- Email: [email protected]
Long non-coding RNA DILC suppresses cell proliferation and metastasis in colorectal cancer
Accepted Manuscript Long non-coding RNA DILC suppresses cell proliferation and metastasis in colorectal cancer
Li-Qiang Gu, Xiang-Lei Xing, Hui Cai, An-Feng Si, Xian-Rong Hu, Qian-Yun Ma, Meng-Lin Zheng, Ruo-Yu Wang, Heng-Yu Li, Xi-Peng Zhang PII: DOI: Reference:
S0378-1119(18)30351-2 doi:10.1016/j.gene.2018.03.100 GENE 42722
To appear in:
Gene
Received date: Revised date: Accepted date:
18 November 2017 7 March 2018 29 March 2018
Please cite this article as: Li-Qiang Gu, Xiang-Lei Xing, Hui Cai, An-Feng Si, Xian-Rong Hu, Qian-Yun Ma, Meng-Lin Zheng, Ruo-Yu Wang, Heng-Yu Li, Xi-Peng Zhang , Long non-coding RNA DILC suppresses cell proliferation and metastasis in colorectal cancer. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Gene(2017), doi:10.1016/j.gene.2018.03.100
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Long non-coding RNA DILC suppresses cell proliferation and metastasis in colorectal cancer Li-Qiang Gu1,#, Xiang-Lei Xing2,#, Hui Cai3,#, An-Feng Si4, Xian-Rong Hu5, Qian-Yun Ma6, Meng-Lin Zheng7,, Ruo-Yu Wang8,*, Heng-Yu Li9,*, Xi-Peng Zhang1,* 1
Department of Colorectal Surgery, Tianjin Union Medical Center, Tianjin, 300121, China Department of Laparoscope, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China 3 Department of Gastrointestinal surgery, First Affiliated Hospital of Second Military Medical University, Shanghai, 200433, China 4 Department of Surgical Oncology, Bayi Hospital Affiliated Nanjing University of Chinese Medicine, Nanjing, Jiangsu Province China 5 Department of Endoscopy, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China 6 Department of Urology surgery, First Affiliated Hospital of Second Military Medical University, Shanghai, 200433, China 7 Department of Ultrasound, Huashan Hospital Affiliated to Fudan University, Shanghai, China 8 Department of Hepatic Surgery, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China 9 Department of Breast and Thyroid surgery, First Affiliated Hospital of Second Military Medical University, Shanghai, 200433, China # These authors contributed equally to this work Correspondence and requests for materials should be addressed to R.W. (email: [email protected]) or to H.L. (email: [email protected]) or to X.Z. (email: [email protected])
CE
PT E
D
MA
NU
SC
RI
PT
2
AC
Running title: lnc-DILC inhibits CRC cells progression
ACCEPTED MANUSCRIPT Abstract Colorectal cancer (CRC) is one of the most common malignant tumors and one of the leading causes of cancer-related death in both men and women. The prognosis of CRC remains poor due to the advanced stage and cancer metastasis at the time of diagnosis. However, the exact mechanism of tumorigenesis in CRC remains unclear. Long non-coding RNAs (lncRNAs), which refer to transcripts longer than 200 nucleotides that are not translated into protein, are known to play important roles in multiple human cancers. Lnc-DILC is reported to be an important tumor
PT
suppressor gene and its inactivation is closely associated with liver cancer stem cells. However, the role of lnc-DILC in CRC remains to be elucidated. In the present study, we observed that lnc-DILC overexpression inhibited the growth and metastasis of CRC cells. Consistently,
RI
lnc-DILC knockdown facilitated the proliferation and metastasis of CRC cells. Mechanically, lnc-DILC suppressed CRC cell progression via IL-6/STAT3 signaling inactivation. More
SC
importantly, the specific STAT3 inhibitor S3I-201 and IL-6R inhibitor tocilizumab abolished the discrepancy of growth and metastasis capacity between lnc-DILC-interference CRC cells and
NU
control cells, which further confirmed that IL-6/STAT3 signaling was required in lnc-DILC-disrupted CRC cell growth and metastasis. Taken together, our results suggest that inactivating IL-6/STAT3 signaling.
MA
lnc-DILC is a novel CRC suppressor and may prove to be an inhibitor of CRC progression by
AC
CE
PT E
D
Keywords: Colorectal cancer, lnc-DILC, STAT3, proliferation, metastasis
ACCEPTED MANUSCRIPT Introduction Colorectal cancer (CRC) is one of the most prevalent tumors with a high death rate in the advanced stage (1, 2). However, the molecular mechanisms underlying colorectal initiation and progression remain unclear. CRC is generally believed to be due to old age or lifestyle change in most cases, and underlying genetic disorders in some cases (3). Numerous factors are involved in the initiation and progression of CRC, including mutations in tumor suppressor genes or proto-oncogenes, chromosomal and microsatellite instability, and epigenetic modifications (4-8).
PT
Knowing that early detection and treatment of CRC in its early stage are of great importance in reducing disease-specific mortality, it is necessary to clarify the underling mechanism and searching optional therapeutic targets.
RI
Long non-coding RNAs (lncRNAs) are a heterogeneous class of transcripts with a minimum length of 200 bases without protein-coding potential (9). Ample evidence has shown that lncRNAs
SC
can affect disparate cellular functions and are associated with diverse physiopathological processes (10). lncRNAs regulate gene expression at multiple levels, including pre-transcriptional
NU
regulation by recruiting chromatin-modifying complexes and post-transcriptional regulation by interacting with miRNAs, mRNAs, or proteins (11-13). More evidence indicates that lncRNAs modulate the proliferation, apoptosis, metastasis and metabolism of various cancers (14-18).
MA
lnc-DILC was reported as a tumor suppressor in liver cancer by regulating liver stem cell expansion through the IL-6/STAT3 axis (19). It was found that JAK/STAT3 pathway played a pivotal role in tumor activation (20), but the detailed machinery has not been identified so far.
D
STAT3 activation modulates the function of numerous substrates involved in the regulation of cell
PT E
growth and metastasis (21). Increasing evidence has shown that IL-6/STAT3 pathway is uncontrolled in CRC (22). However, the role of lnc-DILC in CRC progression is poorly understood.
In this study, we demonstrated that lnc-DILC, acting as a tumor suppressor, was involved in
CE
CRC cell progression, and that lnc-DILC downregulation significantly facilitated CRC cell proliferation and metastasis. In addition, we characterized that IL-6/STAT3 acted as the
AC
downstream pathway of lnc-DILC. Our results highlight the importance of lnc-DILC in inhibiting the proliferation and metastasis of CRC cells.
ACCEPTED MANUSCRIPT Materials and Methods Patients and samples Total 40 CRC patients’ tissue samples were collected from the Tianjin Union Medical Center (Tianjin, China). Patient informed consent was also obtained and the procedure of human sample collection was approved by the Ethic Committee of Tianjin Union Medical Center. Cell lines and cell culture HCT116 and SW480 cells were maintained at 37°C in a 5% CO2 incubator with Dulbecco's
PT
modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 25 µg/ml of gentamicin. The cultures were dissociated with 0.5% trypsin and
RI
transferred to new six-well plates biweekly. The lenti-vector expressing lnc-DILC or its control and mirDILC or its control virus was generated as described previously (23). HCT116 or SW480
SC
lnc-DILC and their control stable cell lines were established using lentivirus infection.
NU
Cell proliferation assays
For cell proliferation analysis, CRC cells were seeded in 96-well plates (3×103 cells per well). ATP activity was measured using a Cell Counting Kit-8 at indicated time points. EdU
MA
immunofluorescence staining was performed with the EdU Kit (RiboBio) according to the manufacturer's protocol. The results were quantified with a Zeiss axiophot photomicroscope (Carl
D
Zeiss) and Image-Pro plus 6.0 software.
PT E
Cell migration assays
For cell migration experiments, 2×105 CRC cells were seeded into the upper chamber of a polycarbonate transwell in serum-free DMEM. The lower chamber was added with DMEM containing 20% FBS as chemoattractant. The cells were incubated for 12 hours and the chamber
CE
was fixed. Cell count is expressed as the mean number of the cells in each field.
