene expression for PP-1 was detected moderately to weakly in the mitral cells, internal granule cells, and periglomerular cells. The caudate putamen expressed the gene moderately, whereas weak expression signals were detected in the septal nuclei (Fig. 4A). The neocortex expressed the gene moderately and homogeneously throughout layers II to VI. Intense to moderate expression signals for PP-1 a were detected in the hippocampal pyramidal and dentate granule cells, piriform cortex and olfactory tubercle (Fig. 4A,D). In the thalamus, weak expression signals were detected in the anterior nuclear group, midline nuclear group, intralaminar nuclear group, and reticular nucleus. Weak expression signals were also detected in the subthalamic nucleus and zona incerta. The medial habenular nucleus and pineal body expressed the gene intensely. In the hypothalamic nuclei, the suprachiasmatic nucleus and paraventricular hypothalamic nucleus expressed PP-1 a mRNA moderately, whereas other hypothalamic nuclei expressed it weakly. In the brain stem, moderate signals were detected in the pontine nuclei, locus ceruleus, and inferior olive, whereas other nuclei expressed it weakly and rather diffusely. In the cerebellum, the granule cells expressed the gene moderately, whereas Purkinje cells and deep cerebellar nuclei expressed it weakly (Fig. 4G,J). In the spinal cord, moderate expression signals were detected in the gray matter. The choroid plexus expressed PP-1 c~ mRNA moderately to intensely.

H. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18 Table 1 R e l a t i v e e x p r e s s i o n levels o f I-1 a n d a , y, ~ c a t a l y t i c s u b u n i t s o f P P - 1 in v a r i o u s r a t b r a i n a r e a s by in situ h y b r i d i z a t i o n h i s t o c h e m i s t r y Area

11

Table 1 (continued) Area

R e l a t i v e e x p r e s s i o n level PP-1 a

PP-1 y

P P - 1 t5

inh-1

+ +

+÷

÷÷

+

+ + + + + +

++ + + + +

++ ÷ + + +

+++ + + + +

+

+

+

+

+ + + + +

+ + ++ + +

+ + + + +

+ + + + +

+ + + +

++ ++ ++

++ + +

+ -

++

++

++

+

++/+

++/+

++/+

-

+ + + + + ++ +

+ ++ ++ ++ ++ ++ ++

+ ++ ++ ++ ++ ++ ++

---+ -+ -

+

++

++

+

+ ++

+ +++

+ ++

+ ++

+/-

++

+/-

+/-

+

++

++

+

++

++ ÷++ + ÷

++ ÷÷÷ + +

--

R e l a t i v e e x p r e s s i o n level P P - 1 c~

P P - 1 y P P - 1 ~ inh-1

Olfactory bulb p e r i g l o m e r u l a r cell t u f t e d cells m i t r a l cells i n t e r n a l g r a n u l e cells

+ + + + + + +

+ + + + + + + + +

+ + + + + + +

+ + + + + + +

Neocortex

II-VI

II-VI

II-VI

++

++

++

II,III, IV < VI ++

Basal ganglia caudateputamen globus pallidus nucleusaccumbense ventralpallidum olfactory tubercle Septum lateral septal nucleus medial septal nucleus triangular septal nucleus septohippocampal nucleus Nuclei of the diagonal band Piriformcortex Dorsal endpiriform cortex Teniatecta Hippocampal formation CA1-3pyramidalcells d e n t a t e g r a n u l e cells Amygdaloid nuclei Claustrum Epithalamus medial habenular nucleus lateral habenular nucleus pineal body Thalamus anterodorsal nucleus anteroventral nucleus anteromedial nucleus mediodorsal nucleus central medial nucleus paracentral nucleus paraventricular nucleus centrolateral nucleius parafascicular nucleus laterodorsal nucleus lateroposterior nucleus ventrolateral nucleus ventromedial nucleus ventroposterior nucleus medial geniculate nucleus lateral geniculate nucleus reticular nucleus Subthalamus subthalamic nucleus zona incerta Hypothalamus anterior hypothalamic area striohypothalamic nucleus medial preoptic nucleus lateral hypothalamic area

++/+++

. . ++/+++

++

.

