- Email: [email protected]
Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells Peng Xia a, b, Pan Liu a, b, Qiang Fu a, Chuanjiang Liu a, Qiankun Luo a, Xu Zhang a, Liyou Cheng a, Tao Qin a, Hongwei Zhang a, * a Department of Hepato-Biliary-Pancreatic Surgery, People’s Hospital of Zhengzhou University, Henan Provincial People’s Hospital, Zhengzhou, People’s Republic of China b Translational Research Institute Integrative Research Hub, Henan Provincial People’s Hospital, Zhengzhou, People’s Republic of China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 October 2019 Accepted 25 November 2019 Available online xxx
Pancreatic cancer (PC) is a fatal disease; most patients are asymptomatic before the disease enters the advanced stage, but molecular mechanisms of early PC that can be exploited for diagnosis are not clear. Long noncoding RNAs (lncRNAs) play key roles in the progression of PC. In this study, we found that the expression of the lncRNA EPIC1 (Lnc-EPIC1) is high in PC and closely related to tumor size, TNM staging and lymph node metastasis status. Silencing Lnc-EPIC1 by siRNA targeting could significantly inhibit the cell growth and colony formation ability of PC cells and induced G1/S cell cycle arrest and apoptosis in PC cells. Lnc-EPIC1-specific siRNAs could downregulate the expression of cyclins and CDKs, such as CDC20, CDK4 and Cyclin A1. Knocking out YAP1 with the CRISPR/Cas-9 gene editing method recapitulated the effects of the Lnc-EPIC1-specific siRNAs on cell growth, colony formation ability and apoptosis in PC cells. In addition, the Lnc-EPIC1-specific siRNAs did not further inhibit cell growth or promote apoptosis in YAP1-knockout (YAP1-KO) cells. RNA immunoprecipitation (RIP) results showed that there was a direct interaction between Lnc-EPIC1 and YAP1. An Lnc-EPIC1-overexpressing lentiviral vector promoted the growth of PC cells. The results show that Lnc-EPIC1 interacts with YAP1 to promote the progression of PC. © 2019 Elsevier Inc. All rights reserved.
Keywords: Long noncoding RNA EPIC1 YAP1 Pancreatic cancer Cell growth Apoptosis
1. Introduction The incidence and mortality of pancreatic cancer (PC) are increasing annually and PC is expected to be the second leading cause of cancer deaths in some countries [1,2]. The prognosis of PC patients ranked last among all cancer patients, with patients exhibiting a 5-year survival rate below 2%e9% [2]. The increase in incidence is more pronounced in developed countries than in developing countries, which may be associated with smoking and obesity [3,4]. Although progress has been made in surgical treatment with chemotherapy or radiotherapy, there has been no significant improvement in the survival rate of patients with PC [3,5]. The main reason for the low overall survival rate is the lack of an understanding of the complex molecular mechanisms involved in
* Corresponding author. Department of Hepato-Biliary-Pancreatic Surgery, People’s Hospital of Zhengzhou University, Henan Provincial People’s Hospital, No. 7 Weiwu Road, Jinshui District, Zhengzhou, 450000, Henan, People’s Republic of China. E-mail address: [email protected] (H. Zhang).
the progression of PC, including cell physiological changes, cell growth and apoptosis signaling dysfunction [6,7]. At present, there is no screening method for PC. It is very important for the prevention and treatment of PC to elucidate the biological and molecular mechanisms of initiation, occurrence and antiapoptotic signaling in PC [8]. Long noncoding RNAs (lncRNAs) are stable noncoding RNAs that have a length greater than 200 nucleotides and play important roles in promoting and suppressing cancer [9]. Increasingly indepth study has found that various lncRNAs form a very large regulatory network and directly regulate various life processes at various levels, such as the epigenetic and pre-and posttranscriptional levels [10]. In the occurrence and development of tumors, lncRNAs can be used as a special target or marker. The lncRNA EPIC1 (ENSG00000224271, Lnc-EPIC1) is highly expressed in human PC cells [11]. Recently, the roles of Lnc-EPIC1 in lung cancer, cholangiocarcinoma and osteosarcoma have been proven, providing us with the theoretical basis of the function of Lnc-EPIC1 [12e14]. However, the carcinogenic role of Lnc-EPIC1 in PC is still unclear. In this study, we investigated for the first time how Lnc-
https://doi.org/10.1016/j.bbrc.2019.11.167 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
2
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
EPIC1 affects the development of PC by interacting with YAP1.
2. Materials and methods 2.1. Tissue samples and clinical data Thirty-five samples of PC tissue and normal pancreatic tissue were taken from fresh frozen tissues collected during surgical resection at Henan Provincial People’s Hospital (Zhengzhou, China, from April 2017 to April 2019). All tissue samples were confirmed to be pancreatic adenocarcinoma by hematoxylin-eosin (HE) staining and immunohistochemistry. The normal pancreatic tissue samples were taken from the margin of the tumor tissue (>5 cm from the lesion), and no patients were treated with radiotherapy or chemotherapy before surgery. The study was approved by the Ethics Committee of the People’s Hospital of Zhengzhou University, and all patients signed an informed consent form.
2.4. Cell transfection Logarithmic growth phase cells were seeded in 6-well plates (NEST, Wuxi, China) and cultured for 24 h. Lnc-EPIC1-specific siRNAs (10 mL) were transfected into the cells in each well, and the medium was changed after 6e8 h of routine culture. Detection of Lnc-EPIC1 expression by qRT-PCR was performed after 24 h of incubation. 2.5. CCK-8 assay Cells were seeded in a 96-well plate (NEST), and a cell counter (Nexcelom, Lawrence, Massachusetts, USA) was used to count 2000 cells per well. In total, 10 mL of CCK-8 solution (Meilunbio, Dalian, China) was added to each well, the plate was protected from light while incubating for 2 h in an incubator, and the absorbance at 450 nm (OD450 nm) was measured on a microplate reader; this time point was considered 0 days. Measurements were repeated every 24 h and counted as day 1, day 2, day 3. The above procedure was repeated to measure OD450 nm values at different times.
2.2. Cells and culture 2.6. Colony formation assay Human normal pancreatic cells (HPDE) and PC cells (SW1990 and HPAFII) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). SW1990 cells were cultured in DMEM (Solarbio, Beijing, China) containing 12% FBS (BI, Kibbutz Beit Haemek, Israel), HPAFII cells were cultured in minimal essential medium (MEM; Solarbio) containing 10% FBS (Gibco, Grand Island, NY, USA), and HPDE cells were cultured in DMEM (Gibco) containing 10% FBS (BI).
2.3. Quantitative real-time polymerase chain reaction (qRT-PCR) PC and normal pancreatic tissue samples were processed by using a rapid tissue cell disruption instrument (JY96-IIN, SCIENTZ, Ningbo, China). Total RNA was extracted from the tissue samples by using a tissue RNA extraction kit (Solarbio). Total cellular RNA was extracted by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Then, the isolated RNAs were reverse transcribed into cDNA using the Goldenstar RT6 cDNA Synthesis Kit (Qingke, Wuhan, China), followed by qRT-PCR analysis using 2 T5 Fast qPCR Mix (SYBR Green I, Qingke) on the Fast Real-time PCR 7500 System (ThermoFisher). Relative expression was normalized to GAPDH expression and calculated according to the 2-△△Ct method. All the primers are listed in Table 1.
Table 1 Primer sequences, siRNAs and sgRNA used in this study.
siRNA 1 siRNA 2 siRNA 3 YAP1 YAP1 sgRNA CDC20 CDK4 Cyclin A1 GAPDH
2.7. Flow cytometry Cells were seeded in 6-well plates (NEST) at a density of 1 105 cells/ml. After siRNA transfection, the cells were allowed to attach for 24 h. Without EDTA-trypsin digestion (Solarbio), the cells were washed 2 times with PBS (Gibco), and the BD FACSAria III Cell Sorter (BD, Franklin Lake, New Jersey, USA) was used to detect the cell apoptosis rate and cell cycle distribution. 2.8. Western blotting Cells were lysed using a RIPA lysis buffer (Solarbio), and total protein was extracted from the cells. The protein concentration was determined by the BCA method. Protein samples (40 mg) were electrophoresed by SDS-PAGE (Beyotime, Shanghai, China) and transferred to a Bio Trace PVDF membrane (PALL, Beijing, China). The membrane was blocked in 10% milk and incubated with the appropriate primary antibody (CST, Danvers, MA, US) overnight. A corresponding HRP-labeled secondary antibody (CST) was added the next day. Protein expression was measured using an ECL detection kit (Sigma), and band intensity was quantified using ImageJ (NIH, Bethesda, Maryland, USA).
