- Email: [email protected]
Long non-coding RNA NEAT1 promotes bladder progression through regulating miR-410 mediated HMGB1
Biomedicine & Pharmacotherapy 121 (2020) 109248
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Long non-coding RNA NEAT1 promotes bladder progression through regulating miR-410 mediated HMGB1
T
Guang Shana,*, Tian Tangb, Yue Xiaa, Hui-Jun Qiana a b
Department of Urology, Renmin Hospital of Wuhan University, Wuhan, Hubei, China Department of Oncology, Renmin Hospital of Wuhan University, Wuhan, Hubei, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Bladder cancer Noncoding RNA NEAT1 miR-410 HMGB1
LncRNA NEAT1 is reported as a crucial oncogene in multiple cancers. But, its biological role in bladder cancer is barely understood. Therefore, we concentrated on the function and role of NEAT1 in bladder cancer. Firstly, NEAT1 expression in bladder cancer cells was determined and it was displayed NEAT1 was significant elevated. NEAT1 was knockdown and overexpressed in T24 and J82 cells. Then it was indicated that NEAT1 silence greatly inhibited bladder cancer cell proliferation with an increased ratio of apoptotic cells and severe cell cycle arrest. Overexpression of NEAT1 exhibited a reversed process in bladder cancer cells. Additionally, in vivo experiments were employed using establishment of nude mice models. NEAT1 knockdown inhibited bladder cancer growth while increase of NEAT1 promoted bladder cancer development in vivo. By employing the bioinformatics analysis, we speculated that miR-410 was as a downstream target of NEAT1. Then, the targeting association between them was proved in our research and we implicated miR-410 was dramatically restrained in bladder cancer cells. Meanwhile, it was exhibited that miR-410 was negatively regulated by NEAT1. Apart from these, HMGB1 was speculated as a downstream target of miR-410. Dual-luciferase reporter assay was used to prove the correlation between miR-410 and HMGB1. Up-regulation of miR-410 restrained HMGB1 levels and NEAT1 can regulate HMGB1 level via sponging miR-410. To sum up, we implied NEAT1/miR-410/HMGB1 axis participated in bladder cancer.
1. Introduction Bladder cancer is a common urological malignant tumor worldwide [1]. Surgery and chemotherapy are still the effective strategies to treat bladder cancer [2]. Despite great improvements have been made in bladder cancer, its five-year overall survival rate is still unsatisfactory [3–5]. Herein, investigating the possible mechanisms of bladder cancer is greatly significant. As well established, lncRNAs are non-coding RNAs with over 200nts [6]. They are involved in a various biological processes [7,8]. Many reports have reported lncRNAs can exert crucial roles in diseases, especially in a variety of cancers [9]. Various lncRNAs can participate in the development of bladder cancer. XIST promotes bladder cancer progression through sponging miR-139-5p [10]. Up-regulation of TUG1 can promote bladder cancer cell development by sponging miR-29c [11]. LncRNA ATB induces bladder cancer progression via suppressing miR-126 [12]. NEAT1 has been reported to contribute to several cancers. For example, it can promote the progression of breast cancer through modulating miR-448/ZEB1 axis [13]. NEAT1 is able to
⁎
promote prostate cancer development via targeting SRC3/IGF1R/AKT [14]. NEAT1 is involved in NSCLC development by modulating miR-98 and MAPK6 [15]. The detailed effect of NEAT1 in bladder cancer progression remains poorly explored. Meanwhile, via binding with the 3′-UTR of mRNA, microRNAs can modulate their targeting genes [16]. MicroRNAs are able to play a crucial role in cancer development as exhibited by the increasing evidences [17,18]. Moreover, lncRNAs can demonstrate their roles via various mechanisms and lncRNAs may function as miRNAs sponges, which can modulate their regulatory effects on mRNAs [19]. Increasing evidence has indicated the interplay between miRNAs and lncRNAs in tumorigenesis. By using informatics analysis, miR-410 was predicted as the target of NEAT1. The interplay between NEAT1 and miR-410 is barely known in the development of bladder cancer.In the current study, we hypothesized NEAT1 regulated HMGB1 levels via sponging miR-410 and targeting HMGB1 in bladder cancer progression.
Corresponding author. E-mail address: [email protected] (G. Shan).
https://doi.org/10.1016/j.biopha.2019.109248 Received 21 May 2019; Received in revised form 18 July 2019; Accepted 18 July 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
2.5. Flow cytometry analysis
Table 1 Primers for real-time PCR.
GAPDH U6 NEAT1 HMGB1 miR-410
Forward (5’-3’)
Reverse (5’-3’)
AAGAAGGTGGTGAAGCAGGC ATTGGAACGATACAGAGAAGATT TGGCTAGCTCAGGGCTTCAG TGCAGATGACAAGCAGCCTT GAGCAGCATTGTACAG
GTCAAAGGTGGAGGAGTGGG GGAACGCTTCACGAATTTG TCTCCTTGCCAAGCTTCCTTC GCTGCATCAGGCTTTCCTTT GTGCAGG GTCCGAGGT
Firstly, all the cells were digested and 1 × 105 cells per mL of suspended cells were harvested. 100 μL 1 × Annexin buffer was used to suspend the cells. Afterwards, Annexin V-FITC was employed to do the marking. Five μL Annexin V and one μL PI were utilized to stain the cells. Then, they were mixed and incubated for 15 min. Next, 400 μL 1× buffer was added. Subsequently, to analyze the cell apoptosis, FACScan® flow cytometer was employed.
2. Materials and methods
2.6. Cell cycle assay
2.1. Cell culture
70% cold anhydrous ethanol was employed to fix the cells. Then, the cells were treated with PI (Sigma, St. Louis, MO, USA) with RNase A. In order to detect the cell cycle distribution, Flow cytometer equipped with Cell Quest software was utilized.
Human uroepithelial cell line (SV-HUC-1), human bladder cancer cell lines (T24, EJ, UMUC3, J82, HT1376) and HEK-293 T cells were obtained from the Cell Bank of the Chinese Academy of Sciences. RPMI1640 medium added with 10% FBS, 100 μg/ml streptomycin and 100U/ ml penicillin (Gibco, Carlsbad, CA, USA) was utilized to culture all the cells. A humidified 5% CO2 incubator at 37 °C was used.
2.7. qRT-PCR To extract total RNA, Trizol reagent was used. Then, total RNA was reverse transcribed to cDNA by using the PrimeScript RT Reagent Kit with gDNA Eraser. SYBR Green PCR Kit (TaKaRaBio Technology, Dalian, China) was employed to carry out qRT-PCR on the ABI 7900 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The primers used in this study were listed in Table 1.
2.2. Lentiviral vector transfection PCR was employed to amplify the full-length cDNA of human NEAT1. pcDNA3.1 (GenePharma, Shanghai, China) was employed to clone the objective products. Lentivirus packaging vectors (pMD2.G) and the constructed vectors were co-transfected for 48 h. Cells were transfected with lentivirus, added with 8 μg/mL polybrene.
2.8. Luciferase activity assay The WT or MUT NEAT1 was sub-cloned into pGL3 Basic vector (Promega, Madison, WI, USA). MiR-410 mimics were co-transfected with 10 μg pLUC-WT-NEAT1 or pLUC-MUT-NEAT1. Luciferase activity was tested using the Multimode Detector reporter assay system (Beckman Coulter, WI, USA). The WT or MUT-HMGB1 was sub-cloned into pGL3 Basic vector in a similar way.
2.3. CCK8 assay Bladder cancer cells were grown on a 96-well plate for a whole night. After the transfection for two days, CCK-8 reagent was used to incubate the cells for 1 h. Afterwards, a microplate reader was utilized to assess the absorbance at 450 nm.
2.9. RIP assay RIP experiment was conducted using Magna RIP Kit (EMD Millipore, Billerica, MA, USA). NP-40 lysis buffer was added to obtain the cell lysate. Afterwards, cell lysate was treated with RIP buffer containing magnetic beads bound with human anti-Ago2 antibody or normal mouse IgG (Millipore, Billerica, MA, USA).
2.4. EdU assay Bladder cancer cells were plated in 96-well plates for a whole night. After transfection, the EdU Cell Proliferation Assay Kit (Ribobio, Guangzhou, China) was employed to detect the cell proliferation. Cells were treated with 50μM EdU. 1 μg/ml DAPI was employed to stain the cell nuclei. The EdU positive cells were determined under fluorescence microscopy.