+/-

++

++

. ++

+/-

++/+++

++

+/-

++

+ + +

+ + +

+ + +

+ +

+ + + + + + +++ + +++

+ + + + + +++ + +++

+ + + + + +++ + +++

+ + + + + +++ + + + + +++

+++

+++

+++

+ + + + + +

+ + + + + +

+++ ++ +

++/ +++ +++ ++ +++

+ + + + + + +

+ + + + + + +

÷÷÷ + +++

+ +

÷++ +++

+ + + +/-

+ + +

+

+ + + + +

+ + + + + + + + + +

+ + + + + + + + + + + + + + + + +

+ +

+ + +

+ +

+ +

+ + + +

+ + + +

+ + + ÷

+ + + +

+ + + + + + + + + + + + + +

+ + + + + + + + + + + +

-

paraventricular hypothalamic nucleus suprachiasmatic nucleus arcuate nucleus ventromedial mucleus dorsomedial nucleus mammillary nucleus Midbrain substantia nigra pars compacta pars reticulata dorsal tegmental nucleus central gray red nucleus superior colliculus i n f e r i o r coUiculus Pons and Medulla pontine nuclei oculomotor nucleus mesencephalic trigeminal nucleus locus ceruleus reticular formation motor trigeminal nucleus spinal trigeminal nucleus facial n u c l e u s dorsal cochlear nucleus vestibular nucleus i n f e r i o r olive prepositus hypoglossal nucleus hypoglossal nucleus Cerebellum P u r k i n j e cells g r a n u l e cells molecular layer deep cerebellar nuclei Spinal cord Choroid plexus E p e n d y m a l cells Arachnoid membrane

÷÷÷

÷ ÷

÷÷÷ ÷ +++

R e l a t i v e e x p r e s s i o n levels w e r e e s t i m a t e d b y visual c o m p a r i s o n o f s e v e r a l e m u l s i o n - c o a t e d slides, as follows: + + + ; i n t e n s e , + + ; moderate, +; weak, - not detectable. Terminology was based on t h e a t l a s o f P a x i n o s a n d W a t s o n (1986).

3.4.2. PP-1 3' subunit In the olfactory bulb, intense expression signals for

+

PP-ly were detected in the mitral cells, internal granule cells, and periglomerular cells. The caudate putamen expressed PP-1 3' mRNA moderately, whereas no significant expression was detected in the globus pallidus (Fig. 4B). In the septal nuclei, the lateral septal nucleus expressed PP-1 y mRNA intensely to moderately, whereas other septal nuclei expressed it weakly (Fig. 4B). Moderate expression signals were detected in the neocortex and thalamic nuclei. The medial habenular nucleus and pineal body expressed PP-1 Y mRNA

12

H. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

H. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

intensely. Intense expression signals were also detected in the hippocampal pyramidal cells and dentate granule cells. In the brain stem, moderate expression signals were detected in various brain stem nuclei, such as the pontine nuclei, locus ceruleus, oculomotor nucleus, and inferior olive. In the cerebellum, intense gene expression of PP-1 y was detected in the granule cells, whereas Purkinje cells expressed this gene weakly (Fig. 4H,K). Distinct expression was seen rather diffusely in the molecular layer, while no significant expression signals were detected in the cerebellar medulla. The deep cerebellar nuclei expressed the gene moderately. In the spinal cord, weak to moderate expression signals were detected throughout the gray matter. 3.4.3. PP-1 6 subunit

