- Email: [email protected]
Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer
Biochemical and Biophysical Research Communications xxx (2017) 1e6
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer Tingyu Ye a, b, Wei Ding a, Nanxiong Wang a, Hang Huang b, Yue Pan b, Anyang Wei a, * a b
Department of Urology, Nanfang Hospital of Southern Medical University, Guangzhou, China Department of Urology, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 June 2017 Accepted 8 July 2017 Available online xxx
Background: More and more reports have demonstrated that long noncoding RNAs (lncRNAs) play an important role in the development of a variety of carcinomas, including bladder cancer. However, only a small fraction of them have been characterized. Linc00346 have been found to be upregulated in bladder cancer tissues compared to normal tissues in a microarray-based lncRNA profiling study. In this study, we would like to explore the expression pattern and functional role of linc00346 in bladder cancer. Methods: We determined the expression of linc00346 in a cohort of bladder cancer tissues with matched normal tissues as well as human bladder cancer cell lines. We investigated the biological function of linc00346 with CCK-8 assay, colony formation assay, flow cytometry analysis, transwell assay and tumor xenografts mice model. Results: We found that linc00346 was upregulated in bladder cancer tissues compared to normal tissues. Knockdown of linc00346 inhibited bladder cancer cell proliferation and migration, induced cell cycle arrest and cell apoptosis. Conclusion: Our study demonstrates that linc00346 could be a potential oncogene and a therapeutic target in bladder cancer. © 2017 Elsevier Inc. All rights reserved.
Keywords: Bladder cancer lncRNA Proliferation Invasion
1. Introduction Bladder cancer represents one of the most common urological carcinomas around the world and is the seventh most frequent cancer in the world [1]. Bladder cancer is highly heterogeneous, which including noninvasive low-grade papillary tumors (70%e 75%) and high-grade invasive tumors (25%e30%) [2]. The invasive bladder cancer is more aggressive and has a strong tendency to develop deadly metastasis [3]. Although a diversity of treatments can be used for bladder cancer, including surgery, chemo- and radio-therapy, the advances in improving patient survival rates remain to be limited [4]. Thus, a more sophisticated understanding of the molecular mechanisms underlying bladder cancer development is needed for the development of more targeted therapeutics. Accumulating evidence has demonstrated that long noncoding RNAs, a subgroup of noncoding RNAs (longer than 200 nucleotides in length and with no protein-coding capacity) has emerged as a
* Corresponding author. Department of Urology, Nanfang Hospital of Southern Medical University, 1838 Gangzhou Avenue, Guangzhou, 510515, China. E-mail address: [email protected] (A. Wei).
new layer of gene regulation, including carcinogenesis [5e7]. Until recently, a number of lncRNAs have been revealed to take part in the carcinogenesis of bladder cancer, including linc-UBC1 [8], HOTAIR [9] and loc572558 [10], have an effect on cell proliferation, apoptosis, invasion and metastasis. In the previous profiling study of differentially expressed lncRNAs in bladder cancer [8], linc00346 (NR_027701) was found to be upregulated in bladder cancer, suggesting that linc00346 was involved in the development of bladder cancer. In the current study, we explored the expression level and biological role of linc00346 in bladder cancer. This study might help to identify novel diagnostic biomarker and therapeutic target in bladder cancer.
2. Materials and methods 2.1. Patients and tissue specimens 2.1.1. Tissue samples Fifty-two pairs of frozen bladder cancer tissues and matched normal tissues were obtained from The First Affiliated Hospital of Wenzhou Medical University. These samples were collected from
http://dx.doi.org/10.1016/j.bbrc.2017.07.045 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
2
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
patients who underwent surgical resection at The First Affiliated Hospital of Wenzhou Medical University. They were stored at 80 C before RNA isolation. The matched normal bladder tissues were at least 3 cm away from cancer. The patients were free from any preoperative chemotherapy. This study were approved by the ethic committee of The First Affiliated Hospital of Wenzhou Medical University. Written consent were obtained from each subject. 2.1.2. Cell culture Two human bladder cancer cell lines (T24 and SW780) and human bladder epithelial cell line HUM-CELL-0046 were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and cultured in RPMI 1640 supplemented with 12% fetal bovine serum (FBS) (GIBCO, Carlsbad, CA). They were maintained in a humidified incubator at 37 C with a 5% CO2 atmosphere. 2.1.3. RNA isolation and real-time polymerase chain reaction (qRTPCR) Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA). The qRT-PCR analysis was performed with using SYBR Select Master Mix (Applied Biosystems) on ABI 7500 system (Applied Biosystems, CA, USA). The primers used were as the followings: b-actin forward: 50 -GAAATCGTGCGTGACATTAA-3’; reverse: 50 -AAGGAAGGCTGGAAGAGTG-3’. linc00346 forward: 50 AGCTTGAATGGCGTTGGAACCTATAG-3’; linc00346 reverse: 50 ATAGTCCCTTCCTCGAATCCTAGT-3’. The results were obtained from three independent repeats. The 2DDCt method was performed to determine the gene expression level. 