2.10. RNA pull-down assay RNAs were labeled using Pierce RNA 3′End Desthiobiotinylation Kit
Fig. 1. Expression of NEAT1 in bladder cancer cells. (A) NEAT1 expression in SV-HUC-1, T24, EJ, UMUC3, J82 and HT1376 cells. qRT-PCR was used to detect NEAT1 expression using GAPDH as a control. (B) NEAT1 expression in T24 cells. T24 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. (C) NEAT1 expression in J82 cells. J82 cells were infected with LVshNEAT1, LV-NEAT1 or LV-NC for 48 h. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05. 2
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 2. Effects of NEAT1 on bladder cancer cell proliferation. (A–B) Effects of NEAT1 on the cell proliferation of C33A cells. Cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. EdU assay was used to detect cell proliferation. The integral optical density (IOD) values of cells transfected with control plasmids were normalized to 100%. (C–D) Effects of NEAT1 on the bladder cancer cell survival. CCK8 assay indicated the cell survival of T24 and J82 cells. (E) Cell survival was calculated as the mean ± SEM at 24 h after cultivation. Data of cells treated with control plasmids was normalized to 100%. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
2.12. Animal studies
(Thermo Fisher Scientific, Waltham, MA, USA). Cells were incubated with miR-410-Bio, miR-410-Bio-mut or NC-Bio.
BALB/c nude mice were purchased from Shanghai Animal Laboratory Center. Briefly, the mice were injected with 5 × 106 parental T24/J82 cells, T24/J82 infected with LV-shNEAT1 or LV-NEAT1 in the front dorsum. After two weeks, every three days, the tumor sizes were recorded. The study was conducted under the requirements in the Guide for the Care and Use of Laboratory Animals of the NIH. The study protocol was approved by the ethic committee of Renmin Hospital of Wuhan University.
2.11. Western blot The cell lysate with the protease inhibitor PMSF was added into cells. The lysate was centrifuged at 12,000 r/min for 20 min. Then, we took the supernatant and the total protein concentration was detected by the BCA method (Pierce, Rockford, IL, USA). 50ug total protein were loaded on 10% SDS-PAGE gel to do electrophoresis. Then, PVDF membrane was used. Then the membranes were blocked in the skimmed milk for 2 h. After washed by TBST for 6 times every 10 min, the membrane was maintained with specific primary antibodies for a whole night at 4 °C. Next, the corresponding secondary antibodies were used. Finally, the membranes were analyzed using ECL detection kit (Applygen, Beijing, China).
2.13. Statistical analysis Statistical data analysis was done using GraphPad Prism 6.0. Afterwards, statistical analysis was carried out using Student’s unpaired two-tailed t-test or one-way analysis of variance. Statistical significance was significant with the p-value less than 0.05. 3
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 3. NEAT1 affected bladder cancer cell apoptosis and cell cycle. (A)Effects of NEAT1 on the cell apoptosis in T24 and J82 cells. Cells were infected with LV-shNEAT1 or LV-NEAT1 for 48 h. Flow cytometry assay was used to analyze the cell apoptosis. (B) Effects of NEAT1 on the cell cycle in T24 and J82 cells. Cells were infected with LV-shNEAT1 or LV-NEAT1 for 48 h. Flow cytometry assay was conducted to analyze the cell cycle. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
3. Results
3.2. NEAT1 affected bladder cancer cell proliferation
3.1. Upregulation of NEAT1 in bladder cancer cells
Here, in our current study, we exhibited that NEAT1 knockdown suppressed bladder cancer cell proliferation while NEAT1 overexpression induced bladder cancer cell proliferation (Fig. 2A and 2B). In addition, CCK8 assay was used and we found LV-shNEAT1 inhibited cell survival and LV-NEAT1 promoted cell growth (Fig. 2C, 2D and 2E). These indicated inhibition of NEAT1 can inhibit bladder cancer cell proliferation.
Firstly, to detect the level of NEAT1 in bladder cancer, we used qRTPCR. As demonstrated, NEAT1 expression in five bladder cancer cells including T24, EJ, UMUC3, J82 and HT1376 cells was dramatically elevated (Fig. 1A). Next, to study the further roles of NEAT1 in bladder cancers, T24 and J82 cells were chosen for our further research. T24 and J82 cells were infected with LV-shNEAT1, LV-NEAT1 or their negative control for two days. We found that NEAT1 was silenced by LVshNEAT1 and greatly overexpressed by LV-NEAT1 in T24 and J82 cells (Fig. 1B). These suggested the NEAT1 was involved in bladder cancer progression.
3.3. Inhibition of NEAT1 triggered bladder cancer cell apoptosis and blocked cell cycle progression Moreover, cell apoptosis was increased by LV-shNEAT1 and inhibited by LV-NEAT1 in Fig. 3A. In Fig. 3B, it was implied that NEAT1 knockdown for 48 h was able to increase cell ratios in G1 phase and reduced cell ratios in S phase. This indicated that NEAT1 inhibition 4
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 4. The effect of NEAT1 deletion and overexpression on bladder tumor growth in vivo. (A–B) The tumor subcutaneously transplanted into the right groin of BALB/C nude mice with T24 or J82 cells was stripping out (A) and the weight was measured (B) (n = 8). Tumor weight was normalized to control plasmid group. (C) Immunohistochemistry staining of Ki-67 in tumor tissues. Ki-67 positive cells were normalized to control plasmid group. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
Fig. 5. MiR-410 was a direct target of NEAT1. (A)The binding regions between NEAT1 and miR-410. (B) The luciferase reporter constructs with the wild type (WT-NEAT1) or mutant NEAT1 (MUT-NEAT1). (C) WT-NEAT1 or MUT-NEAT1 was co-transfected into HEK-293 T cells with miR-410 mimics or their negative controls. (D) The correlation between NEAT1 and Ago2 was assessed by RIP assay in T24 cells. Cellular lysates were immunoprecipitated using Ago2 antibody or IgG. (E) RNA pull-down assay indicated the direct interaction between miR-410 and NEAT1. Cellular lysates were pulled down using biotinylated control (NC-Bio), miR-410 (miR-410-Bio), or miR-410 probe containing mutations in the NEAT1-binding site (miR-410-Bio-mut). Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
blocked the cell cycle progression while NEAT1 overexpression had a reverse phenomenon. These implied NEAT1 silence increased cell apoptosis and triggered cell arrest.
3.4. The effect of NEAT1 deletion and overexpression on bladder tumor growth in vivo T24 and J82 cell nude mouse xenograft model was used to determine if NEAT1 silence inhibited bladder cancer progression in vivo.
5
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 6. NEAT1 modulated miR-410 expression negatively in vitro and in vivo. (A)miR-410 expression in SV-HUC-1, T24, EJ, UMUC3, J82 and HT1376 cells. qRT-PCR was used to detect miR-410 expression using U6 as a control. (B) miR-410 expression in J82 cells. J82 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. (C) miR-410 expression in T24 cells. T24 cells were infected with LVshNEAT1, LV-NEAT1 or LV-NC for 48 h. (D) Expression of miR-410 in the T24 cell nude mouse xenograft model. (E) Expression of miR-410 in the J82 cell nude mouse xenograft model. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. * *P < 0.05, **P < 0.01.
manifested in Fig. 7A and 7B. Co-transfection of the luciferase reporter plasmid containing WT-HMGB1 with miR-410 mimics caused an inhibited reporter activity (Fig. 7C). In addition, HMGB1 was remarkably inhibited by miR-410 mimics in T24 and J82 cells (Fig. 7D). In Fig. 7E and 7 F, HMGB1 levels were down-regulated by NEAT1 deletion and up-regulated by NEAT1 overexpression. These findings indicated NEAT1 regulated bladder cancer development through regulating miR410 and HMGB1.
Eight mice were injected with parental T24/J82 cells. The other eight were injected with T24/J82 infected with LV-shNEAT1 or LV-NEAT1. Tumors were exhibited in Fig. 4A. NEAT1 inhibition greatly inhibited tumor weight while NEAT1 overexpression increased tumor weight as shown in Fig. 4B. In addition, the IHC data revealed Ki-67 was repressed by LV-shNEAT1 whereas reversed by LV-NEAT1 (Fig. 4C). These suggested deletion of NEAT1 could inhibit bladder tumor growth in vivo. 3.5. NEAT1 can sponge miR-410 in vitro
4. Discussion
Currently, the correlation between NEAT1 and miR-410 was exhibited in Fig. 5A. Dual luciferase reporter assay was conducted (Fig. 5B). The luciferase reporter plasmid containing the WT-NEAT1 with miR-410 mimics were co-transfected and a decreased reporter activity was demonstrated (Fig. 5C). NEAT1 and miR-410 were much more enriched in Ago2 pellet (Fig. 5D). RNA pull-down assay with miR410-bio probe induced the level of NEAT1 than NC-bio or miR-410 probes (Fig. 5E). These implied miR-410 might be a target of NEAT1.