The gene for PP-1 6 was expressed moderately in the olfactory mitral cells, internal granule cells, and periglomerular cells. Weak expression signals were detected in the neocortex, septal nuclei, and thalamic nuclei (Fig. 4C,F). Very weak expression signals were detected in the caudate putamen (Fig. 4C). Intense expression was detected in the hippocampal pyramidal and dentate granule cells, without regional difference in intensity. Weak expression signals were detected in the thalamic and hypothalamic nuclei. The pineal body expressed it intensely. In the brain stem, moderate expression was detected in the pontine nuclei, locus ceruleus, dorsal cochlear nucleus, vestibular nucleus, spinal trigeminal nucleus, and inferior olive. In the cerebellum, granule cells and deep cerebellar nuclei expressed it moderately, whereas Purkinje cells expressed it weakly (Fig. 4I,L). In the spinal cord, moderate expression was seen throughout the gray matter.

13

3.5. I-1 mRNA in developing brain

On E15, weak expression signals for I-1 mRNA were detected in the mantle zones of the fore-, mid-, hindbrain and spinal cord, whereas no significant expression signals for the mRNA were detected in the ventricular zone (neuroepithelium) (Fig. 5A,B,C). At this stage, intense expression signals for I-1 mRNA were already detected in the peripheral ganglia such as trigeminal, vestibular, superior glossopharyngeal, vagal, superior cervical, and spinal ganglia (Fig. 5A). From El8 through the postnatal stages, the gene expression increased gradually to the adult levels described above in most brain regions except for the cerebral cortex, thalamus, cerebellum, lower brain stem and spinal cord. The cortical plate expressed the mRNA moderately on El8 although the gene expression in the intermediate and ventricular zones remained very low. The moderate expression was seen homogeneously through layers II-VI on P7 (Fig. 5E). Thereafter the expression levels in layer V decreased to the adult level. In the hippocampal formation, weak expression signals for the mRNA were visible in the immature hippocampal pyramidal cells on El8 (Fig. 5D,G). Thereafter, the expression increased and attained the adult level. In the caudate putamen, weak expression signals for the mRNA were detected homogeneously on El8 (Fig. 5F). The expression gradually increased to the adult level. In the thalamus on El8, moderate to intense expression signals for the mRNA were detected in most thalamic nuclei, whereas the reticular nucleus and zona

Fig. 3. Localization of the I-1 transcripts in the coronal sections of the adult rat brain by in situ hybridization histochemistry. A: a coronal sections of the olfactory bulb. Note moderate expression in the periglomerular cells of the glomerular layer (Gl), mitral cells (Mi), and internal granule cells (IG). EPL, external plexiform layer. Bar = 250/~m. B: a coronal section through the caudate putamen. Note intense expression in the choroid plexus of the lateral ventricle (arrowhead), arachnoid membrane (double-arrow), suprachiasmatic nucleus (SC), claustrum (Cl), dorsal endopiriform cortex (DE) and piriform cortex (Pi). Also note moderate expression in the caudate putamen (CP), bed nucleus (B), and layers II-IV, and VI of the neocortex (Co). GP, globus pallidus. Bar = 1 mm. C: a coronal section through the thalamus. Note intense expression in the choroid plexus (arrowhead), medial habenular nucleus (MH), dentate granule cell layer (DG), the field CA1-3 of Ammon's horn (CA1-3) and arachnoid membrane (double-arrow). Also note moderate expression in the amygdaloid nuclei (Am). Rt, reticular thalamic nucleus; ZI, zona incerta; ST, subthalamic nucleus; Pi, piriform cortex. Ne, neocortex. Bar = 1 mm. D: a coronal section through the thalamus. Note weak expression in the paraventricular thalamic nucleus (PV), central medial thalamic nucleus (CM), paracentral thalamic nucleus (PC), reticular thalamic nucleus (Rt), zona incerta (ZI). MH, medial habenular nucleus; VL, ventrolateral thalamic nucleus; VPL, ventral posterolateral thalamic nucleus; DG, dentate gyrus; MD, mediodorsal thalamic nucleus; G, gelatinosus thalamic nucleus; arrowhead: choroid plexus of the lateral ventricle. Bar = 1 mm. E: a coronal section through the inferior colliculus (IC). Note intense expression in the pineal body (PB). Also note weak expression in the inferior colliculus (IC), dorsal tegmental nucleus (DT), and medial and lateral parabrachial nucleus (MPB, LPB). Cx, cerebral cortex; Gr, cerebellar granule cell layer. Bar = 1 ram. F: a coronal section through the medulla oblongata. Note weak expression in the deep cerebellar nuclei (DCN) inferior olive (IO) and dorsal cochlear nucleus (DC). Arrowhead: choroid plexus of the fourth ventricle. Bar = 1 mm. G: a bright-field photomicrograph showing intense expression in the choroid plexus (asterisk) of the third ventricle and medial habenular nucleus (MH). Bar = 200/.~m. H: a bright-field photomicrograph showing intense expression in the cells of the arachnoid membrane enclosing the brain (double-arrow). Asterisk indicates the branch of the medial cerebral artery. Am, amygdaloid nuclei. Bar = 200 /~m. I: a bright-field photomicrograph of the cerebellum. Note moderate expression in the cerebellar granule cells. Gr, granule cell layer; Pk, Purkinje cell layer; Mo, molecular layer. Bar = 100/.Lm.