Sequence (50 -30 )
Primer name Lnc-EPIC1
Cells were seeded in 6-well plates (NEST) at a density of 1 103 cells and cultured for 14 days. Then colonies were fixed with precooled formaldehyde. A cell counter was used for counting the colonies after 30 min of crystal violet staining.
F R
F R F R F R F R F R
TATCCCTCAGAGCTCCTGCT AGGCTGGCAAGTGTGAATCT CCUUCAGACUGUCUUUGAA GCUUUCUCUCGGAAACGUG UAACGCCUAGGCCAAACAC CAGGTTGGGAGATGGCAAAG TGTTGTCTGATCGATGTGATTTAAGA CATCAGATCGTGCACGTCCG CGCTATATCCCCCATCGCAG CTGATAACCCTCTGGCGCAT ATGGCTACCTCTCGATATGAGC CATTGGGGACTCTCACACTCT GTCACCACATACTATGGACATG AAGTTTTCCTCTCAGCACTGAC GGTGAAGGTCGGAGTCAACG TGGGTGGAATCATATTGGAACA
2.9. RNA immunoprecipitation (RIP) PC cells were collected, and a RIP assay was performed using an RNA kit (Millipore, Shang Hai, China). A clarified cell lysate was incubated with an anti-YAP1 antibody. The RNA was isolated, qRTPCR and Western blotting was used to test the expression of LncEPIC1. IgG was used as a negative control for standardization. 2.10. YAP1 knockout (YAP1-KO) YAP1 was knocked out in SW1990 cells using CRISPR-Cas9 technology. Screening was performed to determine the best leader sequence YAP1-sgRNA for the first exon of the YAP1 gene. The YAP1-sgRNA was ligated to the vector. Using Lipofectamine
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2000 reagent (Thermo Fisher Scientific), the construct was transfected into SW1990 cells. After screening for 48 h with puromycin, the tumor cells were grown in a monoclonal group, and a 24-well plate (NEST) was inoculated to expand the culture. The expression of YAP1 was verified by qRT-PCR. 2.11. Lnc-EPIC1 overexpression The full-length Lnc-EPIC1 cDNA was PCR amplified and cloned into a vector to generate an Lv-EPIC1 construct. Then, SW1990 cells and YAP1-KO cells were transfected with Lv-EPIC1 to induce overexpression. Puromycin-selected cells with Lnc-EPIC1 overexpression were verified by qRT-PCR. 2.12. Statistical analysis Data are expressed as the mean ± standard deviation (SD) and were analyzed with SPSS 22.0 (SPSS 20.0, Chicago, IL) statistical software. Mean comparisons were performed using one-way analysis of variance. Correlation analyses were performed using the t2 test. P < 0.05 was considered statistically significant. 3. Results 3.1. Bioinformatic analysis of YAP1 function As a key transcriptional cofactor in the Hippo pathway, YAP1 is a key factor upstream of MYC that plays an important role in the development of PC [15]. We found a strong correlation between YAP1 and Lnc-EPIC1 by the catRAPID algorithm (Fig. 1A), and the possible binding sites of YAP1 and Lnc-EPIC1 are located at 600 bp and 1300 bp (Fig. 1B). The Gene Expression Profiling Interactive Analysis (GEPIA) tool was used to analyze TCCA-LIHC data, which showed that the expression of YAP1 was relatively high in PC (Fig. 1C). The patients with high expression of YAP1 had poor overall survival and a high tumor stage (Fig. 1B and D). 3.2. High expression of Lnc-EPIC1 in PC cells First, we examined the expression of Lnc-EPIC1 in PC cells (SW1990 and HPAFII) and normal pancreatic cells (HPDE). qRT-PCR results showed that Lnc-EPIC1 expression was significantly increased in the SW1990 cells and HPAFII cells compared to the HPDE cells (Fig. 1F). Western blotting results showed that YAP1 was highly expressed in the SW1990 cells and HPAFII cells (Fig. 1G).
3
PC cell activity (Fig. 2C and D). Colony formation results showed that reduced Lnc-EPIC1 expression significantly inhibited the colony formation ability of PC cells (Fig. 2E and F). Apoptosis assay results showed a significant increase in the apoptosis rate of LncEPIC1-downregulated PC cells (Fig. 2G and H). These results indicate that Lnc-EPIC1 promotes PC progression by promoting cell growth and inhibiting apoptosis. 3.5. YAP1 is a target of Lnc-EPIC1 According to the literature, MYC is the main target of Lnc-EPIC1, and this interaction has been proven in lung cancer and cholangiocarcinoma [11e13]. MYC is also a downstream target of YPA1 in PC [15,16]. Cell cycle experiments showed that knocking down Lnc-EPIC1 expression increased the percentage of G0/G1 PC cells and induced G1/S cell cycle arrest (Fig. 3A). Therefore, we verified the expression of several cyclin mRNAs in PC cells. qRT-PCR showed that Lnc-EPIC1 siRNA treatment significantly inhibited CDC20, CDK4 and Cyclin A1 (Fig. 3B). To verify whether Lnc-EPIC1 and YPA1 are directly linked in PC, we performed a RIP assay and showed the direct interaction of YPA1 and Lnc-EPIC1 in SW1990 cells (Fig. 3C). Next, we used the CRISPR-Cas9 system to establish YAP1-KO SW1990 cells, and qRT-PCR results confirmed a significant decrease in YAP1 mRNA expression (Fig. 3D). Importantly, the YAP1-KO cells exhibited decreased cell growth (Fig. 3E) and colony formation ability (Fig. 3F) and an increased apoptosis rate (Fig. 3G). However, transfection of Lnc-EPIC1-specific siRNAs into YAP1-KO cells did not enhance these changes. These findings indicate that YAP1 is a target of Lnc-EPIC1 in PC. 3.6. Lnc-EPIC1 overexpression promotes the growth of PC cells and inhibits apoptosis To revalidate the functions of Lnc-EPIC1, we constructed LncEPIC1-overexpressing SW1990 cells and YAP1-KO cells using two lentiviral expression constructs (Lv-EPIC1-1 and Lv-EPIC1-2). qRTPCR results verified that Lnc-EPIC1 expression was significantly increased (Fig. 4A, Fig. 4B). Lv-EPIC1-1 promoted SW1990 cell growth (Fig. 4C) and colony formation ability (Fig. 4E). However, it did not affect the growth (Fig. 4D) or colony formation ability of YAP1-KO cells (Fig. 4F). These results fully demonstrate that LncEPIC1 interacts directly with YPA1 to promote tumor cell growth. Notably, overexpression of Lnc-EPIC1 did not further inhibit apoptosis in either SW1990 cells or YAP1-KO cells (Fig. 4G and H). 4. Discussion
3.3. High expression of Lnc-EPIC1 in PC tissue samples Nest, we examined the expression of Lnc-EPIC1 in PC tissue. qRT-PCR results showed that Lnc-EPIC1 was highly expressed in human PC tissue samples. In addition, we analyzed the correlations between case data and Lnc-EPIC1, and the results showed that LncEPIC1 expression was significantly associated with tumor grade, TNM staging and lymph node metastasis status (Table 2). In addition, Western blotting results showed that the protein expression of YAP1 was significantly increased in the PC tissue samples (Fig. 1H). 3.4. Lnc-EPIC1-specific siRNAs inhibit PC cell growth and promotes apoptosis We used three siRNAs to specifically knock down Lnc-EPIC1 expression and transfected the siRNAs into SW1990 and HPAFII cells. As shown, siRNA1 and siRNA2 significantly reduced the expression of Lnc-EPIC1 (Fig. 2A, Fig. 2B). CCK-8 assay results showed that reduced Lnc-EPIC1 expression significantly inhibited
PC is a complex and highly lethal disease, and recent studies have found that genetic changes in multiple lncRNAs, such as HOTAIR, MALAT1, NORAD, PVT1, are involved in the development and progression of PC [17e19]. The regulatory mechanisms and functions of lncRNAs are complex. LncRNAs are involved in normal processes of cell cytology and tumorigenesis, such as cell adaptation, differentiation, proliferation, and cell pluripotency maintenance. They play important roles in the development, progression, apoptosis suppression and prognosis of PC [20]. Our study found that Lnc-EPIC1 plays a key role in the progression of PC. Lnc-EPIC1 is highly expressed in PC. In addition, case data showed that Lnc-EPIC1 was associated with tumor stage, TNM staging and lymph node metastasis status in patients with PC. In cell experiments, we verified that Lnc-EPIC1 was more highly expressed in PC cells than in normal pancreatic cells. After inhibiting Lnc-EPIC1, PC cell growth and colony formation ability were significantly inhibited, and cell cycle arrest and apoptosis were induced. These results indicate that Lnc-EPIC1 may promote tumor
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
4
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. Lnc-EPIC1 expression is upregulated in PC cells. (A) catRAPID from the UniprotKB database showed that the Lnc-EPIC1 and YAP1 association has a high degree of confidence. (B) Lnc-EPIC1 and YAP1 binding regions are located at 600 bp and 1300 bp. (C) TCCA-LIHC data from GEPIA showed that YAP1 expression was elevated in PC and that (D) the overall survival rate was significantly worse for the patients with high YAP1 expression than those with low expression, while (E) the tumor stage of the patients with high YAP1 expression was high. (F) The expression of Lnc-EPIC1 in PC cells (SW1990 and HPAFII) and normal pancreatic cells (HPDE) was determined by qRT-PCR; ***P < 0.005. (G, H) Western blotting detected that the protein levels of YAP1 in PC cells and tissue samples were higher than those in normal pancreatic cells and tissue samples, respectively.