2.1.4. Lentiviral vector construction and transfection For stable linc00346 silencing, we constructed the lentiviral vector containing linc00346 specific shRNA. Linc00346 shRNA were constructed by Genechem Company (Genechem, Shanghai, China) with the primer sequence: sh-linc00346 was shRNA-1: 50 eCCGGAAGCACAGTGGTCTAAAAGTACTCGAGTACTTTTAGACCACTGTGCTTTTTTTG-30 , shRNA-2: 50 eCCGGCTGTAGAAGGTTGAAGGGAA ACTCGAGTTTCCCTTCAACCTTCTACAGTTTTTG-3’. The transfection were performed at a multiplicity of infection (MOI) of 40 plaqueforming units (p.f.u.) per cell. After incubated overnight, the cells were transferred to virus-free medium. The GFP density observed by the microscope were used to evaluate the efficacy of transfection. 2.1.5. Western blot analysis Total cell proteins were extracted with RIPA buffer supplemented with protease inhibitors. Equal amounts of proteins (20e35 mg) were separated by a 10% SDS-polyacrylamide separating gel and then transferred to a PVDF Immobilon-P membrane (Millipore). After blocking with 5% nonfat milk, the membrane was then incubated with the primary antibody and HRP-conjugated secondary antibody. The band intensity was visualized by ECL reagent. 2.1.6. Cell proliferation assay The CCK-8 assay was performed to determine the cell viability. Briefly, 1000 cells were seeded into each well of the 96-well plate. The cells were cultured for indicated time periods. Then, 10 ml CCK8 (Dojindo, Japan) was added into each well and incubated for an additional 2 h. The relative cell number was determined via measuring absorbance at 450 nm with the ELx600 Absorbance microplate reader (BioTek, Winooski, Vermont). 2.1.7. Flow cytometry analysis To analyze cell cycle, cells transfected with desired vector were
harvested and then fixed in 70% ethanol at 4 C overnight. Afterwards, the cells were washed with PBS for three times. PI (50 mg/ mL) and RNase A (100 mg/mL) were added into the cells. After incubation for 1 h, the cells underwent cell cycle analysis on FC500MPL Beckman Coulter. 2.1.8. Colony formation assay Cells transfected with indicated vectors were seeded on six-well plates. After two-week's cell culture, the bladder cancer cells were washed with PBS and fixed with 4% paraformaldehyde. The colonies were stained with Giemsa. The number of colonies were counted under the microscope. 2.1.9. Cell migration and invasion For cell invasion, bladder cancer cells were seeded on the upper chamber of 8-mm trans-well filter precoated with Matrigel (BD, Franklin Lakes, NJ, USA). For cell migration, bladder cancer cells were seeded on the upper chamber of 8-mm trans-well filter. 24 h post cell inoculation, cancer cells that did not invade were removed with the cotton swab, whereas the cancer cells on the lower surface were fixed with 4% paraformaldehyde for 10 min and stained with 1% crystal violet for 15 min. The cells were counted under the microscope. 2.1.10. In vivo nude mice experiments The animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no. 85e23, revised 1996). It was performed in animal experiment center of The First Affiliatd Hospital of Wenzhou Medical University. The study was approved by the Animal Care and Use committee of The First Affiliatd Hospital of Wenzhou Medical University. 1 106 SW780 cells transfected with shRNA-NC or shRNAlinc00346 were injected subcutaneously into the flank area of nude mice (n ¼ 5, per group). The tumor volume was determined every week using the formula: volume ¼ 0.5 length width2. Four weeks after inoculation, the mice were sacrificed. 2.1.11. Statistical analysis The statistical analysis was performed with SPSS version 17.0 (SPSS, Chicago, IL). Data are presented as the mean ± standard deviation from at least three independent experiments. Student's ttest was used to compare continuous variables. Pearson Chi-square test was used to study the correlation between linc00346 and clinicopathological characteristics. A p value less than 0.05 was considered to be significant. 3. Results We first examined the expression level of linc00346 with qRTPCR in bladder cancer tissues and pair-matched normal bladder tissues from 52 bladder cancer patients. The expression level of linc00346 was upregulated in 76.92% (40/52) bladder cancer tissues when compared to pair-matched normal tissues (Supplemental Fig. 1A). No statistical correlation with age, gender and histological grade was observed (Table 1). The expression of linc00346 was higher in human bladder cancer cell lines (T24 and SW780) compared to human bladder epithelial cell line HUM-CELL0046 (Supplemental Fig. 1B). 3.1. Knockdown of linc00346 inhibited bladder cancer proliferation and induced cell cycle arrest To investigate the biological role of linc00346 in bladder cancer, we stably knocked down linc00346 expression using lentivirus-
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6 Table 1 linc00346 expression and clinicopathologic charateristics in bladder cancer. Charateristics
Gender Male Female Age (yr) 65 >65 Tumor status Ta,Tis,T1 T2-4 Tumor Garde G1 G2-G3
Case number
linc00346 expression
3
increase in cell apoptosis was observed in bladder cells after linc00346 knockdown (Fig. 2C).