AC
Cell invasion assays
For cell invasion experiments, 2×105 CRC cells were seeded into the upper chamber of a polycarbonate transwell in serum-free DMEM. The lower chamber was added with DMEM containing 20% FBS as chemoattractant. The cells were incubated for 12 hours and the chamber was fixed. Cell count is expressed as the mean number of the cells in each field. Real-time PCR Total RNA was extracted from the cells using Trizol reagent (Invitrogen, 15596-018). Total cDNAs were synthesized by ThermoScript TM RT-PCR system (Invitrogen, 11146-057). The original amount of the specific transcripts was measured by real-time PCR using the ABI PRISM 7300 sequence detector (Applied Biosystems). The lnc-DILC primer sequences were forward: 5’ CTCTGGAGCCATACGTGACA 3’, and reverse: 5’ TCAGGTCACTTGTGCCGTT 3’.
ACCEPTED MANUSCRIPT
Western Blotting assays Thirty micrograms of proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to the nitrocellulose membrane. The membrane was blocked with 5% non-fat milk and incubated with the primary antibody for 1.5 hours. The protein band, specifically bound to the primary antibody, was detected using an IRDye 800CW-conjugated secondary antibody and LI-COR imaging system (LI-COR Biosciences). The antibodies p-STAT3,
PT
STAT3, IL-6 and GAPDH were purchased from Cell Signaling Technology, USA. Luciferase reporter assays
RI
CRC cells were transfected with STAT3 response element-luciferase reporter plasmid (STAT3-luc) or IL-6 promoter luciferase reporter in combination with the pRL-TK vector (Promega, E2241,
SC
Madison, Wisconsin, USA) as an internal control. The dual luciferase assay kit was purchased from Promega (0000060417). The luciferase activities were determined using a luminometer
NU
(Wallac 1420 Victor 2 multilabel counter system) as described in previous studies (24). Statistical analysis
MA
All statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc. La Jolla, USA). Statistical analysis was carried out using t test or Bonferroni Multiple Comparisons Test:
AC
CE
PT E
D
*p<0.05. A p value of less than 0.05 was considered statistically significant.
ACCEPTED MANUSCRIPT Results lnc-DILC depletion facilitates CRC cells proliferation. To explore the function of lnc-DILC in CRC progression, we checked lnc-DILC expression by using a great amount of human CRC tissues. As shown in Fig. 1A, lnc-DILC expression was dramatically reduced in CRC cases compared with the paired non-tumorous tissues. To elucidate the effect of lnc-DILC on CRC cells behavior, HCT116 and SW480 cells were infected by lentivirus expressing microRNA against lnc-DILC, and stable infectants were
PT
established (Fig. 1B). As shown in Fig. 1C, lnc-DILC depletion drove the proliferation of CRC cells markedly. In addition, CRC cells stably interfered with lnc-DILC to form more and bigger colonies compared with control cells (Fig. 1D). Consistently, 5-ethynyl-2’-deoxyuridine (EdU)
RI
staining confirmed that lnc-DILC knockdown facilitated CRC cell growth (Fig. 1E). Collectively,
SC
all these data showed that lnc-DILC suppressed CRC cells growth. lnc-DILC overexpression suppresses CRC cells proliferation.
NU
To further confirm the effect of lnc-DILC on CRC cells proliferation, HCT116 and SW480 cells were infected by lentivirus expressing lnc-DILC, and stable infectants were established (Fig. 2A). As shown in Fig. 2B, lnc-DILC overexpression significantly inhibited the proliferation of CRC
MA
cells. In addition, HCT116 and SW480 cells stably overexpressing lnc-DILC formed fewer and smaller colonies compared with their control cells (Fig. 2C). Consistently, EdU staining confirmed
D
that ectopic expression of lnc-DILC suppressed HCT116 and SW480 cells growth (Fig. 2D).
PT E
lnc-DILC knockdown drives CRC cells metastasis in vitro. To explore the role of lnc-DILC in CRC cells metastasis, transwell assay was performed, showing that the migration ability was enhanced in lnc-DILC inferencing CRC cells (Fig. 3A&B). In addition, matrigel invasion chamber assay revealed that lnc-DILC knockdown increased the
CE
invasiveness of CRC cells (Fig. 3C&D).
AC
lnc-DILC overexpression inhibits CRC cell transwell and invasion in vitro. To further elucidate the role of lnc-DILC in CRC cells metastasis, transwell assay was performed, showing that the migration ability was attenuated in CRC cells overexpressing lnc-DILC (Fig. 4A&B). Furthermore, matrigel invasion chamber assay revealed that lnc-DILC overexpression decreased the invasiveness of CRC cells (Fig. 4C&D). Taken together, our results demonstrate that lnc-DILC disrupted the metastatic potential of CRC cells. lnc-DILC inhibits CRC cells progression via STAT3 cascade. Several signaling pathways including JAK/STAT3, PI3-K/Akt and MEK/ERK have been reported to feed into the regulation of tumor cells (25, 26). Herein our data showed that PI3-K/Akt and MEK/ERK pathway was not influenced by lnc-DILC knockdown, while the phosphorylation of STAT3 molecule was apparently activated in both HCT116 and SW480 mirDILC cells (Fig. 5 A).
ACCEPTED MANUSCRIPT STAT3 reporter assay further confirmed the effect of lnc-DILC on STAT3 activation (Fig. 5 B&C). Moreover, specific STAT3 inhibitor S3I-201 dramatically attenuated the distinct growth capacity between lnc-DILC knockdown CRC cells and control cells (Fig. 5D). Consistently, the inhibitor S3I-201 also eliminated the discrepancy of metastasis between lnc-DILC interference CRC cells and their control cells (Fig. 5E), suggesting that lnc-DILC suppressed CRC cell progression by inhibiting STAT3 signaling.
PT
lnc-DILC inhibits CRC cells progression via IL-6 signaling. It has been well accepted that the activation of STAT3 is predominantly regulated by the upstream interleukin 6 (IL-6) families (27). Our data showed that both IL-6 mRNA and protein level was
RI
markedly upregulated in both HCT116 and SW480 mirDILC cells (Fig. 6 A&B). IL-6 promoter reporter assay further confirmed the effect of lnc-DILC on IL-6 inactivation (Fig. 6 C).
SC
Furthermore, specific IL-6R inhibitor tocilizumab dramatically abolished the distinct growth capacity between lnc-DILC knockdown CRC cells and control cells (Fig. 6D). Consistently, the
NU
inhibitor tocilizumab also eliminated the discrepancy of metastasis between lnc-DILC interference CRC cells and their control cells (Fig. 6E). Taken together, our data showed that lnc-DILC
AC
CE
PT E
D
MA
suppressed CRC cell progression by inhibiting IL-6 signaling.
ACCEPTED MANUSCRIPT Discussion Colorectal cancer originates from epithelial cells in the colon or rectum (28). Like other malignant tumors, CRC cells have the ability of grow uncontrollably and invade or spread to other parts of the body (29). The clinical outcome of CRC is usually poor, mainly because of deeper tumor location, advanced stage and cancer metastasis at the time of diagnosis in most cases (30). The main treatment used for CRC patients include surgery, radiation therapy, chemotherapy and targeted therapy or their combination (31). CRC patients diagnosed at a late stage are usually not
PT
curable, and in that case the main goal of treatment is to improve the quality of life and prognosis (32).