Table 2 Correlation between clinicopathological features and lncRNA EPIC1 expression in PC tumor tissues. Characteristic
Sex Male Female Age <60 60 Tumor size 4 cm >4 cm TNM staging I-II III-IV Lymph node metastasis Absent Present
n
LncRNA EPIC1 in tumor tissues High
Low
x±s
13 17
9 11
4 6
3.24 ± 0.27 3.47 ± 0.34
12 18
7 14
5 4
3.52 ± 0.37 3.27 ± 0.29
14 16
5 15
9 1
2.93 ± 0.28 4.41 ± 0.31
16 14
7 12
9 2
2.78 ± 0.31 4.05 ± 2.89
13 17
8 12
5 5
2.60 ± 0.37 3.93 ± 0.26
P value
0.623
0.590
0.002
0.004
0.003
* The expression of EPIC1 were compared between the tumor tissue and the normal tissue.
progression by promoting cell growth and reducing apoptosis and that Lnc-EPIC1 is expected to be a valuable therapeutic target and diagnostic marker in PC. According to reports, YAP1 is almost absent in normal
pancreatic acinar cell, but is highly expressed in PC [16]. In addition, an increase in YAP1 expression is associated with the proliferation of PC cells and antiapoptotic processes, and the loss of YAP1 strongly inhibits the expression of MYC [15,21]. Data analysis with GEPIA tool showed that YAP1 was highly expressed in patients with PC and that the overall survival rate of the patients with high expression of YAP1 was poor, while their tumor stage was relatively advanced. Our experiments demonstrate that YAP1 is highly expressed in PC cells and PC tissues. YAP1 maintains the expression of MYC, and knocking out YAP1 causes a profound downregulation of MYC expression, leading to growth arrest and apoptosis [15,22,23]. In addition, the relationship between Lnc-EPIC1 and MYC in lung cancer [12] and cholangiocarcinoma [13] and the relationship between Lnc-EPIC1 and MEF2D in osteosarcoma have been demonstrated [14]. Our study demonstrates for the first time that Lnc-EPIC1 interacts with YAP1 in PC cells. Bioinformatic predictions showed a strong correlation between Lnc-EPIC1 and YAP1 in PC and predicted that the binding sites were concentrated near 600 bp and 1300 bp. RIP verified the direct binding of Lnc-EPIC1 and YAP1. Lnc-EPIC1-specific siRNAs can significantly reduce the levels of the downstream molecules CDC20, CDK4 and Cyclin A1, which may be responsible for the G1/S cell cycle arrest and the increased percentage of G0/G1 cells observed. These results provide insights for further studies of Lnc-EPIC1-related signaling networks and may help develop new treatments to reduce the incidence of recurrence. After
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. Knocking down Lnc-EPIC1 expression inhibits PC cell growth. Lnc-EPIC1-specific siRNAs were transfected into PC cells; Ctrl indicates untransfected cells, and Scr-siRNA indicates cells transfected with nonsense sequences. (A, B) qRT-PCR examined the mRNA levels of Lnc-EPIC1 in siRNA-transfected SW1990 cells and HPAFII cells. (C, D) CCK-8 assay results showed that downregulation of Lnc-EPIC1 expression inhibited PC cell growth. (E, F) Colony formation assay results validated the CCK-8 assay conclusion. (G, H) After Lnc-EPIC1 was inhibited, the apoptosis rate of PC cells increased. *p < 0.05, **p < 0.01, ***p < 0.001, and ns indicates no difference.
YAP1 was knocked out with CRISPR-Cas9 technology, Lnc-EPIC1 lost its roles in promoting proliferation and growth and inhibiting apoptosis in PC cells. Finally, we overexpressed Lnc-EPIC1 in PC cells, which increased the growth and proliferation of the PC cells, but overexpression of Lnc-EPIC1 in YAP1-KO PC cells did not produce the
same effects. Our research has a number of limitations, including the limited number of patients with PC, and it is difficult to rule out type II errors. In addition, we studied only the relationships between Lnc-EPIC1 and cell cycle-related pathways and may have missed other signaling
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
6
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 3. YAP1 is a target of Lnc-EPIC1 in PC cells. (A) FACS was used to analyze the cell cycle distribution of Lnc-EPIC1 siRNA-transfected SW1990 cells. (B) The mRNA expression of CDC20, CDK4 and Cyclin A1, and YAP1 was determined by qRT-PCR. (C) qRT-PCR was used to analyze Lnc-EPIC1 enriched by YAP1 protein in SW1990 cells, Western blotting of YAP1IP is shown PCR product, and the Lnc-EPIC1 qRT-PCR results were normalized to the GAPDH results. (D) YAP1-KO cell mRNA levels were examined by qRT-PCR. (E) Cells growth, (F) colony formation and (G) apoptosis were examined in YAP1-KO cells and SW1990 cells. *p < 0.05, **p < 0.01, ***p < 0.001, and ns indicates no difference.
pathways that have not yet been discovered. Overexpression of LncEPIC1 did not further reduce the apoptosis rate of PC cells, which may be related to antagonism of SOX2, but further bioinformatic studies are required to solve this problem. In summary, Lnc-EPIC1 is highly expressed in PC and regulates the progression of PC by targeting YAP1, which impacts the downstream molecules CDC20, CDK4 and Cyclin A1.