Here, our current work focused on a comprehensive study of the functional role of NEAT1 and its ceRNA mechanism via modulating miR-410 and HMGB1 in bladder cancer progression. Firstly, we found NEAT1 was greatly elevated while miR-410 was inhibited in bladder cancer cells. Lack of NEAT1 repressed the bladder cancer development while NEAT1 overexpression induced it. Meanwhile, NEAT1 can modulate miR-410 levels negatively. The negative association between NEAT1 and miR-410 was also proved. HMGB1 was predicted as a downstream target of miR-410 and miR-410 mimics repressed HMGB1 in vitro. During this research, we highlighted the significance of the ceRNA mechanism in regulating the oncogenic role of NEAT1, which could facilitate our understanding of the internal RNA regulatory networks and contribute a lot to the therapeutic progress for bladder cancer. Bladder cancer exhibits altered expression of some lncRNAs [20]. LncRNAs are implicated in carcinogenesis and can act as potent biomarkers for bladder cancer.For instance,knockdown of lncRNA FGFR3AS1 can inhibit bladder cancer development [21]. LncRNA MALAT1 can reduce bladder cancer cell apoptosis and promote invasion by inhibiting miR-125b [22]. LncRNA HNF1A-AS1 can induce bladder cancer cell proliferation and repress apoptosis by up-regulating Bcl-2 [23]. In addition, NEAT1 exerts an oncogenic role in many cancer [24].
3.6. NEAT1 regulated miR-410 expression negatively miR-410 was obviously decreased in bladder cancer cells (Fig. 6A). Meanwhile, LV-shNEAT1 can increase miR-410 levels while LV-NEAT1 inhibit miR-410 in bladder cancer cells (Fig. 6B and 6C). Furthermore, miR-410 in the T24 and J82 cell nude mouse xenograft models were also increased by NEAT1 deletion and decreased by NEAT1 overexpression (Fig. 6D and 6E). These manifested NEAT1 can regulate miR-410 levels negatively. 3.7. MiR-410 targeted HMGB1 Moreover, WT-HMGB1 and MUT-HMGB1 binding sites were 6
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 7. HMGB1 was a downstream target of miR-410. (A) The binding regions between HMGB1 and miR-410. (B) The luciferase reporter constructs containing the wild type (WT-HMGB1) or mutant HMGB1 (MUTHMGB1) sequence. (C) WT-HMGB1 or MUT-HMGB1 was co-transfected into HEK-293 T cells with miR-410 mimics or their negative controls. (D) Expression of HMGB1 in T24 and J82 cells. Cells were transfected with miR-410 mimics or their negative controls. (E) Expression of HMGB1 in T24 cells. T24 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. (F) Expression of HMGB1 in J82 cells. J82 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
interplay between NEAT1 and miR-410 was proved. HMGB1 belongs to HMGB family members. It can act as a signaling molecule in the various biological processes [34,35]. Additionally, HMGB1 can play a crucial role in many cancers. In colorectal cancer, HMGB1 represses anti-metastatic defense of lymph nodes [36]. HMGB1-mediated MMP-9 contributes to NSCLC cell invasiveness [37]. MiR-34a inhibits cancer cell development in cutaneous squamous cell carcinoma through directly targeting HMGB1 [38]. MiR-129-2 plays tumor suppressive roles via inhibiting HMGB1 in glioma [39]. In addition, lncRNA UCA1 can promote bladder cancer cell invasion and EMT via regulating miR-143 and HMGB1 [40]. LncRNA TUG1 downregulation can enhance radio-sensitivity in bladder cancer through inhibiting HMGB1 [41]. Previously, it has been reported that HMGB1 expression was significantly higher in bladder cancer patients [42]. Targeting HMGB1 can greatly inhibit bladder cancer cells bioactivity through lentivirus-mediated RNA interference [43]. Here, we predicted HMGB1 as a downstream target for miR-410 in bladder cancer. Then, we validated the correlation between miR-410 and HMGB1. MiR-410 mimics repressed HMGB1 expression greatly. Additionally, we reported that NEAT1 modulated HMGB1 levels through sponging miR-410. In conclusion, it was implied that NEAT1 exhibited a tumor oncogenic role in bladder cancer. We implied NEAT1/miR-410/HMGB1 axis was responsible for the progression of bladder cancer.
For instance, NEAT1 can promote breast cancer development through negatively regulating miR-218 [25]. NEAT1 can promote NSCLC progression via targeting miR-181a-5p [26]. NEAT1 induces hepatocellular carcinoma cell proliferation by regulating miR-129-5p [27]. Herein, in our current study, we confirmed that NEAT1 was highly up-regulated in bladder cancer. Previous studies report that NEAT1 possessed oncogenic roles in bladder cancer. NEAT1 is involved in the oncogenesis, early detection, and prognosis of bladder cancer. In addition, NEAT1/ miR-214-3p can contribute to doxorubicin resistance of urothelial bladder cancer via activating Wnt/β-catenin pathway [28]. Here, we found silence of NEAT1 restrained bladder cancer progression. Reversely, NEAT1 overexpression demonstrated an oncogenic role in bladder cancer. Emerging evidences have indicated the existence of a ceRNA interaction network that lncRNAs can act as molecular sponges to inhibit miRNAs and remove them off their binding sites on the targeting mRNAs [29,30]. Herein we predicted that miR-410 might bind to NEAT1. MiR-410 functions a lot in several human cancers. For example, in glioma, miR-410 inhibits glioma proliferation and invasion though regulating MET [31]. MiR-410 can suppress breast cancer progression by inhibiting Snail [32]. MiR-410 can serve as a tumor suppressor via regulating angiotensin II type 1 receptor in pancreatic cancer [33]. However, the effect of miR-410 in bladder cancer was poorly explored. Currently, we predicted NEAT1 targeted miR-410. In bladder cancer cells, we validated that miR-410 was significantly reduced. The 7
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Data availability statement
Oncodevelopmental Biology and Medicine (2016). [19] G. Militello, T. Weirick, D. John, C. Doring, S. Dimmeler, S. Uchida, Screening and validation of lncRNAs and circRNAs as miRNA sponges, Brief. Bioinformatics 18 (5) (2017) 780–788. [20] M. Taheri, M.D. Omrani, S. Ghafouri-Fard, Long non-coding RNA expression in bladder cancer, Biophys. Rev. (2017). [21] X. Liao, J. Chen, Y. Liu, A. He, J. Wu, J. Cheng, X. Zhang, Z. Lv, F. Wang, H. Mei, Knockdown of long noncoding RNA FGFR3- AS1 induces cell proliferation inhibition, apoptosis and motility reduction in bladder cancer, Cancer biomarkers: section A of Disease markers (2017). [22] H. Xie, X. Liao, Z. Chen, Y. Fang, A. He, Y. Zhong, Q. Gao, H. Xiao, J. Li, W. Huang, Y. Liu, LncRNA MALAT1 inhibits apoptosis and promotes invasion by antagonizing miR-125b in bladder Cancer cells, J. Cancer 8 (18) (2017) 3803–3811. [23] Y. Zhan, Y. Li, B. Guan, Z. Wang, D. Peng, Z. Chen, A. He, S. He, Y. Gong, X. Li, L. Zhou, Long non-coding RNA HNF1A-AS1 promotes proliferation and suppresses apoptosis of bladder cancer cells through upregulating Bcl-2, Oncotarget 8 (44) (2017) 76656–76665. [24] P.K. Lo, B. Wolfson, Q. Zhou, Cellular, physiological and pathological aspects of the long non-coding RNA NEAT1, Front. Biol. (Beijing) 11 (6) (2016) 413–426. [25] D. Zhao, Y. Zhang, N. Wang, N. Yu, NEAT1 negatively regulates miR-218 expression and promotes breast cancer progression, Cancer biomarkers: section A of Disease markers 20 (3) (2017) 247–254. [26] S. Li, J. Yang, Y. Xia, Q. Fan, K.P. Yang, LncRNA NEAT1 promotes proliferation and invasion via targeting MiR-181a-5p in non-small cell lung Cancer, Oncol. Res. (2017). [27] L. Fang, J. Sun, Z. Pan, Y. Song, L. Zhong, Y. Zhang, Y. Liu, X. Zheng, P. Huang, Long non-coding RNA NEAT1 promotes hepatocellular carcinoma cell proliferation through the regulation of miR-129-5p-VCP-IkappaB, American journal of physiology, Gastrointestinal and liver physiology 313 (2) (2017) G150–G156. [28] Y. Guo, H. Zhang, D. Xie, X. Hu, R. Song, L. Zhu, Non-coding RNA NEAT1/miR-2143p contribute to doxorubicin resistance of urothelial bladder cancer preliminary through the Wnt/beta-catenin pathway, Cancer Manag. Res. 10 (2018) 4371–4380. [29] M. Cesana, D. Cacchiarelli, I. Legnini, T. Santini, O. Sthandier, M. Chinappi, A. Tramontano, I. Bozzoni, A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA, Cell 147 (2) (2011) 358–369. [30] C. Yang, D. Wu, L. Gao, X. Liu, Y. Jin, D. Wang, T. Wang, X. Li, Competing endogenous RNA networks in human cancer: hypothesis, validation, and perspectives, Oncotarget 7 (12) (2016) 13479–13490. [31] L. Chen, J. Zhang, Y. Feng, R. Li, X. Sun, W. Du, X. Piao, H. Wang, D. Yang, Y. Sun, X. Li, T. Jiang, C. Kang, Y. Li, C. Jiang, MiR-410 regulates MET to influence the proliferation and invasion of glioma, Int. J. Biochem. Cell Biol. 44 (11) (2012) 1711–1717. [32] Y.F. Zhang, Y. Yu, W.Z. Song, R.M. Zhang, S. Jin, J.W. Bai, H.B. Kang, X. Wang, X.C. Cao, miR-410-3p suppresses breast cancer progression by targeting Snail, Oncol. Rep. 36 (1) (2016) 480–486. [33] R. Guo, J. Gu, Z. Zhang, Y. Wang, C. Gu, MicroRNA-410 functions as a tumor suppressor by targeting angiotensin II type 1 receptor in pancreatic cancer, IUBMB Life 67 (1) (2015) 42–53. [34] M.E. Bianchi, A.A. Manfredi, High-mobility group box 1 (HMGB1) protein at the crossroads between innate and adaptive immunity, Immunol. Rev. 220 (2007) 35–46. [35] S. Muller, P. Scaffidi, B. Degryse, T. Bonaldi, L. Ronfani, A. Agresti, M. Beltrame, M.E. Bianchi, New EMBO members’ review: the double life of HMGB1 chromatin protein: architectural factor and extracellular signal, EMBO J. 20 (16) (2001) 4337–4340. [36] Y. Moriwaka, Y. Luo, H. Ohmori, K. Fujii, N. Tatsumoto, T. Sasahira, H. Kuniyasu, HMGB1 attenuates anti-metastatic defense of the lymph nodes in colorectal cancer, Pathobiology: journal of immunopathology, Mol. Cell. Biol. 77 (1) (2010) 17–23. [37] P.L. Liu, J.R. Tsai, J.J. Hwang, S.H. Chou, Y.J. Cheng, F.Y. Lin, Y.L. Chen, C.Y. Hung, W.C. Chen, Y.H. Chen, I.W. Chong, High-mobility group box 1-mediated matrix metalloproteinase-9 expression in non-small cell lung cancer contributes to tumor cell invasiveness, Am. J. Respir. Cell Mol. Biol. 43 (5) (2010) 530–538. [38] S. Li, C. Luo, J. Zhou, Y. Zhang, MicroRNA-34a directly targets high-mobility group box 1 and inhibits the cancer cell proliferation, migration and invasion in cutaneous squamous cell carcinoma, Exp. Ther. Med. 14 (6) (2017) 5611–5618. [39] Y. Yang, J.Q. Huang, X. Zhang, L.F. Shen, MiR-129-2 functions as a tumor suppressor in glioma cells by targeting HMGB1 and is down-regulated by DNA methylation, Mol. Cell. Biochem. 404 (1-2) (2015) 229–239. [40] J. Luo, J. Chen, H. Li, Y. Yang, H. Yun, S. Yang, X. Mao, LncRNA UCA1 promotes the invasion and EMT of bladder cancer cells by regulating the miR-143/HMGB1 pathway, Oncol. Lett. 14 (5) (2017) 5556–5562. [41] H. Jiang, X. Hu, H. Zhang, W. Li, Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression, Radiat. Oncol. 12 (1) (2017) 65. [42] D. Suren, H.T. Yildirim, I. Atalay, A. Sayiner, M. Yildirim, A.S. Alikanoglu, C. Sezer, HMGB1 expression in urothelial carcinoma of the bladder, J. BUON 23 (6) (2018) 1882–1886. [43] W. Wang, H. Zhu, H. Zhang, L. Zhang, Q. Ding, H. Jiang, Targeting HMGB1 inhibits bladder cancer cells bioactivity by lentivirus-mediated RNA interference, Neoplasma 61 (6) (2014) 638–646.
All data are available upon request. Author contribution Guang Shan and Hui-Jun Qian conceived and designed the study. Tian Tang performed the experiments. Yue Xia collected the data and did the analysis. Guang Shan wrote the manuscript. All of the authors approved the final proof. Funding None. Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgements None. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2) (2015) 87–108. [2] R. Chou, S.S. Selph, D.I. Buckley, K.S. Gustafson, J.C. Griffin, S.E. Grusing, J.L. Gore, Treatment of muscle-invasive bladder cancer: a systematic review, Cancer 122 (6) (2016) 842–851. [3] M. Racioppi, D. D’Agostino, A. Totaro, F. Pinto, E. Sacco, A. D’Addessi, F. Marangi, G. Palermo, P.F. Bassi, Value of current chemotherapy and surgery in advanced and metastatic bladder cancer, Urol. Int. 88 (3) (2012) 249–258. [4] A. Ghasemzadeh, T.J. Bivalacqua, N.M. Hahn, C.G. Drake, New strategies in bladder Cancer: a second coming for immunotherapy, Clinical cancer research: an official journal of the American Association for Cancer Research 22 (4) (2016) 793–801. [5] E. Suer, N. Hamidi, M.I. Gokce, O. Gulpinar, K. Turkolmez, Y. Beduk, S. Baltaci, Significance of second transurethral resection on patient outcomes in muscle-invasive bladder cancer patients treated with bladder-preserving multimodal therapy, World J. Urol. 34 (6) (2016) 847–851. [6] T.R. Mercer, M.E. Dinger, J.S. Mattick, Long non-coding RNAs: insights into functions, Nature reviews, Genetics 10 (3) (2009) 155–159. [7] A. Fatica, I. Bozzoni, Long non-coding RNAs: new players in cell differentiation and development, Nature reviews, Genetics 15 (1) (2014) 7–21. [8] S.R. Sheng, J.S. Wu, Y.L. Tang, X.H. Liang, Long noncoding RNAs: emerging regulators of tumor angiogenesis, Future Oncol. 13 (17) (2017) 1551–1562. [9] S.W. Cheetham, F. Gruhl, J.S. Mattick, M.E. Dinger, Long noncoding RNAs and the genetics of cancer, Br. J. Cancer 108 (12) (2013) 2419–2425. [10] Y. Hu, C. Deng, H. Zhang, J. Zhang, B. Peng, C. Hu, Long non-coding RNA XIST promotes cell growth and metastasis through regulating miR-139-5p mediated Wnt/beta-catenin signaling pathway in bladder cancer, Oncotarget 8 (55) (2017) 94554–94568. [11] P. Guo, G. Zhang, J. Meng, Q. He, Z. Li, Y. Guan, Upregulation of long non-coding RNA TUG1 promotes bladder cancer cell 5 proliferation, migration and invasion by inhibiting miR-29c, Oncol. Res. (2018). [12] X. Zhai, W. Xu, Long noncoding RNA ATB promotes proliferation, migration and invasion in bladder cancer by suppressing microRNA-126, Oncol. Res. (2018). [13] X. Jiang, Y. Zhou, A.J. Sun, J.L. Xue, NEAT1 contributes to breast cancer progression through modulating miR-448 and ZEB1, J. Cell. Physiol. (2018). [14] W. Xiong, C. Huang, H. Deng, C. Jian, C. Zen, K. Ye, Z. Zhong, X. Zhao, L. Zhu, Oncogenic non-coding RNA NEAT1 promotes the prostate cancer cell growth through the SRC3/IGF1R/AKT pathway, Int. J. Biochem. Cell Biol. 94 (2018) 125–132. [15] F. Wu, Q. Mo, X. Wan, J. Dan, H. Hu, NEAT1/has-mir-98-5p/MAPK6 axis is involved in non-small-cell lung cancer (NSCLC) development, J. Cell. Biochem. (2017). [16] L.A. Macfarlane, P.R. Murphy, MicroRNA: Biogenesis, Function and Role in Cancer, Curr. Genomics 11 (7) (2010) 537–561. [17] B.N. Davis-Dusenbery, A. Hata, MicroRNA in Cancer: the involvement of aberrant MicroRNA biogenesis regulatory pathways, Genes Cancer 1 (11) (2010) 1100–1114. [18] H.T. Liu, P. Gao, The roles of microRNAs related with progression and metastasis in human cancers, Tumour biology: the journal of the International Society for
8
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Long non-coding RNA NEAT1 promotes bladder progression through regulating miR-410 mediated HMGB1
T
Guang Shana,*, Tian Tangb, Yue Xiaa, Hui-Jun Qiana a b
Department of Urology, Renmin Hospital of Wuhan University, Wuhan, Hubei, China Department of Oncology, Renmin Hospital of Wuhan University, Wuhan, Hubei, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Bladder cancer Noncoding RNA NEAT1 miR-410 HMGB1
LncRNA NEAT1 is reported as a crucial oncogene in multiple cancers. But, its biological role in bladder cancer is barely understood. Therefore, we concentrated on the function and role of NEAT1 in bladder cancer. Firstly, NEAT1 expression in bladder cancer cells was determined and it was displayed NEAT1 was significant elevated. NEAT1 was knockdown and overexpressed in T24 and J82 cells. Then it was indicated that NEAT1 silence greatly inhibited bladder cancer cell proliferation with an increased ratio of apoptotic cells and severe cell cycle arrest. Overexpression of NEAT1 exhibited a reversed process in bladder cancer cells. Additionally, in vivo experiments were employed using establishment of nude mice models. NEAT1 knockdown inhibited bladder cancer growth while increase of NEAT1 promoted bladder cancer development in vivo. By employing the bioinformatics analysis, we speculated that miR-410 was as a downstream target of NEAT1. Then, the targeting association between them was proved in our research and we implicated miR-410 was dramatically restrained in bladder cancer cells. Meanwhile, it was exhibited that miR-410 was negatively regulated by NEAT1. Apart from these, HMGB1 was speculated as a downstream target of miR-410. Dual-luciferase reporter assay was used to prove the correlation between miR-410 and HMGB1. Up-regulation of miR-410 restrained HMGB1 levels and NEAT1 can regulate HMGB1 level via sponging miR-410. To sum up, we implied NEAT1/miR-410/HMGB1 axis participated in bladder cancer.