Colorectal cancer derived from colonal or rectal epithelial cells, mainly because of mutations
RI
occurring in intestinal crypt stem cells due to increased activity of the Wnt signaling pathway (33). The adenomatous polyposis coli (APC) gene is known as the most commonly mutated gene in all
SC
CRC cases. The nuclear accumulation of β-catenin could be prevented by APC protein. In the absence of APC, β-catenin protein accumulated and translocated into the nucleus, where it binds to
NU
DNA and activates the downstream transcription of proto-oncogenes (34). Although APC mutation occurs in most colon cancers, β-catenin or other genes with the function similar to APC such as AXIN1, AXIN2, TCF7L2 and NKD1 were found to be increased in some cases (35). Other than
MA
the defects in Wnt signaling pathway, there should be other mutations that make cells cancerous. However, the molecular mechanisms underlying CRC initiation and progression are still not fully understood. For this reason, it is necessary and urgent to identify novel biomarkers to improve the
D
efficacy of early diagnosis and explore therapeutic targets for CRC patients. For the first time, the
PT E
present study demonstrated that lnc-DILC was a tumor suppressor in CRC and able to inhibit CRC cell growth and metastasis.
It was reported that lnc-RNA played an important role in embryonic development, stem cell self-renewal and differentiation, adipocyte differentiation and vascularization (36). Recent studies
CE
further indicate the pivotal function of lnc-RNA in tumorigenesis (37). Previous studies showed that lnc-DILC was downregulated in liver cell stem cells (LCSC) and suppressed their expansion
AC
through inhibiting autocrine IL6/STAT3 pathway. In addition, lnc-DILC mediated the crosstalk between NF-κB signaling and IL-6/STAT3 cascade in LCSC, suggesting that lnc-DILC played a critical role in connecting hepatic inflammation with LCSC expansion (19). Nevertheless, the role of lnc-DILC in CRC remains unclear. We demonstrated that lnc-DILC gene overexpression suppressed CRC cells proliferation and metastasis in vitro. Consistently, lnc-DILC gene interference facilitated CRC cell proliferation and metastasis in vitro. It was reported that abnormal activation of the STAT3 signaling pathway initiated or contributed to carcinogenesis of CRC and many other malignant tumors by regulating the expression of a large number of genes in tumor cells (38, 39). We found that lnc-DILC played a negative role in CRC cells and inhibited CRC proliferation and metastasis through deactivating IL-6/STAT3 signaling. In addition, these effects could be attenuated by the specific STAT3 inhibitor S3I-201 or IL-6R inhibitor tocilizumab.
ACCEPTED MANUSCRIPT
Competing interests All authors declare no competing interests.
Acknowledgments This work was supported by grand from the Tianjin Health Bureau Science Foundation
AC
CE
PT E
D
MA
NU
SC
RI
PT
(14KG108).
ACCEPTED MANUSCRIPT REFERENCES 1.
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, et al. Cancer statistics in China,
2015. CA Cancer J Clin 2016;66:115-132. 2.
Saika K, Sobue T. [Cancer statistics in the world]. Gan To Kagaku Ryoho 2013;40:2475-2480.
3.
Zhu J, Tan Z, Hollis-Hansen K, Zhang Y, Yu C, Li Y. Epidemiological Trends in Colorectal Cancer in
China: An Ecological Study. Dig Dis Sci 2017;62:235-243. 4.
Slattery ML, Herrick JS, Mullany LE, Samowitz WS, Sevens JR, Sakoda L, Wolff RK. The
co-regulatory networks of tumor suppressor genes, oncogenes, and miRNAs in colorectal cancer. Genes Chromosomes Cancer 2017;56:769-787. Bernal M, Garcia-Alcalde F, Concha A, Cano C, Blanco A, Garrido F, Ruiz-Cabello F. Genome-wide
PT
5.
differential genetic profiling characterizes colorectal cancers with genetic instability and specific routes 6.
RI
to HLA class I loss and immune escape. Cancer Immunol Immunother 2012;61:803-816. Lengauer C, Kinzler KW, Vogelstein B. Genetic instability in colorectal cancers. Nature
7.
SC
1997;386:623-627.
Portela A, Esteller M. Epigenetic modifications and human disease. Nat Biotechnol
2010;28:1057-1068.
Thibodeau SN, Bren G, Schaid D. Microsatellite instability in cancer of the proximal colon. Science
NU
8.
1993;260:816-819. 9.
Schmitt AM, Chang HY. Long Noncoding RNAs in Cancer Pathways. Cancer Cell 2016;29:452-463.
MA
10. Geisler S, Coller J. RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol 2013;14:699-712.
11. Gong Q, Su G. Roles of microRNAs and Long Noncoding RNAs in the Progression of Diabetic Retinopathy. Biosci Rep 2017.
D
12. Wu Q, Guo L, Jiang F, Li L, Li Z, Chen F. Analysis of the miRNA-mRNA-lncRNA networks in ER+ and ER- breast cancer cell lines. J Cell Mol Med 2015;19:2874-2887.
PT E
13. Zeng S, Xie X, Xiao YF, Tang B, Hu CJ, Wang SM, Wu YY, et al. Long noncoding RNA LINC00675 enhances phosphorylation of vimentin on Ser83 to suppress gastric cancer progression. Cancer Lett 2017;412:179-187.
14. Zhan Y, Li Y, Guan B, Wang Z, Peng D, Chen Z, He A, et al. Long non-coding RNA HNF1A-AS1
CE
promotes proliferation and suppresses apoptosis of bladder cancer cells through upregulating Bcl-2. Oncotarget 2017;8:76656-76665. 15. Zeng F, Le YG, Fan JC, Xin L. LncRNA CASC2 inhibited the viability and induced the apoptosis of
AC
hepatocellular carcinoma cells through regulating miR-24-3p. J Cell Biochem 2017. 16. Kun-Peng Z, Chun-Lin Z, Xiao-Long M. Antisense lncRNA FOXF1-AS1 Promotes Migration and Invasion of Osteosarcoma Cells Through the FOXF1/MMP-2/-9 Pathway. Int J Biol Sci 2017;13:1180-1191.
17. Wang P, Xu J, Wang Y, Cao X. An interferon-independent lncRNA promotes viral replication by modulating cellular metabolism. Science 2017. 18. Xiao ZD, Han L, Lee H, Zhuang L, Zhang Y, Baddour J, Nagrath D, et al. Energy stress-induced lncRNA FILNC1 represses c-Myc-mediated energy metabolism and inhibits renal tumor development. Nat Commun 2017;8:783. 19. Wang X, Sun W, Shen W, Xia M, Chen C, Xiang D, Ning B, et al. Long non-coding RNA DILC regulates liver cancer stem cells via IL-6/STAT3 axis. J Hepatol 2016;64:1283-1294. 20. Xu L, Chen X, Shen M, Yang DR, Fang L, Weng G, Tsai Y, et al. Inhibition of IL-6-JAK/Stat3 signaling
ACCEPTED MANUSCRIPT in castration-resistant prostate cancer cells enhances the NK cell mediated cytotoxicity via alteration of PD-L1/NKG2D ligand levels. Mol Oncol 2017. 21. Xiang DM, Sun W, Ning BF, Zhou TF, Li XF, Zhong W, Cheng Z, et al. The HLF/IL-6/STAT3 feedforward circuit drives hepatic stellate cell activation to promote liver fibrosis. Gut 2017. 22. Wang S, Zhang W. Genetic variants in IL-6/JAK/STAT3 pathway and the risk of CRC. Tumour Biol 2016;37:6561-6569. 23. Xiang D, Cheng Z, Liu H, Wang X, Han T, Sun W, Li X, et al. Shp2 promotes liver cancer stem cell expansion by augmenting beta-catenin signaling and predicts chemotherapeutic response of patients. Hepatology 2017;65:1566-1580.
PT
24. Li XF, Chen C, Xiang DM, Qu L, Sun W, Lu XY, Zhou TF, et al. Chronic Inflammation-elicited Liver Progenitor Cell Conversion to Liver Cancer Stem Cell with Clinical Significance. Hepatology 2017. colorectal cancer (Review). Int J Oncol 2014;44:1032-1040.
RI
25. Wang SW, Sun YM. The IL-6/JAK/STAT3 pathway: potential therapeutic strategies in treating
SC
26. Wang RY, Chen L, Chen HY, Hu L, Li L, Sun HY, Jiang F, et al. MUC15 inhibits dimerization of EGFR and PI3K-AKT signaling and is associated with aggressive hepatocellular carcinomas in patients. Gastroenterology 2013;145:1436-1448 e1431-1412.