L,I

~a

Z

H. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

incerta expressed the mRNA weakly (Fig. 5D,G). Moderate to intense expression in most thalamic nuclei were maintained on P0 and P7 (Fig. 5E), and the expression decreased progressively thereafter to weak or background levels, whereas the weak expression levels in the reticular nucleus and zona incerta were maintained throughout the development. In the cerebellum, the Purkinje cells and deep cerebellar nuclei already expressed the mRNA weakly on El8 (Fig. 5H). Weak expression signals were also detected in the molecular layer and the internal granular layer on P0 and P7 (Fig. 5E). Thereafter the expression in the internal granular layer increased to the adult level. No significant expression signals were detected in the external granule cell layer throughout development. Weak to moderate expression signals for the mRNA were detected rather diffusely in the medulla oblongata and the gray matter of the spinal cord till P0 and thereafter the expression decreased to the background levels. 3.6. PP-1 mRNAs in developing brain The developmental changes in the gene expression patterns were basically the same among the three catalytic subunits of PP-1 and the three subunits were thus described here collectively as PP-1. On El5, weak to moderate expression signals for PP-1 were detected both in the mantle and the ventricular germinal zones of the fore-, mid-, hindbrain and spinal cord (Fig. 6A,B,C). On El8, distinct levels of the expression were detected in the cortical plate, caudate putamen, hippocampal pyramidal cell layer, thalamus and olfactory bulb, whereas the remainder of the brain expressed the genes weakly (Fig. 6D). On P1-P7, the expression became evident in the external and internal granule cell layer of the immature cerebellum, whereas the expression in the forebrain neuroepithelium was attenuated except the region of the olfactory bulb in which the substantial level of the expression was sustained by P21 (Fig. 6E). Consequently, the expression patterns for PP-1 became basically similar to those at the adult stage described above by the early postnatal stages. 4. Discussion

The localization of gene expression for I-1 and three catalytic subunits of PP-1 in the brain was revealed for