1. Introduction Bladder cancer is a common urological malignant tumor worldwide [1]. Surgery and chemotherapy are still the effective strategies to treat bladder cancer [2]. Despite great improvements have been made in bladder cancer, its five-year overall survival rate is still unsatisfactory [3–5]. Herein, investigating the possible mechanisms of bladder cancer is greatly significant. As well established, lncRNAs are non-coding RNAs with over 200nts [6]. They are involved in a various biological processes [7,8]. Many reports have reported lncRNAs can exert crucial roles in diseases, especially in a variety of cancers [9]. Various lncRNAs can participate in the development of bladder cancer. XIST promotes bladder cancer progression through sponging miR-139-5p [10]. Up-regulation of TUG1 can promote bladder cancer cell development by sponging miR-29c [11]. LncRNA ATB induces bladder cancer progression via suppressing miR-126 [12]. NEAT1 has been reported to contribute to several cancers. For example, it can promote the progression of breast cancer through modulating miR-448/ZEB1 axis [13]. NEAT1 is able to
⁎
promote prostate cancer development via targeting SRC3/IGF1R/AKT [14]. NEAT1 is involved in NSCLC development by modulating miR-98 and MAPK6 [15]. The detailed effect of NEAT1 in bladder cancer progression remains poorly explored. Meanwhile, via binding with the 3′-UTR of mRNA, microRNAs can modulate their targeting genes [16]. MicroRNAs are able to play a crucial role in cancer development as exhibited by the increasing evidences [17,18]. Moreover, lncRNAs can demonstrate their roles via various mechanisms and lncRNAs may function as miRNAs sponges, which can modulate their regulatory effects on mRNAs [19]. Increasing evidence has indicated the interplay between miRNAs and lncRNAs in tumorigenesis. By using informatics analysis, miR-410 was predicted as the target of NEAT1. The interplay between NEAT1 and miR-410 is barely known in the development of bladder cancer.In the current study, we hypothesized NEAT1 regulated HMGB1 levels via sponging miR-410 and targeting HMGB1 in bladder cancer progression.
Corresponding author. E-mail address: [email protected] (G. Shan).
https://doi.org/10.1016/j.biopha.2019.109248 Received 21 May 2019; Received in revised form 18 July 2019; Accepted 18 July 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
2.5. Flow cytometry analysis
Table 1 Primers for real-time PCR.
GAPDH U6 NEAT1 HMGB1 miR-410
Forward (5’-3’)
Reverse (5’-3’)
AAGAAGGTGGTGAAGCAGGC ATTGGAACGATACAGAGAAGATT TGGCTAGCTCAGGGCTTCAG TGCAGATGACAAGCAGCCTT GAGCAGCATTGTACAG
GTCAAAGGTGGAGGAGTGGG GGAACGCTTCACGAATTTG TCTCCTTGCCAAGCTTCCTTC GCTGCATCAGGCTTTCCTTT GTGCAGG GTCCGAGGT
Firstly, all the cells were digested and 1 × 105 cells per mL of suspended cells were harvested. 100 μL 1 × Annexin buffer was used to suspend the cells. Afterwards, Annexin V-FITC was employed to do the marking. Five μL Annexin V and one μL PI were utilized to stain the cells. Then, they were mixed and incubated for 15 min. Next, 400 μL 1× buffer was added. Subsequently, to analyze the cell apoptosis, FACScan® flow cytometer was employed.
2. Materials and methods
2.6. Cell cycle assay
2.1. Cell culture
70% cold anhydrous ethanol was employed to fix the cells. Then, the cells were treated with PI (Sigma, St. Louis, MO, USA) with RNase A. In order to detect the cell cycle distribution, Flow cytometer equipped with Cell Quest software was utilized.
Human uroepithelial cell line (SV-HUC-1), human bladder cancer cell lines (T24, EJ, UMUC3, J82, HT1376) and HEK-293 T cells were obtained from the Cell Bank of the Chinese Academy of Sciences. RPMI1640 medium added with 10% FBS, 100 μg/ml streptomycin and 100U/ ml penicillin (Gibco, Carlsbad, CA, USA) was utilized to culture all the cells. A humidified 5% CO2 incubator at 37 °C was used.
2.7. qRT-PCR To extract total RNA, Trizol reagent was used. Then, total RNA was reverse transcribed to cDNA by using the PrimeScript RT Reagent Kit with gDNA Eraser. SYBR Green PCR Kit (TaKaRaBio Technology, Dalian, China) was employed to carry out qRT-PCR on the ABI 7900 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA). The primers used in this study were listed in Table 1.
2.2. Lentiviral vector transfection PCR was employed to amplify the full-length cDNA of human NEAT1. pcDNA3.1 (GenePharma, Shanghai, China) was employed to clone the objective products. Lentivirus packaging vectors (pMD2.G) and the constructed vectors were co-transfected for 48 h. Cells were transfected with lentivirus, added with 8 μg/mL polybrene.
2.8. Luciferase activity assay The WT or MUT NEAT1 was sub-cloned into pGL3 Basic vector (Promega, Madison, WI, USA). MiR-410 mimics were co-transfected with 10 μg pLUC-WT-NEAT1 or pLUC-MUT-NEAT1. Luciferase activity was tested using the Multimode Detector reporter assay system (Beckman Coulter, WI, USA). The WT or MUT-HMGB1 was sub-cloned into pGL3 Basic vector in a similar way.
2.3. CCK8 assay Bladder cancer cells were grown on a 96-well plate for a whole night. After the transfection for two days, CCK-8 reagent was used to incubate the cells for 1 h. Afterwards, a microplate reader was utilized to assess the absorbance at 450 nm.
2.9. RIP assay RIP experiment was conducted using Magna RIP Kit (EMD Millipore, Billerica, MA, USA). NP-40 lysis buffer was added to obtain the cell lysate. Afterwards, cell lysate was treated with RIP buffer containing magnetic beads bound with human anti-Ago2 antibody or normal mouse IgG (Millipore, Billerica, MA, USA).
2.4. EdU assay Bladder cancer cells were plated in 96-well plates for a whole night. After transfection, the EdU Cell Proliferation Assay Kit (Ribobio, Guangzhou, China) was employed to detect the cell proliferation. Cells were treated with 50μM EdU. 1 μg/ml DAPI was employed to stain the cell nuclei. The EdU positive cells were determined under fluorescence microscopy.
2.10. RNA pull-down assay RNAs were labeled using Pierce RNA 3′End Desthiobiotinylation Kit
Fig. 1. Expression of NEAT1 in bladder cancer cells. (A) NEAT1 expression in SV-HUC-1, T24, EJ, UMUC3, J82 and HT1376 cells. qRT-PCR was used to detect NEAT1 expression using GAPDH as a control. (B) NEAT1 expression in T24 cells. T24 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. (C) NEAT1 expression in J82 cells. J82 cells were infected with LVshNEAT1, LV-NEAT1 or LV-NC for 48 h. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05. 2
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 2. Effects of NEAT1 on bladder cancer cell proliferation. (A–B) Effects of NEAT1 on the cell proliferation of C33A cells. Cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. EdU assay was used to detect cell proliferation. The integral optical density (IOD) values of cells transfected with control plasmids were normalized to 100%. (C–D) Effects of NEAT1 on the bladder cancer cell survival. CCK8 assay indicated the cell survival of T24 and J82 cells. (E) Cell survival was calculated as the mean ± SEM at 24 h after cultivation. Data of cells treated with control plasmids was normalized to 100%. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
2.12. Animal studies
(Thermo Fisher Scientific, Waltham, MA, USA). Cells were incubated with miR-410-Bio, miR-410-Bio-mut or NC-Bio.