NU
27. Yu H, Lee H, Herrmann A, Buettner R, Jove R. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer 2014;14:736-746. 28. Lee GH, Malietzis G, Askari A, Bernardo D, Al-Hassi HO, Clark SK. Is right-sided colon cancer
MA
different to left-sided colorectal cancer? - a systematic review. Eur J Surg Oncol 2015;41:300-308. 29. Raskov H, Pommergaard HC, Burcharth J, Rosenberg J. Colorectal carcinogenesis--update and perspectives. World J Gastroenterol 2014;20:18151-18164. 30. Son ES, Kim YO, Park CG, Park KH, Jeong SH, Park JW, Kim SH. Coix lacryma-jobi var. ma-yuen
D
Stapf sprout extract has anti-metastatic activity in colon cancer cells in vitro. BMC Complement Altern Med 2017;17:486.
PT E
31. Boursi B, Arber N. Current and future clinical strategies in colon cancer prevention and the emerging role of chemoprevention. Curr Pharm Des 2007;13:2274-2282. 32. Haviland J, Sodergren S, Calman L, Corner J, Din A, Fenlon D, Grimmett C, et al. Social support following diagnosis and treatment for colorectal cancer and associations with health-related quality of
CE
life: Results from the UK ColoREctal Wellbeing (CREW) cohort study. Psychooncology 2017. 33. Xian L, Georgess D, Huso T, Cope L, Belton A, Chang YT, Kuang W, et al. HMGA1 amplifies Wnt signalling and expands the intestinal stem cell compartment and Paneth cell niche. Nat Commun
AC
2017;8:15008.
34. Wei LH, Lin JM, Chu JF, Chen HW, Li QY, Peng J. Scutellaria barbata D. Don inhibits colorectal cancer growth via suppression of Wnt/beta-catenin signaling pathway. Chin J Integr Med 2017;23:858-863.
35. Cao J, Yan XR, Liu T, Han XB, Yu JJ, Liu SH, Wang LB. MicroRNA-552 promotes tumor cell proliferation and migration by directly targeting DACH1 via the Wnt/beta-catenin signaling pathway in colorectal cancer. Oncol Lett 2017;14:3795-3802. 36. Zhang Y, Lun L, Li H, Wang Q, Lin J, Tian R, Pan H, et al. The Value of lncRNA NEAT1 as a Prognostic Factor for Survival of Cancer Outcome: A Meta-Analysis. Sci Rep 2017;7:13080. 37. Liu XH, Sun M, Nie FQ, Ge YB, Zhang EB, Yin DD, Kong R, et al. Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer. Mol Cancer 2014;13:92.
ACCEPTED MANUSCRIPT 38. Chandrasekaran KS, Sathyanarayanan A, Karunagaran D. miR-214 activates TP53 but suppresses the expression of RELA, CTNNB1, and STAT3 in human cervical and colorectal cancer cells. Cell Biochem Funct 2017;35:464-471. 39. Chang YC, Su CY, Chen MH, Chen WS, Chen CL, Hsiao M. Secretory RAB GTPase 3C modulates IL6-STAT3 pathway to promote colon cancer metastasis and is associated with poor prognosis. Mol
AC
CE
PT E
D
MA
NU
SC
RI
PT
Cancer 2017;16:135.
ACCEPTED MANUSCRIPT Figure Legends Figure 1. Interference of lnc-DILC facilitates CRC cells proliferation in vitro. A. The expression of lnc-DILC in 40 pairs of CRCs (T) and neighboring noncancerous tissues (N) was checked by real-time PCR analysis. B. The mRNA level of lnc-DILC in lnc-DILC stably silenced HCT116 and SW480 cells. C. Cell proliferation was measured using CCK-8 assays in HCT116 or SW480 cells with stable depletion of lnc-DILC.
PT
D. Colony formation assays of HCT116 or SW480 cells with stable interference of lnc-DILC. E. Cell proliferation was assessed using EdU immunofluorescence staining in HCT116 or SW480
RI
cells with stable interference of lnc-DILC.
Figure 2. Overexpression of lnc-DILC suppresses CRC cells proliferation in vitro.
SC
A. The mRNA levels of lnc-DILC in lnc-DILC stably overexpressing HCT116 and SW480 cells. B. Cell proliferations were measured using CCK-8 assays in HCT116 or SW480 cells with stable
NU
interference of lnc-DILC.
C. Colony formation assays of HCT116 or SW480 cells stably overexpressing lnc-DILC. D. Cell proliferations were assessed using EdU immunofluorescence staining in HCT116 or
MA
SW480 cells with stable interference of lnc-DILC.
Figure 3. lnc-DILC depletion facilitates CRC cells migration and invasion.
D
A& B. Migration assay was performed utilizing polycarbonate membrane inserts in a 24-well
PT E
plate.
C. The invasive capacity of HCT116 mirDILC and control cells were analyzed using Matrigel-coated Boyden chamber.
D. The invasive ability of SW480 mirDILC and control cells was analyzed using Matrigel-coated
CE
Boyden chamber.
AC
Figure 4. lnc-DILC overexpression suppresses CRC cells migration and invasion. A& B. The migratory properties of the cells were analyzed using the transwell migration assay with transwell filter chambers as described in the Methods section. C. The invasive capacity of HCT116 mirDILC and control cells were analyzed using Matrigel-coated Boyden chamber. D. The invasive ability of SW480 mirDILC and control cells was analyzed using Matrigel-coated Boyden chamber.
Figure 5. lnc-DILC suppresses STAT3 activation in CRC cells. A. The phosphorylation status of STAT3 in HCT116 or SW480 mirDILC and their control cells was determined by Western bolt assay. B. Luciferase activity in the lysates of HCT116 or SW480 mirDILC and their control cells
ACCEPTED MANUSCRIPT transfected with STAT3 response element-luciferase reporter plasmid (STAT3-luc) was measured and normalized by Renillaluciferase activity. C. Luciferase activity in the lysates of HCT116 or SW480 DILC and their control cells transfected with STAT3 response element-luciferase reporter plasmid (STAT3-luc) was measured and normalized by Renillaluciferase activity. D. The proliferation of HCT116 or SW480 mirDILC and their control cells in the presence of S3I-201 (100 nM) or DMSO, respectively, was measured using the CCK8 assay.
PT
E. Migration assay was performed using HCT116 or SW480 mirDILC and their control cells with
Figure 6. lnc-DILC suppresses IL-6 activation in CRC cells.
RI
or without S3I-201 (100 nM, 200nM) treatment.
A. The mRNA expression of IL-6 in HCT116 or SW480 mirDILC and their control cells was
SC
determined by RT-PCR.
B. The protein expression of IL-6 in HCT116 or SW480 mirDILC and their control cells was
NU
determined by Western bolt assay.
C. Luciferase activity in the lysates of HCT116 or SW480 mirDILC and their control cells transfected with IL-6 promoter-luciferase reporter plasmid was measured and normalized by
MA
Renillaluciferase activity.
D. The proliferation of HCT116 or SW480 mirDILC and their control cells in the presence of tocilizumab (20 µg/mL) or DMSO, respectively, was measured using the CCK8 assay.
D
E. Migration assay was performed using HCT116 or SW480 mirDILC and their control cells with
AC
CE
PT E
or tocilizumab (20 µg/mL) treatment.
ACCEPTED MANUSCRIPT Abbreviation list: CRC: Colorectal cancer; lncRNAs: Long non-coding RNAs; DMEM: Dulbecco's modified Eagle’s medium; FBS: fetal bovine serum; EdU: 5-ethynyl-2’-deoxyuridine;
AC
CE
PT E
D
MA
NU
SC
RI
PT
APC: adenomatous polyposis coli; LCSC: liver cell stem cells.
ACCEPTED MANUSCRIPT Highlights: 1. We for first time found lnc-DILC was downregulated in CRC tissues. 2. We for first time found that lnc-DILC inhibits CRC cells proliferation and metastasis.