p-value
3.2. linc00346 promotes bladder cancer migration and invasion
Low
High
44 8
18 6
26 2
0.075
30 22
13 11
17 11
0.634
19 33
9 15
10 18
0.894
9 43
4 20
5 23
0.910
mediated shRNA transfection in two bladder cancer cell lines (T24 and SW780). Seventy-two hours after transduction (MOI of 40), we analyzed the expression level of linc00346 with qRT-PCR. The data demonstrated that short hairpin RNA-mediated knockdown of linc00346 was effective (Fig. 1A). Downregulation of linc00346 results in significantly decreased cell viability in bladder cancer cells compared with control as determined with CCK-8 assay (Fig. 1B). We also showed that knockdown of linc00346 significantly inhibited the colony-formation capacity of bladder cancer cells (Fig. 1C). All these data suggest that linc00346 may be involved in the regulation of bladder cancer cell proliferation. Then, we examined the effect of linc00346 downregulation on cell cycle. Flow cytometry analysis revealed that the downregulation of linc00346 obviously induced a significant G0/G1 cell cycle arrest in bladder cancer cells (Fig. 2A). Then, we determined the effect of linc00346 silencing on the cell cycle regulators, such as CDK4, CDK6 and cyclin D1. Western blot analysis showed that linc00346 downregulation markedly suppressed the expression of CDK4, CDK6 and cyclin D1 (Fig. 2B). Furthermore, a significant
We examined the effect of linc00346 silencing on bladder cancer cell invasion. A marked decrease in the migratory and invasive capacity of bladder cancer cells was found with linc00346 suppression (Supplemental Figs. 2A and B). These data suggest that linc00346 promotes bladder cancer migration and invasion. 3.3. Knockdown of linc00346 suppressed bladder cancer growth in vivo To further confirm the effect of linc00346 on cell proliferation, we subcutaneously implanted three groups of SW780 cells (control, shRNA control group, shRNA-linc00346 group) into nude mice. Four weeks post cancer cell implantation, the growth curve indicated that linc00346 knockdown significantly decreased cell growth (Fig. 3A and B). Immunohistochemical staining of tumor tissues indicated a decrease in ki67 in shRNA-linc00346 vs. scramble (Fig. 3C). 4. Discussion Up till now, a growing number of studies have revealed that not only the protein-coding genes but also protein noncoding RNAs contribute to carcinogenesis of bladder cancer [11e13]. lncRNAs, a subclass of noncoding RNAs with a minimum length of 200 nts, are involved in multiple levels of gene regulation, including epigenetic regulation by recruiting chromatin modifying complex [14] and posttranscriptional regulation by interacting with proteins, miRNAs and mRNAs [15e17]. lncRNAs can modulate various aspects of cancer biology, including proliferation, apoptosis, invasion, metastasis, cell metabolism and therapy-resistance [18]. A number of lncRNAs have been identified to be differentially expressed in bladder cancer tissues compared to normal tissues. For example,
Fig. 1. Effect of linc00346 on cell proliferation. (A) We determined relative linc00346 expression with qRT-PCR. (B) Cellular viability of T24 and SW780 cells transfected with shRNA-NC or shRNA-linc00346 was determined with the CCK-8 assay. (C) T24 and SW780 cells were seeded at the density of 400 cells per well. 14 days later, the formed colonies were stained and counted with a microscope. *, p < 0.05.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
4
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
Fig. 2. Effect of linc00346 on cell cycle and apoptosis. (A) Cell cycle analysis determined the relative cell numbers in each cell-cycle phase after propidium iodide staining of T24 cells and SW780 cells transfected with shRNA against linc00346. Numbers inside bars represent percentages of cells in each phase. (B) The levels of CDK4, CDK6, and cyclin D1 were detected in bladder cancer cells transfected with desired vector by western blot analysis. *p < 0.05. (C) Annexin V/PI staining and flow cytometry analysis assessing apoptosis in T24 cells transfected with shRNA against linc00346. Data represent the mean ± S.D. from three independent experiments. *, p < 0.05.
LncRNA SPRY4-IT1 sponges miR-101-3p to promote proliferation and metastasis of bladder cancer cells through up-regulating EZH2 [19]. Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR-196a-5p in bladder cancer cells [20]. Although a number of lncRNAs have been demonstrated to contribute to the development of bladder cancer, the functional role of lncRNAs in bladder cancer remain largely unknown. The linc00346 was located on chrome 13 (111516333111522655) and has a transcript of about 6322 nucleotides in length. The previous study have showed that linc00346 was upregulated in bladder cancer tissues. Inspired by the observation,
we explored the role of linc00346 in the development of bladder cancer. In this study, the results demonstrated that the expression level of linc00346 was higher in bladder cancer cells and tissues compared to human bladder epithelial cell line and adjacent normal tissues.It suggests that lin00346 might play a role in bladder cancer progression. Furthermore, in vitro and in vivo studies showed that knockdown of linc00346 significantly suppressed cell viability, colony formation ability and DNA replication, indicating that linc00346 plays a role in bladder cancer proliferation. Mechanistical investigation suggested that linc00346-silencing induced bladder cancer G0/G1 cell cycle arrest possibly through downregulating the expression of CDK4, CDK6 and cyclin D1. Knockdown of linc00346
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
5
Fig. 3. Effect of linc00346 on cell growth in vivo. (A) Knockdown of linc00346 inhibited the proliferation bladder cancer cells in vivo (n ¼ 6, per group). (B) Tumor volume was determined on a weekly basis. **, p < 0.01. (C) Immunohistochemical staining demonstrated that suppression of linc00346 inhibited the aggressive phenotype of bladder cells in vivo, as indicated by the expression of Ki67-positive cells.