BALB/c nude mice were purchased from Shanghai Animal Laboratory Center. Briefly, the mice were injected with 5 × 106 parental T24/J82 cells, T24/J82 infected with LV-shNEAT1 or LV-NEAT1 in the front dorsum. After two weeks, every three days, the tumor sizes were recorded. The study was conducted under the requirements in the Guide for the Care and Use of Laboratory Animals of the NIH. The study protocol was approved by the ethic committee of Renmin Hospital of Wuhan University.
2.11. Western blot The cell lysate with the protease inhibitor PMSF was added into cells. The lysate was centrifuged at 12,000 r/min for 20 min. Then, we took the supernatant and the total protein concentration was detected by the BCA method (Pierce, Rockford, IL, USA). 50ug total protein were loaded on 10% SDS-PAGE gel to do electrophoresis. Then, PVDF membrane was used. Then the membranes were blocked in the skimmed milk for 2 h. After washed by TBST for 6 times every 10 min, the membrane was maintained with specific primary antibodies for a whole night at 4 °C. Next, the corresponding secondary antibodies were used. Finally, the membranes were analyzed using ECL detection kit (Applygen, Beijing, China).
2.13. Statistical analysis Statistical data analysis was done using GraphPad Prism 6.0. Afterwards, statistical analysis was carried out using Student’s unpaired two-tailed t-test or one-way analysis of variance. Statistical significance was significant with the p-value less than 0.05. 3
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 3. NEAT1 affected bladder cancer cell apoptosis and cell cycle. (A)Effects of NEAT1 on the cell apoptosis in T24 and J82 cells. Cells were infected with LV-shNEAT1 or LV-NEAT1 for 48 h. Flow cytometry assay was used to analyze the cell apoptosis. (B) Effects of NEAT1 on the cell cycle in T24 and J82 cells. Cells were infected with LV-shNEAT1 or LV-NEAT1 for 48 h. Flow cytometry assay was conducted to analyze the cell cycle. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
3. Results
3.2. NEAT1 affected bladder cancer cell proliferation
3.1. Upregulation of NEAT1 in bladder cancer cells
Here, in our current study, we exhibited that NEAT1 knockdown suppressed bladder cancer cell proliferation while NEAT1 overexpression induced bladder cancer cell proliferation (Fig. 2A and 2B). In addition, CCK8 assay was used and we found LV-shNEAT1 inhibited cell survival and LV-NEAT1 promoted cell growth (Fig. 2C, 2D and 2E). These indicated inhibition of NEAT1 can inhibit bladder cancer cell proliferation.
Firstly, to detect the level of NEAT1 in bladder cancer, we used qRTPCR. As demonstrated, NEAT1 expression in five bladder cancer cells including T24, EJ, UMUC3, J82 and HT1376 cells was dramatically elevated (Fig. 1A). Next, to study the further roles of NEAT1 in bladder cancers, T24 and J82 cells were chosen for our further research. T24 and J82 cells were infected with LV-shNEAT1, LV-NEAT1 or their negative control for two days. We found that NEAT1 was silenced by LVshNEAT1 and greatly overexpressed by LV-NEAT1 in T24 and J82 cells (Fig. 1B). These suggested the NEAT1 was involved in bladder cancer progression.
3.3. Inhibition of NEAT1 triggered bladder cancer cell apoptosis and blocked cell cycle progression Moreover, cell apoptosis was increased by LV-shNEAT1 and inhibited by LV-NEAT1 in Fig. 3A. In Fig. 3B, it was implied that NEAT1 knockdown for 48 h was able to increase cell ratios in G1 phase and reduced cell ratios in S phase. This indicated that NEAT1 inhibition 4
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 4. The effect of NEAT1 deletion and overexpression on bladder tumor growth in vivo. (A–B) The tumor subcutaneously transplanted into the right groin of BALB/C nude mice with T24 or J82 cells was stripping out (A) and the weight was measured (B) (n = 8). Tumor weight was normalized to control plasmid group. (C) Immunohistochemistry staining of Ki-67 in tumor tissues. Ki-67 positive cells were normalized to control plasmid group. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
Fig. 5. MiR-410 was a direct target of NEAT1. (A)The binding regions between NEAT1 and miR-410. (B) The luciferase reporter constructs with the wild type (WT-NEAT1) or mutant NEAT1 (MUT-NEAT1). (C) WT-NEAT1 or MUT-NEAT1 was co-transfected into HEK-293 T cells with miR-410 mimics or their negative controls. (D) The correlation between NEAT1 and Ago2 was assessed by RIP assay in T24 cells. Cellular lysates were immunoprecipitated using Ago2 antibody or IgG. (E) RNA pull-down assay indicated the direct interaction between miR-410 and NEAT1. Cellular lysates were pulled down using biotinylated control (NC-Bio), miR-410 (miR-410-Bio), or miR-410 probe containing mutations in the NEAT1-binding site (miR-410-Bio-mut). Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05, **P < 0.01, ***P < 0.001.
blocked the cell cycle progression while NEAT1 overexpression had a reverse phenomenon. These implied NEAT1 silence increased cell apoptosis and triggered cell arrest.
3.4. The effect of NEAT1 deletion and overexpression on bladder tumor growth in vivo T24 and J82 cell nude mouse xenograft model was used to determine if NEAT1 silence inhibited bladder cancer progression in vivo.
5
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 6. NEAT1 modulated miR-410 expression negatively in vitro and in vivo. (A)miR-410 expression in SV-HUC-1, T24, EJ, UMUC3, J82 and HT1376 cells. qRT-PCR was used to detect miR-410 expression using U6 as a control. (B) miR-410 expression in J82 cells. J82 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. (C) miR-410 expression in T24 cells. T24 cells were infected with LVshNEAT1, LV-NEAT1 or LV-NC for 48 h. (D) Expression of miR-410 in the T24 cell nude mouse xenograft model. (E) Expression of miR-410 in the J82 cell nude mouse xenograft model. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. * *P < 0.05, **P < 0.01.
manifested in Fig. 7A and 7B. Co-transfection of the luciferase reporter plasmid containing WT-HMGB1 with miR-410 mimics caused an inhibited reporter activity (Fig. 7C). In addition, HMGB1 was remarkably inhibited by miR-410 mimics in T24 and J82 cells (Fig. 7D). In Fig. 7E and 7 F, HMGB1 levels were down-regulated by NEAT1 deletion and up-regulated by NEAT1 overexpression. These findings indicated NEAT1 regulated bladder cancer development through regulating miR410 and HMGB1.
Eight mice were injected with parental T24/J82 cells. The other eight were injected with T24/J82 infected with LV-shNEAT1 or LV-NEAT1. Tumors were exhibited in Fig. 4A. NEAT1 inhibition greatly inhibited tumor weight while NEAT1 overexpression increased tumor weight as shown in Fig. 4B. In addition, the IHC data revealed Ki-67 was repressed by LV-shNEAT1 whereas reversed by LV-NEAT1 (Fig. 4C). These suggested deletion of NEAT1 could inhibit bladder tumor growth in vivo. 3.5. NEAT1 can sponge miR-410 in vitro
4. Discussion
Currently, the correlation between NEAT1 and miR-410 was exhibited in Fig. 5A. Dual luciferase reporter assay was conducted (Fig. 5B). The luciferase reporter plasmid containing the WT-NEAT1 with miR-410 mimics were co-transfected and a decreased reporter activity was demonstrated (Fig. 5C). NEAT1 and miR-410 were much more enriched in Ago2 pellet (Fig. 5D). RNA pull-down assay with miR410-bio probe induced the level of NEAT1 than NC-bio or miR-410 probes (Fig. 5E). These implied miR-410 might be a target of NEAT1.