AC
CE
PT E
D
MA
NU
SC
RI
PT
3. We found that IL-6/STAT3 was the downstream of lnc-DILC in CRC cells.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Li-Qiang Gu, Xiang-Lei Xing, Hui Cai, An-Feng Si, Xian-Rong Hu, Qian-Yun Ma, Meng-Lin Zheng, Ruo-Yu Wang, Heng-Yu Li, Xi-Peng Zhang PII: DOI: Reference:
S0378-1119(18)30351-2 doi:10.1016/j.gene.2018.03.100 GENE 42722
To appear in:
Gene
Received date: Revised date: Accepted date:
18 November 2017 7 March 2018 29 March 2018
Please cite this article as: Li-Qiang Gu, Xiang-Lei Xing, Hui Cai, An-Feng Si, Xian-Rong Hu, Qian-Yun Ma, Meng-Lin Zheng, Ruo-Yu Wang, Heng-Yu Li, Xi-Peng Zhang , Long non-coding RNA DILC suppresses cell proliferation and metastasis in colorectal cancer. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Gene(2017), doi:10.1016/j.gene.2018.03.100
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT Long non-coding RNA DILC suppresses cell proliferation and metastasis in colorectal cancer Li-Qiang Gu1,#, Xiang-Lei Xing2,#, Hui Cai3,#, An-Feng Si4, Xian-Rong Hu5, Qian-Yun Ma6, Meng-Lin Zheng7,, Ruo-Yu Wang8,*, Heng-Yu Li9,*, Xi-Peng Zhang1,* 1
Department of Colorectal Surgery, Tianjin Union Medical Center, Tianjin, 300121, China Department of Laparoscope, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China 3 Department of Gastrointestinal surgery, First Affiliated Hospital of Second Military Medical University, Shanghai, 200433, China 4 Department of Surgical Oncology, Bayi Hospital Affiliated Nanjing University of Chinese Medicine, Nanjing, Jiangsu Province China 5 Department of Endoscopy, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China 6 Department of Urology surgery, First Affiliated Hospital of Second Military Medical University, Shanghai, 200433, China 7 Department of Ultrasound, Huashan Hospital Affiliated to Fudan University, Shanghai, China 8 Department of Hepatic Surgery, Third Affiliated Hospital of Second Military Medical University, Shanghai, 200438, China 9 Department of Breast and Thyroid surgery, First Affiliated Hospital of Second Military Medical University, Shanghai, 200433, China # These authors contributed equally to this work Correspondence and requests for materials should be addressed to R.W. (email: [email protected]) or to H.L. (email: [email protected]) or to X.Z. (email: [email protected])
CE
PT E
D
MA
NU
SC
RI
PT
2
AC
Running title: lnc-DILC inhibits CRC cells progression
ACCEPTED MANUSCRIPT Abstract Colorectal cancer (CRC) is one of the most common malignant tumors and one of the leading causes of cancer-related death in both men and women. The prognosis of CRC remains poor due to the advanced stage and cancer metastasis at the time of diagnosis. However, the exact mechanism of tumorigenesis in CRC remains unclear. Long non-coding RNAs (lncRNAs), which refer to transcripts longer than 200 nucleotides that are not translated into protein, are known to play important roles in multiple human cancers. Lnc-DILC is reported to be an important tumor
PT
suppressor gene and its inactivation is closely associated with liver cancer stem cells. However, the role of lnc-DILC in CRC remains to be elucidated. In the present study, we observed that lnc-DILC overexpression inhibited the growth and metastasis of CRC cells. Consistently,
RI
lnc-DILC knockdown facilitated the proliferation and metastasis of CRC cells. Mechanically, lnc-DILC suppressed CRC cell progression via IL-6/STAT3 signaling inactivation. More
SC
importantly, the specific STAT3 inhibitor S3I-201 and IL-6R inhibitor tocilizumab abolished the discrepancy of growth and metastasis capacity between lnc-DILC-interference CRC cells and
NU
control cells, which further confirmed that IL-6/STAT3 signaling was required in lnc-DILC-disrupted CRC cell growth and metastasis. Taken together, our results suggest that inactivating IL-6/STAT3 signaling.
MA
lnc-DILC is a novel CRC suppressor and may prove to be an inhibitor of CRC progression by
AC
CE
PT E
D
Keywords: Colorectal cancer, lnc-DILC, STAT3, proliferation, metastasis
ACCEPTED MANUSCRIPT Introduction Colorectal cancer (CRC) is one of the most prevalent tumors with a high death rate in the advanced stage (1, 2). However, the molecular mechanisms underlying colorectal initiation and progression remain unclear. CRC is generally believed to be due to old age or lifestyle change in most cases, and underlying genetic disorders in some cases (3). Numerous factors are involved in the initiation and progression of CRC, including mutations in tumor suppressor genes or proto-oncogenes, chromosomal and microsatellite instability, and epigenetic modifications (4-8).
PT
Knowing that early detection and treatment of CRC in its early stage are of great importance in reducing disease-specific mortality, it is necessary to clarify the underling mechanism and searching optional therapeutic targets.
RI
Long non-coding RNAs (lncRNAs) are a heterogeneous class of transcripts with a minimum length of 200 bases without protein-coding potential (9). Ample evidence has shown that lncRNAs
SC
can affect disparate cellular functions and are associated with diverse physiopathological processes (10). lncRNAs regulate gene expression at multiple levels, including pre-transcriptional
NU
regulation by recruiting chromatin-modifying complexes and post-transcriptional regulation by interacting with miRNAs, mRNAs, or proteins (11-13). More evidence indicates that lncRNAs modulate the proliferation, apoptosis, metastasis and metabolism of various cancers (14-18).
MA
lnc-DILC was reported as a tumor suppressor in liver cancer by regulating liver stem cell expansion through the IL-6/STAT3 axis (19). It was found that JAK/STAT3 pathway played a pivotal role in tumor activation (20), but the detailed machinery has not been identified so far.
D
STAT3 activation modulates the function of numerous substrates involved in the regulation of cell
PT E
growth and metastasis (21). Increasing evidence has shown that IL-6/STAT3 pathway is uncontrolled in CRC (22). However, the role of lnc-DILC in CRC progression is poorly understood.
In this study, we demonstrated that lnc-DILC, acting as a tumor suppressor, was involved in
CE
CRC cell progression, and that lnc-DILC downregulation significantly facilitated CRC cell proliferation and metastasis. In addition, we characterized that IL-6/STAT3 acted as the
AC
downstream pathway of lnc-DILC. Our results highlight the importance of lnc-DILC in inhibiting the proliferation and metastasis of CRC cells.
ACCEPTED MANUSCRIPT Materials and Methods Patients and samples Total 40 CRC patients’ tissue samples were collected from the Tianjin Union Medical Center (Tianjin, China). Patient informed consent was also obtained and the procedure of human sample collection was approved by the Ethic Committee of Tianjin Union Medical Center. Cell lines and cell culture HCT116 and SW480 cells were maintained at 37°C in a 5% CO2 incubator with Dulbecco's
PT
modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 25 µg/ml of gentamicin. The cultures were dissociated with 0.5% trypsin and
RI
transferred to new six-well plates biweekly. The lenti-vector expressing lnc-DILC or its control and mirDILC or its control virus was generated as described previously (23). HCT116 or SW480
SC
lnc-DILC and their control stable cell lines were established using lentivirus infection.
NU
Cell proliferation assays
For cell proliferation analysis, CRC cells were seeded in 96-well plates (3×103 cells per well). ATP activity was measured using a Cell Counting Kit-8 at indicated time points. EdU
MA
immunofluorescence staining was performed with the EdU Kit (RiboBio) according to the manufacturer's protocol. The results were quantified with a Zeiss axiophot photomicroscope (Carl
D
Zeiss) and Image-Pro plus 6.0 software.
PT E
Cell migration assays
For cell migration experiments, 2×105 CRC cells were seeded into the upper chamber of a polycarbonate transwell in serum-free DMEM. The lower chamber was added with DMEM containing 20% FBS as chemoattractant. The cells were incubated for 12 hours and the chamber
CE
was fixed. Cell count is expressed as the mean number of the cells in each field.