also resulted in significant bladder cancer cell apoptosis. In general, we demonstrated that linc00346 promoted tumor progression via regulating PI3K/AKT signaling pathways in bladder cancer. Our study suggest that linc00346 may contribute to the development of bladder cancer and could be a potential therapeutic target. Completing interests The authors declare that they have no competing interests. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.07.045. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2017.07.045. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2015) 87e108. €m, W. Choi, [2] A.M. Kamat, N.M. Hahn, J.A. Efstathiou, S.P. Lerner, P.U. Malmstro C.C. Guo, Y. Lotan, W. Kassouf, Bladder cancer, Lancet 388 (10061) (2016)
2796e2810. [3] K.E. van Kessel, T.C. Zuiverloon, A.R. Alberts, J.L. Boormans, E.C. Zwarthoff, Targeted therapies in bladder cancer: an overview of in vivo research, Nat. Rev. Urol. 12 (2015) 681e694. [4] T.L. Rose, M.I. Milowsky, Improving systemic chemotherapy for bladder cancer, Curr. Oncol. Rep. 18 (2016) 27. [5] X. Du, M.D. Xu, Y. Wang, W.W. Weng, P. Wei, P. Qi, et al., A positive feedback loop of lncRNA-PVT1 and FOXM1 facilitates gastric cancer growth and invasion, Clin. Cancer Res. 23 (8) (2017) 2071e2080. [6] M.Z. Ma, Y. Zhang, M.Z. Weng, S.H. Wang, Y. Hu, Z.Y. Hou, et al., Long noncoding RNA GCASPC, a target of miR-17-3p, negatively regulates pyruvate carboxylase-dependent cell proliferation in gallbladder cancer, Cancer Res. 76 (2016) 5361e5371. [7] X. Lan, J. Yan, J. Ren, B. Zhong, J. Li, Y. Li, et al., A novel long noncoding RNA Lnc-HC binds hnRNPA2B1 to regulate expressions of Cyp7a1 and Abca1 in hepatocytic cholesterol metabolism, Hepatology 64 (2016) 58e72. [8] W. He, Q. Cai, F. Sun, G. Zhong, P. Wang, H. Liu, et al., linc-UBC1 physically associates with polycomb repressive complex 2 (PRC2) and acts as a negative prognostic factor for lymph node metastasis and survival in bladder cancer, Biochim. Biophys. Acta 1832 (2013) 1528e1537. [9] X. Sun, P. Du, W. Yuan, Z. Du, M. Yu, X. Yu, et al., Long non-coding RNA HOTAIR regulates cyclin J via inhibition of microRNA-205 expression in bladder cancer, Cell Death Dis. 6 (2015) e1907. [10] Y. Zhu, B. Dai, H. Zhang, G. Shi, Y. Shen, D. Ye, Long non-coding RNA LOC572558 inhibits bladder cancer cell proliferation and tumor growth by regulating the AKT-MDM2-p53 signaling axis, Cancer Lett. 380 (2016) 369e374. [11] S. Chen, X. Chen, G. Xie, Y. He, D. Yan, D. Zheng, et al., Cdc6 contributes to cisplatin-resistance by activation of ATR-Chk1 pathway in bladder cancer cells, Oncotarget 7 (2016) 40362e40376. [12] R. Matsumoto, M. Tsuda, K. Yoshida, M. Tanino, T. Kimura, H. Nishihara, et al., Aldo-keto reductase 1C1 induced by interleukin-1b mediates the invasive potential and drug resistance of metastatic bladder cancer cells, Sci. Rep. 6 (2016) 34625. [13] S. Kopsiaftis, K.L. Sullivan, I. Garg, J.A. Taylor, K.P. Claffey, AMPKalpha2 regulates bladder cancer growth through SKP2-mediated degradation of p27, Mol. Cancer Res. 14 (12) (2016) 1182e1194. [14] F. Yang, L. Zhang, X.S. Huo, J.H. Yuan, D. Xu, S.X. Yuan, et al., Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans, Hepatology 54 (2011) 1679e1689.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
6
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
[15] J.H. Yuan, F. Yang, F. Wang, J.Z. Ma, Y.J. Guo, Q.F. Tao, et al., A long noncoding RNA activated by TGF-b promotes the invasion-metastasis cascade in hepatocellular carcinoma, Cancer Cell. 25 (2014) 666e681. [16] F. Yang, X.S. Huo, S.X. Yuan, L. Zhang, W.P. Zhou, F. Wang, et al., Repression of the long noncoding RNA-LET by histone deacetylase 3 contributes to hypoxiamediated metastasis, Mol. Cell. 49 (2013) 1083e1096. [17] F. Yang, H. Zhang, Y. Mei, M. Wu, Reciprocal regulation of HIF-1a and lincRNAp21 modulates the Warburg effect, Mol. Cell. 53 (2014) 88e100. [18] L. Qu, J. Ding, C. Chen, Z.J. Wu, B. Liu, Y. Gao, et al., Exosome-transmitted