Author contributions All listed authors contributed to the study. Declaration of competing interest We declare that we have no financial and personal relationships
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Fig. 4. Lnc-EPIC1 overexpression promotes PC cell growth. Construction of SW1990 cells and YAP1-KO cells stably overexpressing Lnc-EPIC1. (A, B) The mRNA level of Lnc-EPIC1 was detected by qRT-PCR. (C, D) Cell growth, (E, F) colony formation and (G, H) apoptosis were evaluated in Lnc-EPIC1-overexpressing cells. *p < 0.05, **p < 0.01, ***p < 0.001, and ns indicates no difference.
with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled“Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells”. Peng Xia, Pan Liu, Qiang Fu, Chuanjiang Liu, Qiankun Luo, Xu Zhang, Liyou Cheng, Tao Qin and Hongwei Zhang. Acknowledgments The authors thank all participants involved in the study. This work was supported by the National Natural Science Foundation of China (31671440) and the Major Science and Technology Project of Henan Province (2018020421). References [1] W.M. Hackeng, R.H. Hruban, G.J. Offerhaus, L.A. Brosens, Surgical and molecular pathology of pancreatic neoplasms, Diagn. Pathol. 11 (2016) 47, https:// doi.org/10.1186/s13000-016-0497-z. [2] A. McGuigan, P. Kelly, R.C. Turkington, C. Jones, H.G. Coleman, R.S. McCain, Pancreatic cancer: a review of clinical diagnosis, epidemiology, treatment and outcomes, World J. Gastroenterol. 24 (2018) 4846e4861, https://doi.org/ 10.3748/wjg.v24.i43.4846. [3] C.L. Wolfgang, J.M. Herman, D.A. Laheru, A.P. Klein, M.A. Erdek, E.K. Fishman, R.H. Hruban, Recent progress in pancreatic cancer, CA A Cancer J. Clin. 63 (2013) 318e348, https://doi.org/10.3322/caac.21190. [4] Q. Zhang, L. Zeng, Y. Chen, G. Lian, C. Qian, S. Chen, J. Li, K. Huang, Pancreatic Cancer Epidemiology, Detection, and Management, Gastroenterology Research and Practice 2016, 2016, p. 8962321, https://doi.org/10.1155/2016/ 8962321. [5] T. Kamisawa, L.D. Wood, T. Itoi, K. Takaori, Pancreatic cancer, The Lancet 388 (2016) 73e85, https://doi.org/10.1016/s0140-6736(16)00141-0.
[6] Y. Li, X. Yang, X. Kang, S. Liu, The regulatory roles of long noncoding RNAs in the biological behavior of pancreatic cancer, Saudi J. Gastroenterol. : official journal of the Saudi Gastroenterology Association 25 (2019) 145e151, https:// doi.org/10.4103/sjg.SJG_465_18. [7] M. Felsenstein, R.H. Hruban, L.D. Wood, New developments in the molecular mechanisms of pancreatic tumorigenesis, Adv. Anat. Pathol. 25 (2018) 131e142, https://doi.org/10.1097/PAP.0000000000000172. [8] A. Kladi-Skandali, K. Michaelidou, A. Scorilas, K. Mavridis, Long noncoding RNAs in digestive system malignancies: a novel class of cancer biomarkers and therapeutic targets? Gastroenterology research and practice 2015 (2015) 319861, https://doi.org/10.1155/2015/319861. [9] M. Yang, Z. Zhai, S. Guo, X. Li, Y. Zhu, Y. Wang, Long non-coding RNA FLJ33360 participates in ovarian cancer progression by sponging miR-30b-3p, OncoTargets Ther. 12 (2019) 4469e4480, https://doi.org/10.2147/OTT.S205622. [10] C. Jiang, X. Li, H. Zhao, H. Liu, Long non-coding RNAs: potential new biomarkers for predicting tumor invasion and metastasis, Mol. Cancer 15 (2016) 62, https://doi.org/10.1186/s12943-016-0545-z. [11] Z. Wang, B. Yang, M. Zhang, W. Guo, Z. Wu, Y. Wang, L. Jia, S. Li, N. Cancer Genome Atlas Research, W. Xie, D. Yang, lncRNA epigenetic landscape analysis identifies EPIC1 as an oncogenic lncRNA that interacts with MYC and promotes cell-cycle progression in cancer, Cancer Cell 33 (2018) 706e720, https://doi.org/10.1016/j.ccell.2018.03.006. [12] B. Zhang, H.Y. Lu, Y.H. Xia, A.G. Jiang, Y.X. Lv, Long non-coding RNA EPIC1 promotes human lung cancer cell growth, Biochem. Biophys. Res. Commun. 503 (2018) 1342e1348, https://doi.org/10.1016/j.bbrc.2018.07.046. [13] Y. Li, Q. Cai, W. Li, F. Feng, L. Yang, Long non-coding RNA EPIC1 promotes cholangiocarcinoma cell growth, Biochem. Biophys. Res. Commun. 504 (2018) 654e659, https://doi.org/10.1016/j.bbrc.2018.08.174. [14] W. Zhao, D. Zhang, P. Qin, J. Zhang, X. Cui, J. Gao, J. Wang, J. Li, Long noncoding RNA EPIC1 inhibits viability and invasion of osteosarcoma cells by promoting MEF2D ubiquitylation, Int. J. Biol. Macromol. 128 (2019) 566e573, https://doi.org/10.1016/j.ijbiomac.2019.01.156. [15] S. Murakami, I. Nemazanyy, S.M. White, H. Chen, C.D.K. Nguyen, G.T. Graham, D. Saur, M. Pende, C. Yi, A yap-myc-sox2-p53 regulatory network dictates metabolic homeostasis and differentiation in kras-driven pancreatic ductal adenocarcinomas, Dev. Cell 51 (2019) 113e128, https://doi.org/10.1016/ j.devcel.2019.07.022. [16] B. Tu, J. Yao, S. Ferri-Borgogno, J. Zhao, S. Chen, Q. Wang, L. Yan, X. Zhou, C. Zhu, S. Bang, Q. Chang, C.A. Bristow, Y. Kang, H. Zheng, H. Wang, J.B. Fleming, M. Kim, T.P. Heffernan, G.F. Draetta, D. Pan, A. Maitra, W. Yao,
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
8
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
S. Gupta, H. Ying, YAP1 Oncogene Is a Context-specific Driver for Pancreatic Ductal Adenocarcinoma, JCI Insight, 2019, https://doi.org/10.1172/ jci.insight.130811. [17] R.Z. He, D.X. Luo, Y.Y. Mo, Emerging roles of lncRNAs in the posttranscriptional regulation in cancer, Genes & diseases 6 (2019) 6e15, https://doi.org/10.1016/j.gendis.2019.01.003. [18] C. Zheng, Y. Xiao, Y. Li, D. He, Knockdown of long non-coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation, Onco. Lett. 18 (2019) 1225e1234, https://doi.org/10.3892/ol.2019.10450. [19] H. Li, X. Wang, C. Wen, Z. Huo, W. Wang, Q. Zhan, D. Cheng, H. Chen, X. Deng, C. Peng, B. Shen, Long noncoding RNA NORAD, a novel competing endogenous RNA, enhances the hypoxia-induced epithelial-mesenchymal transition to promote metastasis in pancreatic cancer, Mol. Cancer 16 (2017) 169, https:// doi.org/10.1186/s12943-017-0738-0.
[20] D. Neureiter, T. Jager, M. Ocker, T. Kiesslich, Epigenetics and pancreatic cancer: pathophysiology and novel treatment aspects, World J. Gastroenterol. 20 (2014) 7830e7848, https://doi.org/10.3748/wjg.v20.i24.7830. [21] M. Nishimoto, K. Uranishi, M.N. Asaka, A. Suzuki, Y. Mizuno, M. Hirasaki, A. Okuda, Transformation of normal cells by aberrant activation of YAP via cMyc with TEAD, Sci. Rep. 9 (2019) 10933, https://doi.org/10.1038/s41598019-47301-6. [22] miR-375-3pp. suppresses tumorigenesis and partially reverses chemoresistance by targeting YAP1 [PMIDK31543507].pdf>. [23] P. Zhu, Y. Wang, J. Wu, G. Huang, B. Liu, B. Ye, Y. Du, G. Gao, Y. Tian, L. He, Z. Fan, LncBRM initiates YAP1 signalling activation to drive self-renewal of liver cancer stem cells, Nat. Commun. 7 (2016) 13608, https://doi.org/ 10.1038/ncomms13608.