AC
Cell invasion assays
For cell invasion experiments, 2×105 CRC cells were seeded into the upper chamber of a polycarbonate transwell in serum-free DMEM. The lower chamber was added with DMEM containing 20% FBS as chemoattractant. The cells were incubated for 12 hours and the chamber was fixed. Cell count is expressed as the mean number of the cells in each field. Real-time PCR Total RNA was extracted from the cells using Trizol reagent (Invitrogen, 15596-018). Total cDNAs were synthesized by ThermoScript TM RT-PCR system (Invitrogen, 11146-057). The original amount of the specific transcripts was measured by real-time PCR using the ABI PRISM 7300 sequence detector (Applied Biosystems). The lnc-DILC primer sequences were forward: 5’ CTCTGGAGCCATACGTGACA 3’, and reverse: 5’ TCAGGTCACTTGTGCCGTT 3’.
ACCEPTED MANUSCRIPT
Western Blotting assays Thirty micrograms of proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to the nitrocellulose membrane. The membrane was blocked with 5% non-fat milk and incubated with the primary antibody for 1.5 hours. The protein band, specifically bound to the primary antibody, was detected using an IRDye 800CW-conjugated secondary antibody and LI-COR imaging system (LI-COR Biosciences). The antibodies p-STAT3,
PT
STAT3, IL-6 and GAPDH were purchased from Cell Signaling Technology, USA. Luciferase reporter assays
RI
CRC cells were transfected with STAT3 response element-luciferase reporter plasmid (STAT3-luc) or IL-6 promoter luciferase reporter in combination with the pRL-TK vector (Promega, E2241,
SC
Madison, Wisconsin, USA) as an internal control. The dual luciferase assay kit was purchased from Promega (0000060417). The luciferase activities were determined using a luminometer
NU
(Wallac 1420 Victor 2 multilabel counter system) as described in previous studies (24). Statistical analysis
MA
All statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc. La Jolla, USA). Statistical analysis was carried out using t test or Bonferroni Multiple Comparisons Test:
AC
CE
PT E
D
*p<0.05. A p value of less than 0.05 was considered statistically significant.
ACCEPTED MANUSCRIPT Results lnc-DILC depletion facilitates CRC cells proliferation. To explore the function of lnc-DILC in CRC progression, we checked lnc-DILC expression by using a great amount of human CRC tissues. As shown in Fig. 1A, lnc-DILC expression was dramatically reduced in CRC cases compared with the paired non-tumorous tissues. To elucidate the effect of lnc-DILC on CRC cells behavior, HCT116 and SW480 cells were infected by lentivirus expressing microRNA against lnc-DILC, and stable infectants were
PT
established (Fig. 1B). As shown in Fig. 1C, lnc-DILC depletion drove the proliferation of CRC cells markedly. In addition, CRC cells stably interfered with lnc-DILC to form more and bigger colonies compared with control cells (Fig. 1D). Consistently, 5-ethynyl-2’-deoxyuridine (EdU)
RI
staining confirmed that lnc-DILC knockdown facilitated CRC cell growth (Fig. 1E). Collectively,
SC
all these data showed that lnc-DILC suppressed CRC cells growth. lnc-DILC overexpression suppresses CRC cells proliferation.
NU
To further confirm the effect of lnc-DILC on CRC cells proliferation, HCT116 and SW480 cells were infected by lentivirus expressing lnc-DILC, and stable infectants were established (Fig. 2A). As shown in Fig. 2B, lnc-DILC overexpression significantly inhibited the proliferation of CRC
MA
cells. In addition, HCT116 and SW480 cells stably overexpressing lnc-DILC formed fewer and smaller colonies compared with their control cells (Fig. 2C). Consistently, EdU staining confirmed
D
that ectopic expression of lnc-DILC suppressed HCT116 and SW480 cells growth (Fig. 2D).
PT E
lnc-DILC knockdown drives CRC cells metastasis in vitro. To explore the role of lnc-DILC in CRC cells metastasis, transwell assay was performed, showing that the migration ability was enhanced in lnc-DILC inferencing CRC cells (Fig. 3A&B). In addition, matrigel invasion chamber assay revealed that lnc-DILC knockdown increased the
CE
invasiveness of CRC cells (Fig. 3C&D).
AC
lnc-DILC overexpression inhibits CRC cell transwell and invasion in vitro. To further elucidate the role of lnc-DILC in CRC cells metastasis, transwell assay was performed, showing that the migration ability was attenuated in CRC cells overexpressing lnc-DILC (Fig. 4A&B). Furthermore, matrigel invasion chamber assay revealed that lnc-DILC overexpression decreased the invasiveness of CRC cells (Fig. 4C&D). Taken together, our results demonstrate that lnc-DILC disrupted the metastatic potential of CRC cells. lnc-DILC inhibits CRC cells progression via STAT3 cascade. Several signaling pathways including JAK/STAT3, PI3-K/Akt and MEK/ERK have been reported to feed into the regulation of tumor cells (25, 26). Herein our data showed that PI3-K/Akt and MEK/ERK pathway was not influenced by lnc-DILC knockdown, while the phosphorylation of STAT3 molecule was apparently activated in both HCT116 and SW480 mirDILC cells (Fig. 5 A).
ACCEPTED MANUSCRIPT STAT3 reporter assay further confirmed the effect of lnc-DILC on STAT3 activation (Fig. 5 B&C). Moreover, specific STAT3 inhibitor S3I-201 dramatically attenuated the distinct growth capacity between lnc-DILC knockdown CRC cells and control cells (Fig. 5D). Consistently, the inhibitor S3I-201 also eliminated the discrepancy of metastasis between lnc-DILC interference CRC cells and their control cells (Fig. 5E), suggesting that lnc-DILC suppressed CRC cell progression by inhibiting STAT3 signaling.
PT
lnc-DILC inhibits CRC cells progression via IL-6 signaling. It has been well accepted that the activation of STAT3 is predominantly regulated by the upstream interleukin 6 (IL-6) families (27). Our data showed that both IL-6 mRNA and protein level was
RI
markedly upregulated in both HCT116 and SW480 mirDILC cells (Fig. 6 A&B). IL-6 promoter reporter assay further confirmed the effect of lnc-DILC on IL-6 inactivation (Fig. 6 C).
SC
Furthermore, specific IL-6R inhibitor tocilizumab dramatically abolished the distinct growth capacity between lnc-DILC knockdown CRC cells and control cells (Fig. 6D). Consistently, the
NU
inhibitor tocilizumab also eliminated the discrepancy of metastasis between lnc-DILC interference CRC cells and their control cells (Fig. 6E). Taken together, our data showed that lnc-DILC
AC
CE
PT E
D
MA
suppressed CRC cell progression by inhibiting IL-6 signaling.
ACCEPTED MANUSCRIPT Discussion Colorectal cancer originates from epithelial cells in the colon or rectum (28). Like other malignant tumors, CRC cells have the ability of grow uncontrollably and invade or spread to other parts of the body (29). The clinical outcome of CRC is usually poor, mainly because of deeper tumor location, advanced stage and cancer metastasis at the time of diagnosis in most cases (30). The main treatment used for CRC patients include surgery, radiation therapy, chemotherapy and targeted therapy or their combination (31). CRC patients diagnosed at a late stage are usually not
PT
curable, and in that case the main goal of treatment is to improve the quality of life and prognosis (32).
Colorectal cancer derived from colonal or rectal epithelial cells, mainly because of mutations
RI
occurring in intestinal crypt stem cells due to increased activity of the Wnt signaling pathway (33). The adenomatous polyposis coli (APC) gene is known as the most commonly mutated gene in all
SC
CRC cases. The nuclear accumulation of β-catenin could be prevented by APC protein. In the absence of APC, β-catenin protein accumulated and translocated into the nucleus, where it binds to
NU
DNA and activates the downstream transcription of proto-oncogenes (34). Although APC mutation occurs in most colon cancers, β-catenin or other genes with the function similar to APC such as AXIN1, AXIN2, TCF7L2 and NKD1 were found to be increased in some cases (35). Other than
MA
the defects in Wnt signaling pathway, there should be other mutations that make cells cancerous. However, the molecular mechanisms underlying CRC initiation and progression are still not fully understood. For this reason, it is necessary and urgent to identify novel biomarkers to improve the
D
efficacy of early diagnosis and explore therapeutic targets for CRC patients. For the first time, the
PT E
present study demonstrated that lnc-DILC was a tumor suppressor in CRC and able to inhibit CRC cell growth and metastasis.