Here, our current work focused on a comprehensive study of the functional role of NEAT1 and its ceRNA mechanism via modulating miR-410 and HMGB1 in bladder cancer progression. Firstly, we found NEAT1 was greatly elevated while miR-410 was inhibited in bladder cancer cells. Lack of NEAT1 repressed the bladder cancer development while NEAT1 overexpression induced it. Meanwhile, NEAT1 can modulate miR-410 levels negatively. The negative association between NEAT1 and miR-410 was also proved. HMGB1 was predicted as a downstream target of miR-410 and miR-410 mimics repressed HMGB1 in vitro. During this research, we highlighted the significance of the ceRNA mechanism in regulating the oncogenic role of NEAT1, which could facilitate our understanding of the internal RNA regulatory networks and contribute a lot to the therapeutic progress for bladder cancer. Bladder cancer exhibits altered expression of some lncRNAs [20]. LncRNAs are implicated in carcinogenesis and can act as potent biomarkers for bladder cancer.For instance,knockdown of lncRNA FGFR3AS1 can inhibit bladder cancer development [21]. LncRNA MALAT1 can reduce bladder cancer cell apoptosis and promote invasion by inhibiting miR-125b [22]. LncRNA HNF1A-AS1 can induce bladder cancer cell proliferation and repress apoptosis by up-regulating Bcl-2 [23]. In addition, NEAT1 exerts an oncogenic role in many cancer [24].
3.6. NEAT1 regulated miR-410 expression negatively miR-410 was obviously decreased in bladder cancer cells (Fig. 6A). Meanwhile, LV-shNEAT1 can increase miR-410 levels while LV-NEAT1 inhibit miR-410 in bladder cancer cells (Fig. 6B and 6C). Furthermore, miR-410 in the T24 and J82 cell nude mouse xenograft models were also increased by NEAT1 deletion and decreased by NEAT1 overexpression (Fig. 6D and 6E). These manifested NEAT1 can regulate miR-410 levels negatively. 3.7. MiR-410 targeted HMGB1 Moreover, WT-HMGB1 and MUT-HMGB1 binding sites were 6
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Fig. 7. HMGB1 was a downstream target of miR-410. (A) The binding regions between HMGB1 and miR-410. (B) The luciferase reporter constructs containing the wild type (WT-HMGB1) or mutant HMGB1 (MUTHMGB1) sequence. (C) WT-HMGB1 or MUT-HMGB1 was co-transfected into HEK-293 T cells with miR-410 mimics or their negative controls. (D) Expression of HMGB1 in T24 and J82 cells. Cells were transfected with miR-410 mimics or their negative controls. (E) Expression of HMGB1 in T24 cells. T24 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. (F) Expression of HMGB1 in J82 cells. J82 cells were infected with LV-shNEAT1, LV-NEAT1 or LV-NC for 48 h. Three independent experiments were carried out. Error bars stand for the mean ± SD of at least triplicate experiments. *P < 0.05.
interplay between NEAT1 and miR-410 was proved. HMGB1 belongs to HMGB family members. It can act as a signaling molecule in the various biological processes [34,35]. Additionally, HMGB1 can play a crucial role in many cancers. In colorectal cancer, HMGB1 represses anti-metastatic defense of lymph nodes [36]. HMGB1-mediated MMP-9 contributes to NSCLC cell invasiveness [37]. MiR-34a inhibits cancer cell development in cutaneous squamous cell carcinoma through directly targeting HMGB1 [38]. MiR-129-2 plays tumor suppressive roles via inhibiting HMGB1 in glioma [39]. In addition, lncRNA UCA1 can promote bladder cancer cell invasion and EMT via regulating miR-143 and HMGB1 [40]. LncRNA TUG1 downregulation can enhance radio-sensitivity in bladder cancer through inhibiting HMGB1 [41]. Previously, it has been reported that HMGB1 expression was significantly higher in bladder cancer patients [42]. Targeting HMGB1 can greatly inhibit bladder cancer cells bioactivity through lentivirus-mediated RNA interference [43]. Here, we predicted HMGB1 as a downstream target for miR-410 in bladder cancer. Then, we validated the correlation between miR-410 and HMGB1. MiR-410 mimics repressed HMGB1 expression greatly. Additionally, we reported that NEAT1 modulated HMGB1 levels through sponging miR-410. In conclusion, it was implied that NEAT1 exhibited a tumor oncogenic role in bladder cancer. We implied NEAT1/miR-410/HMGB1 axis was responsible for the progression of bladder cancer.
For instance, NEAT1 can promote breast cancer development through negatively regulating miR-218 [25]. NEAT1 can promote NSCLC progression via targeting miR-181a-5p [26]. NEAT1 induces hepatocellular carcinoma cell proliferation by regulating miR-129-5p [27]. Herein, in our current study, we confirmed that NEAT1 was highly up-regulated in bladder cancer. Previous studies report that NEAT1 possessed oncogenic roles in bladder cancer. NEAT1 is involved in the oncogenesis, early detection, and prognosis of bladder cancer. In addition, NEAT1/ miR-214-3p can contribute to doxorubicin resistance of urothelial bladder cancer via activating Wnt/β-catenin pathway [28]. Here, we found silence of NEAT1 restrained bladder cancer progression. Reversely, NEAT1 overexpression demonstrated an oncogenic role in bladder cancer. Emerging evidences have indicated the existence of a ceRNA interaction network that lncRNAs can act as molecular sponges to inhibit miRNAs and remove them off their binding sites on the targeting mRNAs [29,30]. Herein we predicted that miR-410 might bind to NEAT1. MiR-410 functions a lot in several human cancers. For example, in glioma, miR-410 inhibits glioma proliferation and invasion though regulating MET [31]. MiR-410 can suppress breast cancer progression by inhibiting Snail [32]. MiR-410 can serve as a tumor suppressor via regulating angiotensin II type 1 receptor in pancreatic cancer [33]. However, the effect of miR-410 in bladder cancer was poorly explored. Currently, we predicted NEAT1 targeted miR-410. In bladder cancer cells, we validated that miR-410 was significantly reduced. The 7
Biomedicine & Pharmacotherapy 121 (2020) 109248
G. Shan, et al.
Data availability statement
Oncodevelopmental Biology and Medicine (2016). [19] G. Militello, T. Weirick, D. John, C. Doring, S. Dimmeler, S. Uchida, Screening and validation of lncRNAs and circRNAs as miRNA sponges, Brief. Bioinformatics 18 (5) (2017) 780–788. [20] M. Taheri, M.D. Omrani, S. Ghafouri-Fard, Long non-coding RNA expression in bladder cancer, Biophys. Rev. (2017). [21] X. Liao, J. Chen, Y. Liu, A. He, J. Wu, J. Cheng, X. Zhang, Z. Lv, F. Wang, H. Mei, Knockdown of long noncoding RNA FGFR3- AS1 induces cell proliferation inhibition, apoptosis and motility reduction in bladder cancer, Cancer biomarkers: section A of Disease markers (2017). [22] H. Xie, X. Liao, Z. Chen, Y. Fang, A. He, Y. Zhong, Q. Gao, H. Xiao, J. Li, W. Huang, Y. Liu, LncRNA MALAT1 inhibits apoptosis and promotes invasion by antagonizing miR-125b in bladder Cancer cells, J. Cancer 8 (18) (2017) 3803–3811. [23] Y. Zhan, Y. Li, B. Guan, Z. Wang, D. Peng, Z. Chen, A. He, S. He, Y. Gong, X. Li, L. Zhou, Long non-coding RNA HNF1A-AS1 promotes proliferation and suppresses apoptosis of bladder cancer cells through upregulating Bcl-2, Oncotarget 8 (44) (2017) 76656–76665. [24] P.K. Lo, B. Wolfson, Q. Zhou, Cellular, physiological and pathological aspects of the long non-coding RNA NEAT1, Front. Biol. (Beijing) 11 (6) (2016) 413–426. [25] D. Zhao, Y. Zhang, N. Wang, N. Yu, NEAT1 negatively regulates miR-218 expression and promotes breast cancer progression, Cancer biomarkers: section A of Disease markers 20 (3) (2017) 247–254. [26] S. Li, J. Yang, Y. Xia, Q. Fan, K.P. Yang, LncRNA NEAT1 promotes proliferation