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells Peng Xia a, b, Pan Liu a, b, Qiang Fu a, Chuanjiang Liu a, Qiankun Luo a, Xu Zhang a, Liyou Cheng a, Tao Qin a, Hongwei Zhang a, * a Department of Hepato-Biliary-Pancreatic Surgery, People’s Hospital of Zhengzhou University, Henan Provincial People’s Hospital, Zhengzhou, People’s Republic of China b Translational Research Institute Integrative Research Hub, Henan Provincial People’s Hospital, Zhengzhou, People’s Republic of China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 27 October 2019 Accepted 25 November 2019 Available online xxx
Pancreatic cancer (PC) is a fatal disease; most patients are asymptomatic before the disease enters the advanced stage, but molecular mechanisms of early PC that can be exploited for diagnosis are not clear. Long noncoding RNAs (lncRNAs) play key roles in the progression of PC. In this study, we found that the expression of the lncRNA EPIC1 (Lnc-EPIC1) is high in PC and closely related to tumor size, TNM staging and lymph node metastasis status. Silencing Lnc-EPIC1 by siRNA targeting could significantly inhibit the cell growth and colony formation ability of PC cells and induced G1/S cell cycle arrest and apoptosis in PC cells. Lnc-EPIC1-specific siRNAs could downregulate the expression of cyclins and CDKs, such as CDC20, CDK4 and Cyclin A1. Knocking out YAP1 with the CRISPR/Cas-9 gene editing method recapitulated the effects of the Lnc-EPIC1-specific siRNAs on cell growth, colony formation ability and apoptosis in PC cells. In addition, the Lnc-EPIC1-specific siRNAs did not further inhibit cell growth or promote apoptosis in YAP1-knockout (YAP1-KO) cells. RNA immunoprecipitation (RIP) results showed that there was a direct interaction between Lnc-EPIC1 and YAP1. An Lnc-EPIC1-overexpressing lentiviral vector promoted the growth of PC cells. The results show that Lnc-EPIC1 interacts with YAP1 to promote the progression of PC. © 2019 Elsevier Inc. All rights reserved.
Keywords: Long noncoding RNA EPIC1 YAP1 Pancreatic cancer Cell growth Apoptosis
1. Introduction The incidence and mortality of pancreatic cancer (PC) are increasing annually and PC is expected to be the second leading cause of cancer deaths in some countries [1,2]. The prognosis of PC patients ranked last among all cancer patients, with patients exhibiting a 5-year survival rate below 2%e9% [2]. The increase in incidence is more pronounced in developed countries than in developing countries, which may be associated with smoking and obesity [3,4]. Although progress has been made in surgical treatment with chemotherapy or radiotherapy, there has been no significant improvement in the survival rate of patients with PC [3,5]. The main reason for the low overall survival rate is the lack of an understanding of the complex molecular mechanisms involved in
* Corresponding author. Department of Hepato-Biliary-Pancreatic Surgery, People’s Hospital of Zhengzhou University, Henan Provincial People’s Hospital, No. 7 Weiwu Road, Jinshui District, Zhengzhou, 450000, Henan, People’s Republic of China. E-mail address: [email protected] (H. Zhang).
the progression of PC, including cell physiological changes, cell growth and apoptosis signaling dysfunction [6,7]. At present, there is no screening method for PC. It is very important for the prevention and treatment of PC to elucidate the biological and molecular mechanisms of initiation, occurrence and antiapoptotic signaling in PC [8]. Long noncoding RNAs (lncRNAs) are stable noncoding RNAs that have a length greater than 200 nucleotides and play important roles in promoting and suppressing cancer [9]. Increasingly indepth study has found that various lncRNAs form a very large regulatory network and directly regulate various life processes at various levels, such as the epigenetic and pre-and posttranscriptional levels [10]. In the occurrence and development of tumors, lncRNAs can be used as a special target or marker. The lncRNA EPIC1 (ENSG00000224271, Lnc-EPIC1) is highly expressed in human PC cells [11]. Recently, the roles of Lnc-EPIC1 in lung cancer, cholangiocarcinoma and osteosarcoma have been proven, providing us with the theoretical basis of the function of Lnc-EPIC1 [12e14]. However, the carcinogenic role of Lnc-EPIC1 in PC is still unclear. In this study, we investigated for the first time how Lnc-
https://doi.org/10.1016/j.bbrc.2019.11.167 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
2
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
EPIC1 affects the development of PC by interacting with YAP1.
2. Materials and methods 2.1. Tissue samples and clinical data Thirty-five samples of PC tissue and normal pancreatic tissue were taken from fresh frozen tissues collected during surgical resection at Henan Provincial People’s Hospital (Zhengzhou, China, from April 2017 to April 2019). All tissue samples were confirmed to be pancreatic adenocarcinoma by hematoxylin-eosin (HE) staining and immunohistochemistry. The normal pancreatic tissue samples were taken from the margin of the tumor tissue (>5 cm from the lesion), and no patients were treated with radiotherapy or chemotherapy before surgery. The study was approved by the Ethics Committee of the People’s Hospital of Zhengzhou University, and all patients signed an informed consent form.
2.4. Cell transfection Logarithmic growth phase cells were seeded in 6-well plates (NEST, Wuxi, China) and cultured for 24 h. Lnc-EPIC1-specific siRNAs (10 mL) were transfected into the cells in each well, and the medium was changed after 6e8 h of routine culture. Detection of Lnc-EPIC1 expression by qRT-PCR was performed after 24 h of incubation. 2.5. CCK-8 assay Cells were seeded in a 96-well plate (NEST), and a cell counter (Nexcelom, Lawrence, Massachusetts, USA) was used to count 2000 cells per well. In total, 10 mL of CCK-8 solution (Meilunbio, Dalian, China) was added to each well, the plate was protected from light while incubating for 2 h in an incubator, and the absorbance at 450 nm (OD450 nm) was measured on a microplate reader; this time point was considered 0 days. Measurements were repeated every 24 h and counted as day 1, day 2, day 3. The above procedure was repeated to measure OD450 nm values at different times.
2.2. Cells and culture 2.6. Colony formation assay Human normal pancreatic cells (HPDE) and PC cells (SW1990 and HPAFII) were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China). SW1990 cells were cultured in DMEM (Solarbio, Beijing, China) containing 12% FBS (BI, Kibbutz Beit Haemek, Israel), HPAFII cells were cultured in minimal essential medium (MEM; Solarbio) containing 10% FBS (Gibco, Grand Island, NY, USA), and HPDE cells were cultured in DMEM (Gibco) containing 10% FBS (BI).
2.3. Quantitative real-time polymerase chain reaction (qRT-PCR) PC and normal pancreatic tissue samples were processed by using a rapid tissue cell disruption instrument (JY96-IIN, SCIENTZ, Ningbo, China). Total RNA was extracted from the tissue samples by using a tissue RNA extraction kit (Solarbio). Total cellular RNA was extracted by using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Then, the isolated RNAs were reverse transcribed into cDNA using the Goldenstar RT6 cDNA Synthesis Kit (Qingke, Wuhan, China), followed by qRT-PCR analysis using 2 T5 Fast qPCR Mix (SYBR Green I, Qingke) on the Fast Real-time PCR 7500 System (ThermoFisher). Relative expression was normalized to GAPDH expression and calculated according to the 2-△△Ct method. All the primers are listed in Table 1.
Table 1 Primer sequences, siRNAs and sgRNA used in this study.
siRNA 1 siRNA 2 siRNA 3 YAP1 YAP1 sgRNA CDC20 CDK4 Cyclin A1 GAPDH
2.7. Flow cytometry Cells were seeded in 6-well plates (NEST) at a density of 1 105 cells/ml. After siRNA transfection, the cells were allowed to attach for 24 h. Without EDTA-trypsin digestion (Solarbio), the cells were washed 2 times with PBS (Gibco), and the BD FACSAria III Cell Sorter (BD, Franklin Lake, New Jersey, USA) was used to detect the cell apoptosis rate and cell cycle distribution. 2.8. Western blotting Cells were lysed using a RIPA lysis buffer (Solarbio), and total protein was extracted from the cells. The protein concentration was determined by the BCA method. Protein samples (40 mg) were electrophoresed by SDS-PAGE (Beyotime, Shanghai, China) and transferred to a Bio Trace PVDF membrane (PALL, Beijing, China). The membrane was blocked in 10% milk and incubated with the appropriate primary antibody (CST, Danvers, MA, US) overnight. A corresponding HRP-labeled secondary antibody (CST) was added the next day. Protein expression was measured using an ECL detection kit (Sigma), and band intensity was quantified using ImageJ (NIH, Bethesda, Maryland, USA).