It was reported that lnc-RNA played an important role in embryonic development, stem cell self-renewal and differentiation, adipocyte differentiation and vascularization (36). Recent studies
CE
further indicate the pivotal function of lnc-RNA in tumorigenesis (37). Previous studies showed that lnc-DILC was downregulated in liver cell stem cells (LCSC) and suppressed their expansion
AC
through inhibiting autocrine IL6/STAT3 pathway. In addition, lnc-DILC mediated the crosstalk between NF-κB signaling and IL-6/STAT3 cascade in LCSC, suggesting that lnc-DILC played a critical role in connecting hepatic inflammation with LCSC expansion (19). Nevertheless, the role of lnc-DILC in CRC remains unclear. We demonstrated that lnc-DILC gene overexpression suppressed CRC cells proliferation and metastasis in vitro. Consistently, lnc-DILC gene interference facilitated CRC cell proliferation and metastasis in vitro. It was reported that abnormal activation of the STAT3 signaling pathway initiated or contributed to carcinogenesis of CRC and many other malignant tumors by regulating the expression of a large number of genes in tumor cells (38, 39). We found that lnc-DILC played a negative role in CRC cells and inhibited CRC proliferation and metastasis through deactivating IL-6/STAT3 signaling. In addition, these effects could be attenuated by the specific STAT3 inhibitor S3I-201 or IL-6R inhibitor tocilizumab.
ACCEPTED MANUSCRIPT
Competing interests All authors declare no competing interests.
Acknowledgments This work was supported by grand from the Tianjin Health Bureau Science Foundation
AC
CE
PT E
D
MA
NU
SC
RI
PT
(14KG108).
ACCEPTED MANUSCRIPT REFERENCES 1.
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F, Jemal A, et al. Cancer statistics in China,
2015. CA Cancer J Clin 2016;66:115-132. 2.
Saika K, Sobue T. [Cancer statistics in the world]. Gan To Kagaku Ryoho 2013;40:2475-2480.
3.
Zhu J, Tan Z, Hollis-Hansen K, Zhang Y, Yu C, Li Y. Epidemiological Trends in Colorectal Cancer in
China: An Ecological Study. Dig Dis Sci 2017;62:235-243. 4.
Slattery ML, Herrick JS, Mullany LE, Samowitz WS, Sevens JR, Sakoda L, Wolff RK. The
co-regulatory networks of tumor suppressor genes, oncogenes, and miRNAs in colorectal cancer. Genes Chromosomes Cancer 2017;56:769-787. Bernal M, Garcia-Alcalde F, Concha A, Cano C, Blanco A, Garrido F, Ruiz-Cabello F. Genome-wide
PT
5.
differential genetic profiling characterizes colorectal cancers with genetic instability and specific routes 6.
RI
to HLA class I loss and immune escape. Cancer Immunol Immunother 2012;61:803-816. Lengauer C, Kinzler KW, Vogelstein B. Genetic instability in colorectal cancers. Nature
7.
SC
1997;386:623-627.
Portela A, Esteller M. Epigenetic modifications and human disease. Nat Biotechnol
2010;28:1057-1068.
Thibodeau SN, Bren G, Schaid D. Microsatellite instability in cancer of the proximal colon. Science
NU
8.
1993;260:816-819. 9.
Schmitt AM, Chang HY. Long Noncoding RNAs in Cancer Pathways. Cancer Cell 2016;29:452-463.
MA
10. Geisler S, Coller J. RNA in unexpected places: long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol 2013;14:699-712.
11. Gong Q, Su G. Roles of microRNAs and Long Noncoding RNAs in the Progression of Diabetic Retinopathy. Biosci Rep 2017.
D
12. Wu Q, Guo L, Jiang F, Li L, Li Z, Chen F. Analysis of the miRNA-mRNA-lncRNA networks in ER+ and ER- breast cancer cell lines. J Cell Mol Med 2015;19:2874-2887.
PT E
13. Zeng S, Xie X, Xiao YF, Tang B, Hu CJ, Wang SM, Wu YY, et al. Long noncoding RNA LINC00675 enhances phosphorylation of vimentin on Ser83 to suppress gastric cancer progression. Cancer Lett 2017;412:179-187.
14. Zhan Y, Li Y, Guan B, Wang Z, Peng D, Chen Z, He A, et al. Long non-coding RNA HNF1A-AS1
CE
promotes proliferation and suppresses apoptosis of bladder cancer cells through upregulating Bcl-2. Oncotarget 2017;8:76656-76665. 15. Zeng F, Le YG, Fan JC, Xin L. LncRNA CASC2 inhibited the viability and induced the apoptosis of
AC
hepatocellular carcinoma cells through regulating miR-24-3p. J Cell Biochem 2017. 16. Kun-Peng Z, Chun-Lin Z, Xiao-Long M. Antisense lncRNA FOXF1-AS1 Promotes Migration and Invasion of Osteosarcoma Cells Through the FOXF1/MMP-2/-9 Pathway. Int J Biol Sci 2017;13:1180-1191.
17. Wang P, Xu J, Wang Y, Cao X. An interferon-independent lncRNA promotes viral replication by modulating cellular metabolism. Science 2017. 18. Xiao ZD, Han L, Lee H, Zhuang L, Zhang Y, Baddour J, Nagrath D, et al. Energy stress-induced lncRNA FILNC1 represses c-Myc-mediated energy metabolism and inhibits renal tumor development. Nat Commun 2017;8:783. 19. Wang X, Sun W, Shen W, Xia M, Chen C, Xiang D, Ning B, et al. Long non-coding RNA DILC regulates liver cancer stem cells via IL-6/STAT3 axis. J Hepatol 2016;64:1283-1294. 20. Xu L, Chen X, Shen M, Yang DR, Fang L, Weng G, Tsai Y, et al. Inhibition of IL-6-JAK/Stat3 signaling
ACCEPTED MANUSCRIPT in castration-resistant prostate cancer cells enhances the NK cell mediated cytotoxicity via alteration of PD-L1/NKG2D ligand levels. Mol Oncol 2017. 21. Xiang DM, Sun W, Ning BF, Zhou TF, Li XF, Zhong W, Cheng Z, et al. The HLF/IL-6/STAT3 feedforward circuit drives hepatic stellate cell activation to promote liver fibrosis. Gut 2017. 22. Wang S, Zhang W. Genetic variants in IL-6/JAK/STAT3 pathway and the risk of CRC. Tumour Biol 2016;37:6561-6569. 23. Xiang D, Cheng Z, Liu H, Wang X, Han T, Sun W, Li X, et al. Shp2 promotes liver cancer stem cell expansion by augmenting beta-catenin signaling and predicts chemotherapeutic response of patients. Hepatology 2017;65:1566-1580.
PT
24. Li XF, Chen C, Xiang DM, Qu L, Sun W, Lu XY, Zhou TF, et al. Chronic Inflammation-elicited Liver Progenitor Cell Conversion to Liver Cancer Stem Cell with Clinical Significance. Hepatology 2017. colorectal cancer (Review). Int J Oncol 2014;44:1032-1040.
RI
25. Wang SW, Sun YM. The IL-6/JAK/STAT3 pathway: potential therapeutic strategies in treating
SC
26. Wang RY, Chen L, Chen HY, Hu L, Li L, Sun HY, Jiang F, et al. MUC15 inhibits dimerization of EGFR and PI3K-AKT signaling and is associated with aggressive hepatocellular carcinomas in patients. Gastroenterology 2013;145:1436-1448 e1431-1412.