lncARSR promotes sunitinib resistance in renal cancer by acting as a competing endogenous RNA, Cancer Cell. 29 (2016) 653e668. [19] D. Liu, Y. Li, G. Luo, X. Xiao, D. Tao, X. Wu, et al., LncRNA SPRY4-IT1 sponges miR-101-3p to promote proliferation and metastasis of bladder cancer cells through up-regulating EZH2, Cancer Lett. 388 (2017) 281e291. [20] J. Pan, X. Li, W. Wu, M. Xue, H. Hou, W. Zhai, et al., Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells, Cancer Lett. 382 (2016) 64e76.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer Tingyu Ye a, b, Wei Ding a, Nanxiong Wang a, Hang Huang b, Yue Pan b, Anyang Wei a, * a b
Department of Urology, Nanfang Hospital of Southern Medical University, Guangzhou, China Department of Urology, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 29 June 2017 Accepted 8 July 2017 Available online xxx
Background: More and more reports have demonstrated that long noncoding RNAs (lncRNAs) play an important role in the development of a variety of carcinomas, including bladder cancer. However, only a small fraction of them have been characterized. Linc00346 have been found to be upregulated in bladder cancer tissues compared to normal tissues in a microarray-based lncRNA profiling study. In this study, we would like to explore the expression pattern and functional role of linc00346 in bladder cancer. Methods: We determined the expression of linc00346 in a cohort of bladder cancer tissues with matched normal tissues as well as human bladder cancer cell lines. We investigated the biological function of linc00346 with CCK-8 assay, colony formation assay, flow cytometry analysis, transwell assay and tumor xenografts mice model. Results: We found that linc00346 was upregulated in bladder cancer tissues compared to normal tissues. Knockdown of linc00346 inhibited bladder cancer cell proliferation and migration, induced cell cycle arrest and cell apoptosis. Conclusion: Our study demonstrates that linc00346 could be a potential oncogene and a therapeutic target in bladder cancer. © 2017 Elsevier Inc. All rights reserved.
Keywords: Bladder cancer lncRNA Proliferation Invasion
1. Introduction Bladder cancer represents one of the most common urological carcinomas around the world and is the seventh most frequent cancer in the world [1]. Bladder cancer is highly heterogeneous, which including noninvasive low-grade papillary tumors (70%e 75%) and high-grade invasive tumors (25%e30%) [2]. The invasive bladder cancer is more aggressive and has a strong tendency to develop deadly metastasis [3]. Although a diversity of treatments can be used for bladder cancer, including surgery, chemo- and radio-therapy, the advances in improving patient survival rates remain to be limited [4]. Thus, a more sophisticated understanding of the molecular mechanisms underlying bladder cancer development is needed for the development of more targeted therapeutics. Accumulating evidence has demonstrated that long noncoding RNAs, a subgroup of noncoding RNAs (longer than 200 nucleotides in length and with no protein-coding capacity) has emerged as a
* Corresponding author. Department of Urology, Nanfang Hospital of Southern Medical University, 1838 Gangzhou Avenue, Guangzhou, 510515, China. E-mail address: [email protected] (A. Wei).
new layer of gene regulation, including carcinogenesis [5e7]. Until recently, a number of lncRNAs have been revealed to take part in the carcinogenesis of bladder cancer, including linc-UBC1 [8], HOTAIR [9] and loc572558 [10], have an effect on cell proliferation, apoptosis, invasion and metastasis. In the previous profiling study of differentially expressed lncRNAs in bladder cancer [8], linc00346 (NR_027701) was found to be upregulated in bladder cancer, suggesting that linc00346 was involved in the development of bladder cancer. In the current study, we explored the expression level and biological role of linc00346 in bladder cancer. This study might help to identify novel diagnostic biomarker and therapeutic target in bladder cancer.