Sequence (50 -30 )
Primer name Lnc-EPIC1
Cells were seeded in 6-well plates (NEST) at a density of 1 103 cells and cultured for 14 days. Then colonies were fixed with precooled formaldehyde. A cell counter was used for counting the colonies after 30 min of crystal violet staining.
F R
F R F R F R F R F R
TATCCCTCAGAGCTCCTGCT AGGCTGGCAAGTGTGAATCT CCUUCAGACUGUCUUUGAA GCUUUCUCUCGGAAACGUG UAACGCCUAGGCCAAACAC CAGGTTGGGAGATGGCAAAG TGTTGTCTGATCGATGTGATTTAAGA CATCAGATCGTGCACGTCCG CGCTATATCCCCCATCGCAG CTGATAACCCTCTGGCGCAT ATGGCTACCTCTCGATATGAGC CATTGGGGACTCTCACACTCT GTCACCACATACTATGGACATG AAGTTTTCCTCTCAGCACTGAC GGTGAAGGTCGGAGTCAACG TGGGTGGAATCATATTGGAACA
2.9. RNA immunoprecipitation (RIP) PC cells were collected, and a RIP assay was performed using an RNA kit (Millipore, Shang Hai, China). A clarified cell lysate was incubated with an anti-YAP1 antibody. The RNA was isolated, qRTPCR and Western blotting was used to test the expression of LncEPIC1. IgG was used as a negative control for standardization. 2.10. YAP1 knockout (YAP1-KO) YAP1 was knocked out in SW1990 cells using CRISPR-Cas9 technology. Screening was performed to determine the best leader sequence YAP1-sgRNA for the first exon of the YAP1 gene. The YAP1-sgRNA was ligated to the vector. Using Lipofectamine
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2000 reagent (Thermo Fisher Scientific), the construct was transfected into SW1990 cells. After screening for 48 h with puromycin, the tumor cells were grown in a monoclonal group, and a 24-well plate (NEST) was inoculated to expand the culture. The expression of YAP1 was verified by qRT-PCR. 2.11. Lnc-EPIC1 overexpression The full-length Lnc-EPIC1 cDNA was PCR amplified and cloned into a vector to generate an Lv-EPIC1 construct. Then, SW1990 cells and YAP1-KO cells were transfected with Lv-EPIC1 to induce overexpression. Puromycin-selected cells with Lnc-EPIC1 overexpression were verified by qRT-PCR. 2.12. Statistical analysis Data are expressed as the mean ± standard deviation (SD) and were analyzed with SPSS 22.0 (SPSS 20.0, Chicago, IL) statistical software. Mean comparisons were performed using one-way analysis of variance. Correlation analyses were performed using the t2 test. P < 0.05 was considered statistically significant. 3. Results 3.1. Bioinformatic analysis of YAP1 function As a key transcriptional cofactor in the Hippo pathway, YAP1 is a key factor upstream of MYC that plays an important role in the development of PC [15]. We found a strong correlation between YAP1 and Lnc-EPIC1 by the catRAPID algorithm (Fig. 1A), and the possible binding sites of YAP1 and Lnc-EPIC1 are located at 600 bp and 1300 bp (Fig. 1B). The Gene Expression Profiling Interactive Analysis (GEPIA) tool was used to analyze TCCA-LIHC data, which showed that the expression of YAP1 was relatively high in PC (Fig. 1C). The patients with high expression of YAP1 had poor overall survival and a high tumor stage (Fig. 1B and D). 3.2. High expression of Lnc-EPIC1 in PC cells First, we examined the expression of Lnc-EPIC1 in PC cells (SW1990 and HPAFII) and normal pancreatic cells (HPDE). qRT-PCR results showed that Lnc-EPIC1 expression was significantly increased in the SW1990 cells and HPAFII cells compared to the HPDE cells (Fig. 1F). Western blotting results showed that YAP1 was highly expressed in the SW1990 cells and HPAFII cells (Fig. 1G).
3
PC cell activity (Fig. 2C and D). Colony formation results showed that reduced Lnc-EPIC1 expression significantly inhibited the colony formation ability of PC cells (Fig. 2E and F). Apoptosis assay results showed a significant increase in the apoptosis rate of LncEPIC1-downregulated PC cells (Fig. 2G and H). These results indicate that Lnc-EPIC1 promotes PC progression by promoting cell growth and inhibiting apoptosis. 3.5. YAP1 is a target of Lnc-EPIC1 According to the literature, MYC is the main target of Lnc-EPIC1, and this interaction has been proven in lung cancer and cholangiocarcinoma [11e13]. MYC is also a downstream target of YPA1 in PC [15,16]. Cell cycle experiments showed that knocking down Lnc-EPIC1 expression increased the percentage of G0/G1 PC cells and induced G1/S cell cycle arrest (Fig. 3A). Therefore, we verified the expression of several cyclin mRNAs in PC cells. qRT-PCR showed that Lnc-EPIC1 siRNA treatment significantly inhibited CDC20, CDK4 and Cyclin A1 (Fig. 3B). To verify whether Lnc-EPIC1 and YPA1 are directly linked in PC, we performed a RIP assay and showed the direct interaction of YPA1 and Lnc-EPIC1 in SW1990 cells (Fig. 3C). Next, we used the CRISPR-Cas9 system to establish YAP1-KO SW1990 cells, and qRT-PCR results confirmed a significant decrease in YAP1 mRNA expression (Fig. 3D). Importantly, the YAP1-KO cells exhibited decreased cell growth (Fig. 3E) and colony formation ability (Fig. 3F) and an increased apoptosis rate (Fig. 3G). However, transfection of Lnc-EPIC1-specific siRNAs into YAP1-KO cells did not enhance these changes. These findings indicate that YAP1 is a target of Lnc-EPIC1 in PC. 3.6. Lnc-EPIC1 overexpression promotes the growth of PC cells and inhibits apoptosis To revalidate the functions of Lnc-EPIC1, we constructed LncEPIC1-overexpressing SW1990 cells and YAP1-KO cells using two lentiviral expression constructs (Lv-EPIC1-1 and Lv-EPIC1-2). qRTPCR results verified that Lnc-EPIC1 expression was significantly increased (Fig. 4A, Fig. 4B). Lv-EPIC1-1 promoted SW1990 cell growth (Fig. 4C) and colony formation ability (Fig. 4E). However, it did not affect the growth (Fig. 4D) or colony formation ability of YAP1-KO cells (Fig. 4F). These results fully demonstrate that LncEPIC1 interacts directly with YPA1 to promote tumor cell growth. Notably, overexpression of Lnc-EPIC1 did not further inhibit apoptosis in either SW1990 cells or YAP1-KO cells (Fig. 4G and H). 4. Discussion
3.3. High expression of Lnc-EPIC1 in PC tissue samples Nest, we examined the expression of Lnc-EPIC1 in PC tissue. qRT-PCR results showed that Lnc-EPIC1 was highly expressed in human PC tissue samples. In addition, we analyzed the correlations between case data and Lnc-EPIC1, and the results showed that LncEPIC1 expression was significantly associated with tumor grade, TNM staging and lymph node metastasis status (Table 2). In addition, Western blotting results showed that the protein expression of YAP1 was significantly increased in the PC tissue samples (Fig. 1H). 3.4. Lnc-EPIC1-specific siRNAs inhibit PC cell growth and promotes apoptosis We used three siRNAs to specifically knock down Lnc-EPIC1 expression and transfected the siRNAs into SW1990 and HPAFII cells. As shown, siRNA1 and siRNA2 significantly reduced the expression of Lnc-EPIC1 (Fig. 2A, Fig. 2B). CCK-8 assay results showed that reduced Lnc-EPIC1 expression significantly inhibited
PC is a complex and highly lethal disease, and recent studies have found that genetic changes in multiple lncRNAs, such as HOTAIR, MALAT1, NORAD, PVT1, are involved in the development and progression of PC [17e19]. The regulatory mechanisms and functions of lncRNAs are complex. LncRNAs are involved in normal processes of cell cytology and tumorigenesis, such as cell adaptation, differentiation, proliferation, and cell pluripotency maintenance. They play important roles in the development, progression, apoptosis suppression and prognosis of PC [20]. Our study found that Lnc-EPIC1 plays a key role in the progression of PC. Lnc-EPIC1 is highly expressed in PC. In addition, case data showed that Lnc-EPIC1 was associated with tumor stage, TNM staging and lymph node metastasis status in patients with PC. In cell experiments, we verified that Lnc-EPIC1 was more highly expressed in PC cells than in normal pancreatic cells. After inhibiting Lnc-EPIC1, PC cell growth and colony formation ability were significantly inhibited, and cell cycle arrest and apoptosis were induced. These results indicate that Lnc-EPIC1 may promote tumor
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
4
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. Lnc-EPIC1 expression is upregulated in PC cells. (A) catRAPID from the UniprotKB database showed that the Lnc-EPIC1 and YAP1 association has a high degree of confidence. (B) Lnc-EPIC1 and YAP1 binding regions are located at 600 bp and 1300 bp. (C) TCCA-LIHC data from GEPIA showed that YAP1 expression was elevated in PC and that (D) the overall survival rate was significantly worse for the patients with high YAP1 expression than those with low expression, while (E) the tumor stage of the patients with high YAP1 expression was high. (F) The expression of Lnc-EPIC1 in PC cells (SW1990 and HPAFII) and normal pancreatic cells (HPDE) was determined by qRT-PCR; ***P < 0.005. (G, H) Western blotting detected that the protein levels of YAP1 in PC cells and tissue samples were higher than those in normal pancreatic cells and tissue samples, respectively.