15

the first time by the present in situ hybridization study. When compared with the previous immunohistochemical finding on the localization of I-1 [8], the present finding by in situ hybridization is largely consistent with the previous immunohistochemical one. However, several discrepancies are noted: Moderate to intense expression of I-1 mRNA is detected in the hippocampal pyramidal cells, neurons in the amygala, and cerebellar granule cells, all of which have been described to be immunonegative for I-1. Several explanations are possible for these discrepancies. Among them, the negative translational control is first taken into consideration. This includes attenuation of the transcript by its premature termination, alternative splice-site selection, control of 3'-end formation by cleavage and poly(A) addition, control of translational initiation a n d / o r regulated mRNA degeneration [1,15,16,17,19]. In addition, we have to consider an alternative possibility that some changes in the epitope structure of I-1 may occur selectively in those neurons by unknown post-translational mechanisms. Which is the most plausible explanation remains to be elucidated. Similar discrepancies between immunoreactivity and mRNA expression have been reported by us in the localization of neuron-specific enolase in cerebellar Purkinje cells [20]. According to the widespread idea of the function of I-1 as noted in the introduction, the presence of I-1 a n d / o r I-1 mRNA in given neuronal and non-neuronal cells would provide these cells with a means of strongly inhibiting PP-1, when they are stimulated by transmitters or hormones that elevate cyclic AMP levels. The gene expression pattern for I-1 is thus expected to be similar to that for PP-1. In agreement with this expectation, a relatively high and parallel expression of I-1 and PP-1 mRNAs is found in most of the forebrain and cerebellum of the adult rat in the present in situ hybridization analysis. However, the present study also shows this not always to be the case: In the adult brain, the expression of I-1 mRNA shows a laminar pattern in the neocortex with layers I and V at low levels, whereas the three PP-1 mRNAs are expressed rather homogeneously through layer II-VI. Most regions in the brain stem such as pontine nuclei express I-1 mRNA weakly in contrast to relatively high levels for PP-1 mRNAs. Such unparallel expression between I-1 and PP-1 are also noted in several brain regions during the

Fig. 4. Localization of mRNAs for PP-1 a (A,D,G,J), y (B,E,H,K), ~ (C,F,I,L) catalytic subunits in the coronal sections of the adult rat brain by in situ hybridization histochemistry. A-C: coronal sections through the caudate putamen (CP). D-F: coronal sections through the thalamus. G-I: dark-field photographs through the cerebellar cortex. J-L: bright-field photographs through the cerebellar cortex. Co, neocortex; Pi, piriform cortex; Tu, olfactory tubercle; LS, lateral septal nucleus; VDB, nucleus vertical limb diagonal band; HDB, nucleus horizontal limb diagonal band; DG; dentate granule cell layer; CA1-3, fields CA1-3 of Ammon's horn of the hippocampal formation; MH, medial habenular nucleus; P, paraventricular hypothalamic nucleus; Mo, molecular layer; Gr, granule cell layer; Pk, Purkinje cell layer; arrow: choroid plexus. Bar = 1 mm.

lt~

1-I. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

Fig. 5. Developmental changes in the gene expression for I-1 in embryonic and postnatal rat brain by in situ hybridization histochemistry. Note weak expression in the fore-, mid-, hindbrain and spinal cord on El5 (A). The boxed region in A corresponds to dark-field and bright-field micrographs in B and C, respectively. Note that weak expression is seen in the mantle zone (MZ) of the cortical plate, whereas no significant expression is seen in its ventricular zone (VZ). Also note intense to moderate expression in the thalamus (Th) on E20 (D) and on P7 (E). Coronal sections of the forebrain on P0 through the caudate putamen (CP) (F), thalamus (G), and inferior colliculus (IC) (H). DRG, dorsal root ganglia; 5, trigeminal ganglion; 8, vestibular ganglion; 9, superior glossopharyngeal ganglion; 10, vagal ganglion; SCG, superior cervical ganglion; H: hippocampal formation; SC, superior colliculus; Cb, cerebellar cortex; LS; lateral septal nucleus; DE, dorsal endopiriform cortex; Pi, piriform cortex; Co, neocortex; Am, amygdaloid nuclei; Pk, cerebellar Purkinje cell layer; DCN, deep cerebellar nuclei; IO, inferior olive. DC, dorsal cochlear nucleus; LV, lateral ventricle; Aq, aqueduct; 4V, fourth ventricle; asterisk: medial habenular nucleus. Bars in A and D-H = 1 mm; Bars in B and C = 50/xm.

H. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

17

Fig. 6 Developmental changes in the gene expression for PP-1 y catalytic subunit mRNA on El5 (A-C), E20 (D), and P7 (E). Note that weak to moderate expression was observed widely in the brain on E15 (A). The boxed region in A corresponds to bright- and dark-field photographs in B and C, respectively. Note that moderate expression is seen in both of the mantle zone (MZ) and ventricular zone (VZ). Also note the persistent expression in the ventricular zone for the olfactory bulb (arrowhead) on P7. LV, lateral ventricle; 4V, fourth ventricle; OB, olfactory bulb; CP, caudate putamen; H, hippocampal formation; Co, neocortex; Th, thalamus; SC, superior colliculus; IC, inferior colliculus; Cb; cerebellar cortex. Bars in A, D, and E = 1 mm; in B and C = 50/zm.

ontogeny: I-1 mRNA is first expressed at substantial levels in neurons after their settlement in the cerebral cortical plates, whereas the expression of PP-1 mRNA is already detected in its ventricular zone (neuroepithelium). The expression of PP-1 mRNAs in the ventricular zone suggests a possible involvement of dephosphrylation by PP-1 in the regulation of mitosis. This possibility is compatible with a recent finding that protein phosphatase-1 plays important roles in mammalian cell mitosis by reversing p34Cdc2-induced effects after mid-mitosis [7]. On the other hand, no distinct expression of I-1 mRNA in the ventricular neuroepithelium implies that substances other than I-1 may be involved in the regulation of the mitosis-related dephosphorylation by PP-1. In this regard, novel inhibitory polypeptides of protein phosphatase 1 have recently been isolated from bovine thymic nuclei [3]. Whether these polypeptides regulate the activity of

PP-1 also in the rat neuronal nuclei remains to be elucidated. A second example of the unparallel gene expression is seen in immature brains: I-1 mRNA is expressed at relatively high levels in the thalamus in late prenatal and early postnatal development in contrast to the low to moderate expression levels of PP-1 mRNAs there. After P7, the expression of I-1 mRNA decreases in the thalamus, whereas the expression levels of PP-1 mRNAs in the thalamus are constant throughout the development. This transient expression for I-1 mRNA is well in agreement with the previous Western blot analysis that the level of I-1 is peaked at P7 and declined by P3W in various brain regions [10]. Considering the time sequence of development of the thalamus, the decrease reflects a drop-off in the level of I-1 mRNA in individual neurons, but not a decrease in the population of neurons expressing the gene, and thus the

18

n. Sakagami et al. / Molecular Brain Research 25 (1994) 7-18

change in expression seems to be somehow relevant to the synaptogenesis and remodeling the fiber connections in the thalamus [2,12]. All these findings on the unparallel expression between I-1 and PP-ls in adult as well as developing rat brain suggest that I-1 may play some discrete roles independent of the regulation of PP-1 in certain brain regions and developmental stages. In conclusion, the present findings on the detailed localization of I-1 and PP-1 mRNAs in the adult and developing rat brain provide a basis for understanding the regulation of neuronal protein phosphorylation/ dephosphorylation equilibrium. Further studies including modification of the gene expression for I-1 and PP-ls following lesions and pharmacological treatments will be necessary to clarify more the importance of the protein phosphatase cascade in the neuronal signaling.

Acknowledgments The authors wish to thank Prof. Shinri Tamura, Tohoku University, for his helpful advice and suggestions for this work. This study was supported by Grants 04404020 and 0526023 from the Ministry of Education, Science and Culture of Japan and by grants from Asaoka Eye Clinic Foundation, Hamamatsu, Japan and from JCR Pharmaceutical Co. Ltd., Ashiya, Japan.

References [1] Andreadis, A., Gallego, M.E. and Nadal-Ginard, B., Generation of protein isoform diversity by alternative splicing: mechanistic and biological implications, Annu. Rev. Cell Biol., 3 (1987) 207-242. [2] Asanuma, C. and Stanfield, B.B., Observations on the development of certain ascending inputs to the thalamus in rats. I. Postnatal development, Brain Res., 469 (1988) 159-170. [3] Beullens, M., Eynde, A.V., Stalmans, W. and Bollen, M., The isolation of novel inhibitory polypeptides of protein phosphatase 1 from bovine thymus nuclei, J. Biol. Chem., 267 (23) (1992) 16538-16544. [4] Chomczynski, P. and Sacchi, N., Single-step method of RNA isolation by acid guanidinium thyocyanate-phenol-chloroform extraction, Anal Biochem., 162 (1987) 156-159.