2. Materials and methods 2.1. Patients and tissue specimens 2.1.1. Tissue samples Fifty-two pairs of frozen bladder cancer tissues and matched normal tissues were obtained from The First Affiliated Hospital of Wenzhou Medical University. These samples were collected from
http://dx.doi.org/10.1016/j.bbrc.2017.07.045 0006-291X/© 2017 Elsevier Inc. All rights reserved.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
2
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
patients who underwent surgical resection at The First Affiliated Hospital of Wenzhou Medical University. They were stored at 80 C before RNA isolation. The matched normal bladder tissues were at least 3 cm away from cancer. The patients were free from any preoperative chemotherapy. This study were approved by the ethic committee of The First Affiliated Hospital of Wenzhou Medical University. Written consent were obtained from each subject. 2.1.2. Cell culture Two human bladder cancer cell lines (T24 and SW780) and human bladder epithelial cell line HUM-CELL-0046 were obtained from the American Type Culture Collection (ATCC, Manassas, VA) and cultured in RPMI 1640 supplemented with 12% fetal bovine serum (FBS) (GIBCO, Carlsbad, CA). They were maintained in a humidified incubator at 37 C with a 5% CO2 atmosphere. 2.1.3. RNA isolation and real-time polymerase chain reaction (qRTPCR) Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA). The qRT-PCR analysis was performed with using SYBR Select Master Mix (Applied Biosystems) on ABI 7500 system (Applied Biosystems, CA, USA). The primers used were as the followings: b-actin forward: 50 -GAAATCGTGCGTGACATTAA-3’; reverse: 50 -AAGGAAGGCTGGAAGAGTG-3’. linc00346 forward: 50 AGCTTGAATGGCGTTGGAACCTATAG-3’; linc00346 reverse: 50 ATAGTCCCTTCCTCGAATCCTAGT-3’. The results were obtained from three independent repeats. The 2DDCt method was performed to determine the gene expression level. 2.1.4. Lentiviral vector construction and transfection For stable linc00346 silencing, we constructed the lentiviral vector containing linc00346 specific shRNA. Linc00346 shRNA were constructed by Genechem Company (Genechem, Shanghai, China) with the primer sequence: sh-linc00346 was shRNA-1: 50 eCCGGAAGCACAGTGGTCTAAAAGTACTCGAGTACTTTTAGACCACTGTGCTTTTTTTG-30 , shRNA-2: 50 eCCGGCTGTAGAAGGTTGAAGGGAA ACTCGAGTTTCCCTTCAACCTTCTACAGTTTTTG-3’. The transfection were performed at a multiplicity of infection (MOI) of 40 plaqueforming units (p.f.u.) per cell. After incubated overnight, the cells were transferred to virus-free medium. The GFP density observed by the microscope were used to evaluate the efficacy of transfection. 2.1.5. Western blot analysis Total cell proteins were extracted with RIPA buffer supplemented with protease inhibitors. Equal amounts of proteins (20e35 mg) were separated by a 10% SDS-polyacrylamide separating gel and then transferred to a PVDF Immobilon-P membrane (Millipore). After blocking with 5% nonfat milk, the membrane was then incubated with the primary antibody and HRP-conjugated secondary antibody. The band intensity was visualized by ECL reagent. 2.1.6. Cell proliferation assay The CCK-8 assay was performed to determine the cell viability. Briefly, 1000 cells were seeded into each well of the 96-well plate. The cells were cultured for indicated time periods. Then, 10 ml CCK8 (Dojindo, Japan) was added into each well and incubated for an additional 2 h. The relative cell number was determined via measuring absorbance at 450 nm with the ELx600 Absorbance microplate reader (BioTek, Winooski, Vermont). 2.1.7. Flow cytometry analysis To analyze cell cycle, cells transfected with desired vector were
harvested and then fixed in 70% ethanol at 4 C overnight. Afterwards, the cells were washed with PBS for three times. PI (50 mg/ mL) and RNase A (100 mg/mL) were added into the cells. After incubation for 1 h, the cells underwent cell cycle analysis on FC500MPL Beckman Coulter. 2.1.8. Colony formation assay Cells transfected with indicated vectors were seeded on six-well plates. After two-week's cell culture, the bladder cancer cells were washed with PBS and fixed with 4% paraformaldehyde. The colonies were stained with Giemsa. The number of colonies were counted under the microscope. 2.1.9. Cell migration and invasion For cell invasion, bladder cancer cells were seeded on the upper chamber of 8-mm trans-well filter precoated with Matrigel (BD, Franklin Lakes, NJ, USA). For cell migration, bladder cancer cells were seeded on the upper chamber of 8-mm trans-well filter. 24 h post cell inoculation, cancer cells that did not invade were removed with the cotton swab, whereas the cancer cells on the lower surface were fixed with 4% paraformaldehyde for 10 min and stained with 1% crystal violet for 15 min. The cells were counted under the microscope. 2.1.10. In vivo nude mice experiments The animal experiments were carried out in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no. 85e23, revised 1996). It was performed in animal experiment center of The First Affiliatd Hospital of Wenzhou Medical University. The study was approved by the Animal Care and Use committee of The First Affiliatd Hospital of Wenzhou Medical University. 1 106 SW780 cells transfected with shRNA-NC or shRNAlinc00346 were injected subcutaneously into the flank area of nude mice (n ¼ 5, per group). The tumor volume was determined every week using the formula: volume ¼ 0.5 length width2. Four weeks after inoculation, the mice were sacrificed. 2.1.11. Statistical analysis The statistical analysis was performed with SPSS version 17.0 (SPSS, Chicago, IL). Data are presented as the mean ± standard deviation from at least three independent experiments. Student's ttest was used to compare continuous variables. Pearson Chi-square test was used to study the correlation between linc00346 and clinicopathological characteristics. A p value less than 0.05 was considered to be significant. 3. Results We first examined the expression level of linc00346 with qRTPCR in bladder cancer tissues and pair-matched normal bladder tissues from 52 bladder cancer patients. The expression level of linc00346 was upregulated in 76.92% (40/52) bladder cancer tissues when compared to pair-matched normal tissues (Supplemental Fig. 1A). No statistical correlation with age, gender and histological grade was observed (Table 1). The expression of linc00346 was higher in human bladder cancer cell lines (T24 and SW780) compared to human bladder epithelial cell line HUM-CELL0046 (Supplemental Fig. 1B). 3.1. Knockdown of linc00346 inhibited bladder cancer proliferation and induced cell cycle arrest To investigate the biological role of linc00346 in bladder cancer, we stably knocked down linc00346 expression using lentivirus-
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6 Table 1 linc00346 expression and clinicopathologic charateristics in bladder cancer. Charateristics
Gender Male Female Age (yr) 65 >65 Tumor status Ta,Tis,T1 T2-4 Tumor Garde G1 G2-G3
Case number
linc00346 expression
3
increase in cell apoptosis was observed in bladder cells after linc00346 knockdown (Fig. 2C).