Table 2 Correlation between clinicopathological features and lncRNA EPIC1 expression in PC tumor tissues. Characteristic
Sex Male Female Age <60 60 Tumor size 4 cm >4 cm TNM staging I-II III-IV Lymph node metastasis Absent Present
n
LncRNA EPIC1 in tumor tissues High
Low
x±s
13 17
9 11
4 6
3.24 ± 0.27 3.47 ± 0.34
12 18
7 14
5 4
3.52 ± 0.37 3.27 ± 0.29
14 16
5 15
9 1
2.93 ± 0.28 4.41 ± 0.31
16 14
7 12
9 2
2.78 ± 0.31 4.05 ± 2.89
13 17
8 12
5 5
2.60 ± 0.37 3.93 ± 0.26
P value
0.623
0.590
0.002
0.004
0.003
* The expression of EPIC1 were compared between the tumor tissue and the normal tissue.
progression by promoting cell growth and reducing apoptosis and that Lnc-EPIC1 is expected to be a valuable therapeutic target and diagnostic marker in PC. According to reports, YAP1 is almost absent in normal
pancreatic acinar cell, but is highly expressed in PC [16]. In addition, an increase in YAP1 expression is associated with the proliferation of PC cells and antiapoptotic processes, and the loss of YAP1 strongly inhibits the expression of MYC [15,21]. Data analysis with GEPIA tool showed that YAP1 was highly expressed in patients with PC and that the overall survival rate of the patients with high expression of YAP1 was poor, while their tumor stage was relatively advanced. Our experiments demonstrate that YAP1 is highly expressed in PC cells and PC tissues. YAP1 maintains the expression of MYC, and knocking out YAP1 causes a profound downregulation of MYC expression, leading to growth arrest and apoptosis [15,22,23]. In addition, the relationship between Lnc-EPIC1 and MYC in lung cancer [12] and cholangiocarcinoma [13] and the relationship between Lnc-EPIC1 and MEF2D in osteosarcoma have been demonstrated [14]. Our study demonstrates for the first time that Lnc-EPIC1 interacts with YAP1 in PC cells. Bioinformatic predictions showed a strong correlation between Lnc-EPIC1 and YAP1 in PC and predicted that the binding sites were concentrated near 600 bp and 1300 bp. RIP verified the direct binding of Lnc-EPIC1 and YAP1. Lnc-EPIC1-specific siRNAs can significantly reduce the levels of the downstream molecules CDC20, CDK4 and Cyclin A1, which may be responsible for the G1/S cell cycle arrest and the increased percentage of G0/G1 cells observed. These results provide insights for further studies of Lnc-EPIC1-related signaling networks and may help develop new treatments to reduce the incidence of recurrence. After
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. Knocking down Lnc-EPIC1 expression inhibits PC cell growth. Lnc-EPIC1-specific siRNAs were transfected into PC cells; Ctrl indicates untransfected cells, and Scr-siRNA indicates cells transfected with nonsense sequences. (A, B) qRT-PCR examined the mRNA levels of Lnc-EPIC1 in siRNA-transfected SW1990 cells and HPAFII cells. (C, D) CCK-8 assay results showed that downregulation of Lnc-EPIC1 expression inhibited PC cell growth. (E, F) Colony formation assay results validated the CCK-8 assay conclusion. (G, H) After Lnc-EPIC1 was inhibited, the apoptosis rate of PC cells increased. *p < 0.05, **p < 0.01, ***p < 0.001, and ns indicates no difference.
YAP1 was knocked out with CRISPR-Cas9 technology, Lnc-EPIC1 lost its roles in promoting proliferation and growth and inhibiting apoptosis in PC cells. Finally, we overexpressed Lnc-EPIC1 in PC cells, which increased the growth and proliferation of the PC cells, but overexpression of Lnc-EPIC1 in YAP1-KO PC cells did not produce the
same effects. Our research has a number of limitations, including the limited number of patients with PC, and it is difficult to rule out type II errors. In addition, we studied only the relationships between Lnc-EPIC1 and cell cycle-related pathways and may have missed other signaling
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
6
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 3. YAP1 is a target of Lnc-EPIC1 in PC cells. (A) FACS was used to analyze the cell cycle distribution of Lnc-EPIC1 siRNA-transfected SW1990 cells. (B) The mRNA expression of CDC20, CDK4 and Cyclin A1, and YAP1 was determined by qRT-PCR. (C) qRT-PCR was used to analyze Lnc-EPIC1 enriched by YAP1 protein in SW1990 cells, Western blotting of YAP1IP is shown PCR product, and the Lnc-EPIC1 qRT-PCR results were normalized to the GAPDH results. (D) YAP1-KO cell mRNA levels were examined by qRT-PCR. (E) Cells growth, (F) colony formation and (G) apoptosis were examined in YAP1-KO cells and SW1990 cells. *p < 0.05, **p < 0.01, ***p < 0.001, and ns indicates no difference.
pathways that have not yet been discovered. Overexpression of LncEPIC1 did not further reduce the apoptosis rate of PC cells, which may be related to antagonism of SOX2, but further bioinformatic studies are required to solve this problem. In summary, Lnc-EPIC1 is highly expressed in PC and regulates the progression of PC by targeting YAP1, which impacts the downstream molecules CDC20, CDK4 and Cyclin A1.