[5] Cohen, P., The structure and regulation of protein phosphatases, Annu. Rev. Biochem., 58 (1989) 453-508. [6] Elbrecht, A., DiRenzo, J., Smith, R.G. and Shenolikar, S., Molecular cloning of protein phosphatase inhibitor-1 in rat and rabbit tissues, J. Biol. Chem., 265 (23) (1990) 13415-13418. [7] Fernandez, A., Brautigan, D.L. and Lamb, N.J., Protein phosphatase type 1 in mammalian cell mitosis: chromosomal and involvement in mitotic exit, J. Cell Biol., 116 (1992) 1421-1430. [8] Gustafson, E.L., Girault, J-A., Hemmings, H.C., Nairn, A.C., Jr. and Greengard, P., Immunohistochemical localization of phosphatase inhibitor-1 in rat brain, J. Comp. Neurol., 310 (1991) 170-188. [9] Haung, F.L. and Glinsmann, W.H., Separation and characterization of two phosphorylase phosphatase inhibitors from rabbit skeletal muscle, Eur. J. Biochern., 70 (1976) 419-426. [10] Hemmings, H.C., Jr., Girault, J.-A., Nairn, A.C., Bertuzzi, G. and Greengard, P., Distribution of protein phosphatase inhibitor-1 in brain and peripheral tissues of various species: comparison with DARPP-32, J. Neurochem., 59 (1992) 10531061. [11] Kennedy, M.B., Experimental approaches to understanding the role of protein phosphorylation in the regulation of neuronal function, Annu. Rev. Neurosci., 6 (1983) 493-525. [12] Minciacchi, D. and Granato, A., Development of the thalamocortical system: transient-crossed projections to the frontal cortex in neonatal rats, J. Comp. Neurol., 281 (1989) 1-12. [13] Nestler, E.J. and Greengard, P., Protein phosphorylation in the brain, Nature, 305 (1983) 583-588. [14] Nimmo, G.A. and Cohen, P., The regulation of glycogen metabolism. Purification and characterization of protein phosphatase inhibitor-1 from rabbit skeletal muscle, Eur. J. Biochem., 87 (1978) 341-351. [15] Peterson, M.L. and Perry, R., Regulated production of/xm and ~s mRNA requires linkage of the poly(A) additon sites and is dependent on the length of the ~s-/~m intron, Proc. Natl. Acad. Sci. USA, 83 (1986) 8883-8887. [16] Platt, T., Transcription termination and the regulation of gene expression, Annu. Rev. Biochem., 55 (1986) 356-360. [17] Rosenthal, E.T., Hunt, T. and Ruderman, J.V., Selective translation of mRNA controls the pattern of protein synthesis during early development of the surf clam, Spisula solidissima, Cell, 20 (1980) 487-494. [18] Sasaki, K., Shima, H., Kitagawa, Y., Irino, S., Sugimura, T. and Nagao, M., Identification of members of the protein phosphatase 1 gene family in the rat and enhaced expression of protein phosphatase l a gene in rat hepatocellular carinomas, Jpn. J. Cancer Res., 81 (1990) 1272-1280. [19] Shaw, G. and Kamen, R., A conserved AU sequence from the 3' untranslated region of GM-CSF mediates selective mRNA degradation, Cell, 46 (1986) 659-667. [20] Watanabe, M., Sakimura, K., Takahashi, Y. and Kondo, H., Ontogenic changes in expression of neuron-specific enolase (NSE) and its mRNA in the Purkinje cells of the rat cerebellum: immunohistochemical and in situ hybridization study, Dev. Brain Res., 53 (1990) 89-96.