and invasion via targeting MiR-181a-5p in non-small cell lung Cancer, Oncol. Res. (2017). [27] L. Fang, J. Sun, Z. Pan, Y. Song, L. Zhong, Y. Zhang, Y. Liu, X. Zheng, P. Huang, Long non-coding RNA NEAT1 promotes hepatocellular carcinoma cell proliferation through the regulation of miR-129-5p-VCP-IkappaB, American journal of physiology, Gastrointestinal and liver physiology 313 (2) (2017) G150–G156. [28] Y. Guo, H. Zhang, D. Xie, X. Hu, R. Song, L. Zhu, Non-coding RNA NEAT1/miR-2143p contribute to doxorubicin resistance of urothelial bladder cancer preliminary through the Wnt/beta-catenin pathway, Cancer Manag. Res. 10 (2018) 4371–4380. [29] M. Cesana, D. Cacchiarelli, I. Legnini, T. Santini, O. Sthandier, M. Chinappi, A. Tramontano, I. Bozzoni, A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA, Cell 147 (2) (2011) 358–369. [30] C. Yang, D. Wu, L. Gao, X. Liu, Y. Jin, D. Wang, T. Wang, X. Li, Competing endogenous RNA networks in human cancer: hypothesis, validation, and perspectives, Oncotarget 7 (12) (2016) 13479–13490. [31] L. Chen, J. Zhang, Y. Feng, R. Li, X. Sun, W. Du, X. Piao, H. Wang, D. Yang, Y. Sun, X. Li, T. Jiang, C. Kang, Y. Li, C. Jiang, MiR-410 regulates MET to influence the proliferation and invasion of glioma, Int. J. Biochem. Cell Biol. 44 (11) (2012) 1711–1717. [32] Y.F. Zhang, Y. Yu, W.Z. Song, R.M. Zhang, S. Jin, J.W. Bai, H.B. Kang, X. Wang, X.C. Cao, miR-410-3p suppresses breast cancer progression by targeting Snail, Oncol. Rep. 36 (1) (2016) 480–486. [33] R. Guo, J. Gu, Z. Zhang, Y. Wang, C. Gu, MicroRNA-410 functions as a tumor suppressor by targeting angiotensin II type 1 receptor in pancreatic cancer, IUBMB Life 67 (1) (2015) 42–53. [34] M.E. Bianchi, A.A. Manfredi, High-mobility group box 1 (HMGB1) protein at the crossroads between innate and adaptive immunity, Immunol. Rev. 220 (2007) 35–46. [35] S. Muller, P. Scaffidi, B. Degryse, T. Bonaldi, L. Ronfani, A. Agresti, M. Beltrame, M.E. Bianchi, New EMBO members’ review: the double life of HMGB1 chromatin protein: architectural factor and extracellular signal, EMBO J. 20 (16) (2001) 4337–4340. [36] Y. Moriwaka, Y. Luo, H. Ohmori, K. Fujii, N. Tatsumoto, T. Sasahira, H. Kuniyasu, HMGB1 attenuates anti-metastatic defense of the lymph nodes in colorectal cancer, Pathobiology: journal of immunopathology, Mol. Cell. Biol. 77 (1) (2010) 17–23. [37] P.L. Liu, J.R. Tsai, J.J. Hwang, S.H. Chou, Y.J. Cheng, F.Y. Lin, Y.L. Chen, C.Y. Hung, W.C. Chen, Y.H. Chen, I.W. Chong, High-mobility group box 1-mediated matrix metalloproteinase-9 expression in non-small cell lung cancer contributes to tumor cell invasiveness, Am. J. Respir. Cell Mol. Biol. 43 (5) (2010) 530–538. [38] S. Li, C. Luo, J. Zhou, Y. Zhang, MicroRNA-34a directly targets high-mobility group box 1 and inhibits the cancer cell proliferation, migration and invasion in cutaneous squamous cell carcinoma, Exp. Ther. Med. 14 (6) (2017) 5611–5618. [39] Y. Yang, J.Q. Huang, X. Zhang, L.F. Shen, MiR-129-2 functions as a tumor suppressor in glioma cells by targeting HMGB1 and is down-regulated by DNA methylation, Mol. Cell. Biochem. 404 (1-2) (2015) 229–239. [40] J. Luo, J. Chen, H. Li, Y. Yang, H. Yun, S. Yang, X. Mao, LncRNA UCA1 promotes the invasion and EMT of bladder cancer cells by regulating the miR-143/HMGB1 pathway, Oncol. Lett. 14 (5) (2017) 5556–5562. [41] H. Jiang, X. Hu, H. Zhang, W. Li, Down-regulation of LncRNA TUG1 enhances radiosensitivity in bladder cancer via suppressing HMGB1 expression, Radiat. Oncol. 12 (1) (2017) 65. [42] D. Suren, H.T. Yildirim, I. Atalay, A. Sayiner, M. Yildirim, A.S. Alikanoglu, C. Sezer, HMGB1 expression in urothelial carcinoma of the bladder, J. BUON 23 (6) (2018) 1882–1886. [43] W. Wang, H. Zhu, H. Zhang, L. Zhang, Q. Ding, H. Jiang, Targeting HMGB1 inhibits bladder cancer cells bioactivity by lentivirus-mediated RNA interference, Neoplasma 61 (6) (2014) 638–646.
All data are available upon request. Author contribution Guang Shan and Hui-Jun Qian conceived and designed the study. Tian Tang performed the experiments. Yue Xia collected the data and did the analysis. Guang Shan wrote the manuscript. All of the authors approved the final proof. Funding None. Declaration of Competing Interest The authors declare that there are no conflicts of interest. Acknowledgements None. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2) (2015) 87–108. [2] R. Chou, S.S. Selph, D.I. Buckley, K.S. Gustafson, J.C. Griffin, S.E. Grusing, J.L. Gore, Treatment of muscle-invasive bladder cancer: a systematic review, Cancer 122 (6) (2016) 842–851. [3] M. Racioppi, D. D’Agostino, A. Totaro, F. Pinto, E. Sacco, A. D’Addessi, F. Marangi, G. Palermo, P.F. Bassi, Value of current chemotherapy and surgery in advanced and metastatic bladder cancer, Urol. Int. 88 (3) (2012) 249–258. [4] A. Ghasemzadeh, T.J. Bivalacqua, N.M. Hahn, C.G. Drake, New strategies in bladder Cancer: a second coming for immunotherapy, Clinical cancer research: an official journal of the American Association for Cancer Research 22 (4) (2016) 793–801. [5] E. Suer, N. Hamidi, M.I. Gokce, O. Gulpinar, K. Turkolmez, Y. Beduk, S. Baltaci, Significance of second transurethral resection on patient outcomes in muscle-invasive bladder cancer patients treated with bladder-preserving multimodal therapy, World J. Urol. 34 (6) (2016) 847–851. [6] T.R. Mercer, M.E. Dinger, J.S. Mattick, Long non-coding RNAs: insights into functions, Nature reviews, Genetics 10 (3) (2009) 155–159. [7] A. Fatica, I. Bozzoni, Long non-coding RNAs: new players in cell differentiation and development, Nature reviews, Genetics 15 (1) (2014) 7–21. [8] S.R. Sheng, J.S. Wu, Y.L. Tang, X.H. Liang, Long noncoding RNAs: emerging regulators of tumor angiogenesis, Future Oncol. 13 (17) (2017) 1551–1562. [9] S.W. Cheetham, F. Gruhl, J.S. Mattick, M.E. Dinger, Long noncoding RNAs and the genetics of cancer, Br. J. Cancer 108 (12) (2013) 2419–2425. [10] Y. Hu, C. Deng, H. Zhang, J. Zhang, B. Peng, C. Hu, Long non-coding RNA XIST promotes cell growth and metastasis through regulating miR-139-5p mediated Wnt/beta-catenin signaling pathway in bladder cancer, Oncotarget 8 (55) (2017) 94554–94568. [11] P. Guo, G. Zhang, J. Meng, Q. He, Z. Li, Y. Guan, Upregulation of long non-coding RNA TUG1 promotes bladder cancer cell 5 proliferation, migration and invasion by inhibiting miR-29c, Oncol. Res. (2018). [12] X. Zhai, W. Xu, Long noncoding RNA ATB promotes proliferation, migration and invasion in bladder cancer by suppressing microRNA-126, Oncol. Res. (2018). [13] X. Jiang, Y. Zhou, A.J. Sun, J.L. Xue, NEAT1 contributes to breast cancer progression through modulating miR-448 and ZEB1, J. Cell. Physiol. (2018). [14] W. Xiong, C. Huang, H. Deng, C. Jian, C. Zen, K. Ye, Z. Zhong, X. Zhao, L. Zhu, Oncogenic non-coding RNA NEAT1 promotes the prostate cancer cell growth through the SRC3/IGF1R/AKT pathway, Int. J. Biochem. Cell Biol. 94 (2018) 125–132. [15] F. Wu, Q. Mo, X. Wan, J. Dan, H. Hu, NEAT1/has-mir-98-5p/MAPK6 axis is involved in non-small-cell lung cancer (NSCLC) development, J. Cell. Biochem. (2017). [16] L.A. Macfarlane, P.R. Murphy, MicroRNA: Biogenesis, Function and Role in Cancer, Curr. Genomics 11 (7) (2010) 537–561. [17] B.N. Davis-Dusenbery, A. Hata, MicroRNA in Cancer: the involvement of aberrant MicroRNA biogenesis regulatory pathways, Genes Cancer 1 (11) (2010) 1100–1114. [18] H.T. Liu, P. Gao, The roles of microRNAs related with progression and metastasis in human cancers, Tumour biology: the journal of the International Society for
8