p-value
3.2. linc00346 promotes bladder cancer migration and invasion
Low
High
44 8
18 6
26 2
0.075
30 22
13 11
17 11
0.634
19 33
9 15
10 18
0.894
9 43
4 20
5 23
0.910
mediated shRNA transfection in two bladder cancer cell lines (T24 and SW780). Seventy-two hours after transduction (MOI of 40), we analyzed the expression level of linc00346 with qRT-PCR. The data demonstrated that short hairpin RNA-mediated knockdown of linc00346 was effective (Fig. 1A). Downregulation of linc00346 results in significantly decreased cell viability in bladder cancer cells compared with control as determined with CCK-8 assay (Fig. 1B). We also showed that knockdown of linc00346 significantly inhibited the colony-formation capacity of bladder cancer cells (Fig. 1C). All these data suggest that linc00346 may be involved in the regulation of bladder cancer cell proliferation. Then, we examined the effect of linc00346 downregulation on cell cycle. Flow cytometry analysis revealed that the downregulation of linc00346 obviously induced a significant G0/G1 cell cycle arrest in bladder cancer cells (Fig. 2A). Then, we determined the effect of linc00346 silencing on the cell cycle regulators, such as CDK4, CDK6 and cyclin D1. Western blot analysis showed that linc00346 downregulation markedly suppressed the expression of CDK4, CDK6 and cyclin D1 (Fig. 2B). Furthermore, a significant
We examined the effect of linc00346 silencing on bladder cancer cell invasion. A marked decrease in the migratory and invasive capacity of bladder cancer cells was found with linc00346 suppression (Supplemental Figs. 2A and B). These data suggest that linc00346 promotes bladder cancer migration and invasion. 3.3. Knockdown of linc00346 suppressed bladder cancer growth in vivo To further confirm the effect of linc00346 on cell proliferation, we subcutaneously implanted three groups of SW780 cells (control, shRNA control group, shRNA-linc00346 group) into nude mice. Four weeks post cancer cell implantation, the growth curve indicated that linc00346 knockdown significantly decreased cell growth (Fig. 3A and B). Immunohistochemical staining of tumor tissues indicated a decrease in ki67 in shRNA-linc00346 vs. scramble (Fig. 3C). 4. Discussion Up till now, a growing number of studies have revealed that not only the protein-coding genes but also protein noncoding RNAs contribute to carcinogenesis of bladder cancer [11e13]. lncRNAs, a subclass of noncoding RNAs with a minimum length of 200 nts, are involved in multiple levels of gene regulation, including epigenetic regulation by recruiting chromatin modifying complex [14] and posttranscriptional regulation by interacting with proteins, miRNAs and mRNAs [15e17]. lncRNAs can modulate various aspects of cancer biology, including proliferation, apoptosis, invasion, metastasis, cell metabolism and therapy-resistance [18]. A number of lncRNAs have been identified to be differentially expressed in bladder cancer tissues compared to normal tissues. For example,
Fig. 1. Effect of linc00346 on cell proliferation. (A) We determined relative linc00346 expression with qRT-PCR. (B) Cellular viability of T24 and SW780 cells transfected with shRNA-NC or shRNA-linc00346 was determined with the CCK-8 assay. (C) T24 and SW780 cells were seeded at the density of 400 cells per well. 14 days later, the formed colonies were stained and counted with a microscope. *, p < 0.05.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
4
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
Fig. 2. Effect of linc00346 on cell cycle and apoptosis. (A) Cell cycle analysis determined the relative cell numbers in each cell-cycle phase after propidium iodide staining of T24 cells and SW780 cells transfected with shRNA against linc00346. Numbers inside bars represent percentages of cells in each phase. (B) The levels of CDK4, CDK6, and cyclin D1 were detected in bladder cancer cells transfected with desired vector by western blot analysis. *p < 0.05. (C) Annexin V/PI staining and flow cytometry analysis assessing apoptosis in T24 cells transfected with shRNA against linc00346. Data represent the mean ± S.D. from three independent experiments. *, p < 0.05.