Author contributions All listed authors contributed to the study. Declaration of competing interest We declare that we have no financial and personal relationships
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Fig. 4. Lnc-EPIC1 overexpression promotes PC cell growth. Construction of SW1990 cells and YAP1-KO cells stably overexpressing Lnc-EPIC1. (A, B) The mRNA level of Lnc-EPIC1 was detected by qRT-PCR. (C, D) Cell growth, (E, F) colony formation and (G, H) apoptosis were evaluated in Lnc-EPIC1-overexpressing cells. *p < 0.05, **p < 0.01, ***p < 0.001, and ns indicates no difference.
with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled“Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells”. Peng Xia, Pan Liu, Qiang Fu, Chuanjiang Liu, Qiankun Luo, Xu Zhang, Liyou Cheng, Tao Qin and Hongwei Zhang. Acknowledgments The authors thank all participants involved in the study. This work was supported by the National Natural Science Foundation of China (31671440) and the Major Science and Technology Project of Henan Province (2018020421). References [1] W.M. Hackeng, R.H. Hruban, G.J. Offerhaus, L.A. Brosens, Surgical and molecular pathology of pancreatic neoplasms, Diagn. Pathol. 11 (2016) 47, https:// doi.org/10.1186/s13000-016-0497-z. [2] A. McGuigan, P. Kelly, R.C. Turkington, C. Jones, H.G. Coleman, R.S. McCain, Pancreatic cancer: a review of clinical diagnosis, epidemiology, treatment and outcomes, World J. Gastroenterol. 24 (2018) 4846e4861, https://doi.org/ 10.3748/wjg.v24.i43.4846. [3] C.L. Wolfgang, J.M. Herman, D.A. Laheru, A.P. Klein, M.A. Erdek, E.K. Fishman, R.H. Hruban, Recent progress in pancreatic cancer, CA A Cancer J. Clin. 63 (2013) 318e348, https://doi.org/10.3322/caac.21190. [4] Q. Zhang, L. Zeng, Y. Chen, G. Lian, C. Qian, S. Chen, J. Li, K. Huang, Pancreatic Cancer Epidemiology, Detection, and Management, Gastroenterology Research and Practice 2016, 2016, p. 8962321, https://doi.org/10.1155/2016/ 8962321. [5] T. Kamisawa, L.D. Wood, T. Itoi, K. Takaori, Pancreatic cancer, The Lancet 388 (2016) 73e85, https://doi.org/10.1016/s0140-6736(16)00141-0.
[6] Y. Li, X. Yang, X. Kang, S. Liu, The regulatory roles of long noncoding RNAs in the biological behavior of pancreatic cancer, Saudi J. Gastroenterol. : official journal of the Saudi Gastroenterology Association 25 (2019) 145e151, https:// doi.org/10.4103/sjg.SJG_465_18. [7] M. Felsenstein, R.H. Hruban, L.D. Wood, New developments in the molecular mechanisms of pancreatic tumorigenesis, Adv. Anat. Pathol. 25 (2018) 131e142, https://doi.org/10.1097/PAP.0000000000000172. [8] A. Kladi-Skandali, K. Michaelidou, A. Scorilas, K. Mavridis, Long noncoding RNAs in digestive system malignancies: a novel class of cancer biomarkers and therapeutic targets? Gastroenterology research and practice 2015 (2015) 319861, https://doi.org/10.1155/2015/319861. [9] M. Yang, Z. Zhai, S. Guo, X. Li, Y. Zhu, Y. Wang, Long non-coding RNA FLJ33360 participates in ovarian cancer progression by sponging miR-30b-3p, OncoTargets Ther. 12 (2019) 4469e4480, https://doi.org/10.2147/OTT.S205622. [10] C. Jiang, X. Li, H. Zhao, H. Liu, Long non-coding RNAs: potential new biomarkers for predicting tumor invasion and metastasis, Mol. Cancer 15 (2016) 62, https://doi.org/10.1186/s12943-016-0545-z. [11] Z. Wang, B. Yang, M. Zhang, W. Guo, Z. Wu, Y. Wang, L. Jia, S. Li, N. Cancer Genome Atlas Research, W. Xie, D. Yang, lncRNA epigenetic landscape analysis identifies EPIC1 as an oncogenic lncRNA that interacts with MYC and promotes cell-cycle progression in cancer, Cancer Cell 33 (2018) 706e720, https://doi.org/10.1016/j.ccell.2018.03.006. [12] B. Zhang, H.Y. Lu, Y.H. Xia, A.G. Jiang, Y.X. Lv, Long non-coding RNA EPIC1 promotes human lung cancer cell growth, Biochem. Biophys. Res. Commun. 503 (2018) 1342e1348, https://doi.org/10.1016/j.bbrc.2018.07.046. [13] Y. Li, Q. Cai, W. Li, F. Feng, L. Yang, Long non-coding RNA EPIC1 promotes cholangiocarcinoma cell growth, Biochem. Biophys. Res. Commun. 504 (2018) 654e659, https://doi.org/10.1016/j.bbrc.2018.08.174. [14] W. Zhao, D. Zhang, P. Qin, J. Zhang, X. Cui, J. Gao, J. Wang, J. Li, Long noncoding RNA EPIC1 inhibits viability and invasion of osteosarcoma cells by promoting MEF2D ubiquitylation, Int. J. Biol. Macromol. 128 (2019) 566e573, https://doi.org/10.1016/j.ijbiomac.2019.01.156. [15] S. Murakami, I. Nemazanyy, S.M. White, H. Chen, C.D.K. Nguyen, G.T. Graham, D. Saur, M. Pende, C. Yi, A yap-myc-sox2-p53 regulatory network dictates metabolic homeostasis and differentiation in kras-driven pancreatic ductal adenocarcinomas, Dev. Cell 51 (2019) 113e128, https://doi.org/10.1016/ j.devcel.2019.07.022. [16] B. Tu, J. Yao, S. Ferri-Borgogno, J. Zhao, S. Chen, Q. Wang, L. Yan, X. Zhou, C. Zhu, S. Bang, Q. Chang, C.A. Bristow, Y. Kang, H. Zheng, H. Wang, J.B. Fleming, M. Kim, T.P. Heffernan, G.F. Draetta, D. Pan, A. Maitra, W. Yao,
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167
8
P. Xia et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
S. Gupta, H. Ying, YAP1 Oncogene Is a Context-specific Driver for Pancreatic Ductal Adenocarcinoma, JCI Insight, 2019, https://doi.org/10.1172/ jci.insight.130811. [17] R.Z. He, D.X. Luo, Y.Y. Mo, Emerging roles of lncRNAs in the posttranscriptional regulation in cancer, Genes & diseases 6 (2019) 6e15, https://doi.org/10.1016/j.gendis.2019.01.003. [18] C. Zheng, Y. Xiao, Y. Li, D. He, Knockdown of long non-coding RNA PVT1 inhibits the proliferation of Raji cells through cell cycle regulation, Onco. Lett. 18 (2019) 1225e1234, https://doi.org/10.3892/ol.2019.10450. [19] H. Li, X. Wang, C. Wen, Z. Huo, W. Wang, Q. Zhan, D. Cheng, H. Chen, X. Deng, C. Peng, B. Shen, Long noncoding RNA NORAD, a novel competing endogenous RNA, enhances the hypoxia-induced epithelial-mesenchymal transition to promote metastasis in pancreatic cancer, Mol. Cancer 16 (2017) 169, https:// doi.org/10.1186/s12943-017-0738-0.
[20] D. Neureiter, T. Jager, M. Ocker, T. Kiesslich, Epigenetics and pancreatic cancer: pathophysiology and novel treatment aspects, World J. Gastroenterol. 20 (2014) 7830e7848, https://doi.org/10.3748/wjg.v20.i24.7830. [21] M. Nishimoto, K. Uranishi, M.N. Asaka, A. Suzuki, Y. Mizuno, M. Hirasaki, A. Okuda, Transformation of normal cells by aberrant activation of YAP via cMyc with TEAD, Sci. Rep. 9 (2019) 10933, https://doi.org/10.1038/s41598019-47301-6. [22] miR-375-3pp. suppresses tumorigenesis and partially reverses chemoresistance by targeting YAP1 [PMIDK31543507].pdf>. [23] P. Zhu, Y. Wang, J. Wu, G. Huang, B. Liu, B. Ye, Y. Du, G. Gao, Y. Tian, L. He, Z. Fan, LncBRM initiates YAP1 signalling activation to drive self-renewal of liver cancer stem cells, Nat. Commun. 7 (2016) 13608, https://doi.org/ 10.1038/ncomms13608.
Please cite this article as: P. Xia et al., Long noncoding RNA EPIC1 interacts with YAP1 to regulate the cell cycle and promote the growth of pancreatic cancer cells, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.167