NU
27. Yu H, Lee H, Herrmann A, Buettner R, Jove R. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer 2014;14:736-746. 28. Lee GH, Malietzis G, Askari A, Bernardo D, Al-Hassi HO, Clark SK. Is right-sided colon cancer
MA
different to left-sided colorectal cancer? - a systematic review. Eur J Surg Oncol 2015;41:300-308. 29. Raskov H, Pommergaard HC, Burcharth J, Rosenberg J. Colorectal carcinogenesis--update and perspectives. World J Gastroenterol 2014;20:18151-18164. 30. Son ES, Kim YO, Park CG, Park KH, Jeong SH, Park JW, Kim SH. Coix lacryma-jobi var. ma-yuen
D
Stapf sprout extract has anti-metastatic activity in colon cancer cells in vitro. BMC Complement Altern Med 2017;17:486.
PT E
31. Boursi B, Arber N. Current and future clinical strategies in colon cancer prevention and the emerging role of chemoprevention. Curr Pharm Des 2007;13:2274-2282. 32. Haviland J, Sodergren S, Calman L, Corner J, Din A, Fenlon D, Grimmett C, et al. Social support following diagnosis and treatment for colorectal cancer and associations with health-related quality of
CE
life: Results from the UK ColoREctal Wellbeing (CREW) cohort study. Psychooncology 2017. 33. Xian L, Georgess D, Huso T, Cope L, Belton A, Chang YT, Kuang W, et al. HMGA1 amplifies Wnt signalling and expands the intestinal stem cell compartment and Paneth cell niche. Nat Commun
AC
2017;8:15008.
34. Wei LH, Lin JM, Chu JF, Chen HW, Li QY, Peng J. Scutellaria barbata D. Don inhibits colorectal cancer growth via suppression of Wnt/beta-catenin signaling pathway. Chin J Integr Med 2017;23:858-863.
35. Cao J, Yan XR, Liu T, Han XB, Yu JJ, Liu SH, Wang LB. MicroRNA-552 promotes tumor cell proliferation and migration by directly targeting DACH1 via the Wnt/beta-catenin signaling pathway in colorectal cancer. Oncol Lett 2017;14:3795-3802. 36. Zhang Y, Lun L, Li H, Wang Q, Lin J, Tian R, Pan H, et al. The Value of lncRNA NEAT1 as a Prognostic Factor for Survival of Cancer Outcome: A Meta-Analysis. Sci Rep 2017;7:13080. 37. Liu XH, Sun M, Nie FQ, Ge YB, Zhang EB, Yin DD, Kong R, et al. Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer. Mol Cancer 2014;13:92.
ACCEPTED MANUSCRIPT 38. Chandrasekaran KS, Sathyanarayanan A, Karunagaran D. miR-214 activates TP53 but suppresses the expression of RELA, CTNNB1, and STAT3 in human cervical and colorectal cancer cells. Cell Biochem Funct 2017;35:464-471. 39. Chang YC, Su CY, Chen MH, Chen WS, Chen CL, Hsiao M. Secretory RAB GTPase 3C modulates IL6-STAT3 pathway to promote colon cancer metastasis and is associated with poor prognosis. Mol
AC
CE
PT E
D
MA
NU
SC
RI
PT
Cancer 2017;16:135.
ACCEPTED MANUSCRIPT Figure Legends Figure 1. Interference of lnc-DILC facilitates CRC cells proliferation in vitro. A. The expression of lnc-DILC in 40 pairs of CRCs (T) and neighboring noncancerous tissues (N) was checked by real-time PCR analysis. B. The mRNA level of lnc-DILC in lnc-DILC stably silenced HCT116 and SW480 cells. C. Cell proliferation was measured using CCK-8 assays in HCT116 or SW480 cells with stable depletion of lnc-DILC.
PT
D. Colony formation assays of HCT116 or SW480 cells with stable interference of lnc-DILC. E. Cell proliferation was assessed using EdU immunofluorescence staining in HCT116 or SW480
RI
cells with stable interference of lnc-DILC.
Figure 2. Overexpression of lnc-DILC suppresses CRC cells proliferation in vitro.
SC
A. The mRNA levels of lnc-DILC in lnc-DILC stably overexpressing HCT116 and SW480 cells. B. Cell proliferations were measured using CCK-8 assays in HCT116 or SW480 cells with stable
NU
interference of lnc-DILC.
C. Colony formation assays of HCT116 or SW480 cells stably overexpressing lnc-DILC. D. Cell proliferations were assessed using EdU immunofluorescence staining in HCT116 or
MA
SW480 cells with stable interference of lnc-DILC.
Figure 3. lnc-DILC depletion facilitates CRC cells migration and invasion.
D
A& B. Migration assay was performed utilizing polycarbonate membrane inserts in a 24-well
PT E
plate.
C. The invasive capacity of HCT116 mirDILC and control cells were analyzed using Matrigel-coated Boyden chamber.
D. The invasive ability of SW480 mirDILC and control cells was analyzed using Matrigel-coated
CE
Boyden chamber.
AC
Figure 4. lnc-DILC overexpression suppresses CRC cells migration and invasion. A& B. The migratory properties of the cells were analyzed using the transwell migration assay with transwell filter chambers as described in the Methods section. C. The invasive capacity of HCT116 mirDILC and control cells were analyzed using Matrigel-coated Boyden chamber. D. The invasive ability of SW480 mirDILC and control cells was analyzed using Matrigel-coated Boyden chamber.
Figure 5. lnc-DILC suppresses STAT3 activation in CRC cells. A. The phosphorylation status of STAT3 in HCT116 or SW480 mirDILC and their control cells was determined by Western bolt assay. B. Luciferase activity in the lysates of HCT116 or SW480 mirDILC and their control cells
ACCEPTED MANUSCRIPT transfected with STAT3 response element-luciferase reporter plasmid (STAT3-luc) was measured and normalized by Renillaluciferase activity. C. Luciferase activity in the lysates of HCT116 or SW480 DILC and their control cells transfected with STAT3 response element-luciferase reporter plasmid (STAT3-luc) was measured and normalized by Renillaluciferase activity. D. The proliferation of HCT116 or SW480 mirDILC and their control cells in the presence of S3I-201 (100 nM) or DMSO, respectively, was measured using the CCK8 assay.
PT
E. Migration assay was performed using HCT116 or SW480 mirDILC and their control cells with
Figure 6. lnc-DILC suppresses IL-6 activation in CRC cells.
RI
or without S3I-201 (100 nM, 200nM) treatment.
A. The mRNA expression of IL-6 in HCT116 or SW480 mirDILC and their control cells was
SC
determined by RT-PCR.
B. The protein expression of IL-6 in HCT116 or SW480 mirDILC and their control cells was
NU
determined by Western bolt assay.
C. Luciferase activity in the lysates of HCT116 or SW480 mirDILC and their control cells transfected with IL-6 promoter-luciferase reporter plasmid was measured and normalized by
MA
Renillaluciferase activity.
D. The proliferation of HCT116 or SW480 mirDILC and their control cells in the presence of tocilizumab (20 µg/mL) or DMSO, respectively, was measured using the CCK8 assay.
D
E. Migration assay was performed using HCT116 or SW480 mirDILC and their control cells with
AC
CE
PT E
or tocilizumab (20 µg/mL) treatment.
ACCEPTED MANUSCRIPT Abbreviation list: CRC: Colorectal cancer; lncRNAs: Long non-coding RNAs; DMEM: Dulbecco's modified Eagle’s medium; FBS: fetal bovine serum; EdU: 5-ethynyl-2’-deoxyuridine;
AC
CE
PT E
D
MA
NU
SC
RI
PT
APC: adenomatous polyposis coli; LCSC: liver cell stem cells.
ACCEPTED MANUSCRIPT Highlights: 1. We for first time found lnc-DILC was downregulated in CRC tissues. 2. We for first time found that lnc-DILC inhibits CRC cells proliferation and metastasis.
AC
CE
PT E
D
MA
NU
SC
RI
PT
3. We found that IL-6/STAT3 was the downstream of lnc-DILC in CRC cells.
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6