LncRNA SPRY4-IT1 sponges miR-101-3p to promote proliferation and metastasis of bladder cancer cells through up-regulating EZH2 [19]. Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR-196a-5p in bladder cancer cells [20]. Although a number of lncRNAs have been demonstrated to contribute to the development of bladder cancer, the functional role of lncRNAs in bladder cancer remain largely unknown. The linc00346 was located on chrome 13 (111516333111522655) and has a transcript of about 6322 nucleotides in length. The previous study have showed that linc00346 was upregulated in bladder cancer tissues. Inspired by the observation,
we explored the role of linc00346 in the development of bladder cancer. In this study, the results demonstrated that the expression level of linc00346 was higher in bladder cancer cells and tissues compared to human bladder epithelial cell line and adjacent normal tissues.It suggests that lin00346 might play a role in bladder cancer progression. Furthermore, in vitro and in vivo studies showed that knockdown of linc00346 significantly suppressed cell viability, colony formation ability and DNA replication, indicating that linc00346 plays a role in bladder cancer proliferation. Mechanistical investigation suggested that linc00346-silencing induced bladder cancer G0/G1 cell cycle arrest possibly through downregulating the expression of CDK4, CDK6 and cyclin D1. Knockdown of linc00346
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
5
Fig. 3. Effect of linc00346 on cell growth in vivo. (A) Knockdown of linc00346 inhibited the proliferation bladder cancer cells in vivo (n ¼ 6, per group). (B) Tumor volume was determined on a weekly basis. **, p < 0.01. (C) Immunohistochemical staining demonstrated that suppression of linc00346 inhibited the aggressive phenotype of bladder cells in vivo, as indicated by the expression of Ki67-positive cells.
also resulted in significant bladder cancer cell apoptosis. In general, we demonstrated that linc00346 promoted tumor progression via regulating PI3K/AKT signaling pathways in bladder cancer. Our study suggest that linc00346 may contribute to the development of bladder cancer and could be a potential therapeutic target. Completing interests The authors declare that they have no competing interests. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2017.07.045. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2017.07.045. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2015) 87e108. €m, W. Choi, [2] A.M. Kamat, N.M. Hahn, J.A. Efstathiou, S.P. Lerner, P.U. Malmstro C.C. Guo, Y. Lotan, W. Kassouf, Bladder cancer, Lancet 388 (10061) (2016)
2796e2810. [3] K.E. van Kessel, T.C. Zuiverloon, A.R. Alberts, J.L. Boormans, E.C. Zwarthoff, Targeted therapies in bladder cancer: an overview of in vivo research, Nat. Rev. Urol. 12 (2015) 681e694. [4] T.L. Rose, M.I. Milowsky, Improving systemic chemotherapy for bladder cancer, Curr. Oncol. Rep. 18 (2016) 27. [5] X. Du, M.D. Xu, Y. Wang, W.W. Weng, P. Wei, P. Qi, et al., A positive feedback loop of lncRNA-PVT1 and FOXM1 facilitates gastric cancer growth and invasion, Clin. Cancer Res. 23 (8) (2017) 2071e2080. [6] M.Z. Ma, Y. Zhang, M.Z. Weng, S.H. Wang, Y. Hu, Z.Y. Hou, et al., Long noncoding RNA GCASPC, a target of miR-17-3p, negatively regulates pyruvate carboxylase-dependent cell proliferation in gallbladder cancer, Cancer Res. 76 (2016) 5361e5371. [7] X. Lan, J. Yan, J. Ren, B. Zhong, J. Li, Y. Li, et al., A novel long noncoding RNA Lnc-HC binds hnRNPA2B1 to regulate expressions of Cyp7a1 and Abca1 in hepatocytic cholesterol metabolism, Hepatology 64 (2016) 58e72. [8] W. He, Q. Cai, F. Sun, G. Zhong, P. Wang, H. Liu, et al., linc-UBC1 physically associates with polycomb repressive complex 2 (PRC2) and acts as a negative prognostic factor for lymph node metastasis and survival in bladder cancer, Biochim. Biophys. Acta 1832 (2013) 1528e1537. [9] X. Sun, P. Du, W. Yuan, Z. Du, M. Yu, X. Yu, et al., Long non-coding RNA HOTAIR regulates cyclin J via inhibition of microRNA-205 expression in bladder cancer, Cell Death Dis. 6 (2015) e1907. [10] Y. Zhu, B. Dai, H. Zhang, G. Shi, Y. Shen, D. Ye, Long non-coding RNA LOC572558 inhibits bladder cancer cell proliferation and tumor growth by regulating the AKT-MDM2-p53 signaling axis, Cancer Lett. 380 (2016) 369e374. [11] S. Chen, X. Chen, G. Xie, Y. He, D. Yan, D. Zheng, et al., Cdc6 contributes to cisplatin-resistance by activation of ATR-Chk1 pathway in bladder cancer cells, Oncotarget 7 (2016) 40362e40376. [12] R. Matsumoto, M. Tsuda, K. Yoshida, M. Tanino, T. Kimura, H. Nishihara, et al., Aldo-keto reductase 1C1 induced by interleukin-1b mediates the invasive potential and drug resistance of metastatic bladder cancer cells, Sci. Rep. 6 (2016) 34625. [13] S. Kopsiaftis, K.L. Sullivan, I. Garg, J.A. Taylor, K.P. Claffey, AMPKalpha2 regulates bladder cancer growth through SKP2-mediated degradation of p27, Mol. Cancer Res. 14 (12) (2016) 1182e1194. [14] F. Yang, L. Zhang, X.S. Huo, J.H. Yuan, D. Xu, S.X. Yuan, et al., Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans, Hepatology 54 (2011) 1679e1689.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045
6
T. Ye et al. / Biochemical and Biophysical Research Communications xxx (2017) 1e6
[15] J.H. Yuan, F. Yang, F. Wang, J.Z. Ma, Y.J. Guo, Q.F. Tao, et al., A long noncoding RNA activated by TGF-b promotes the invasion-metastasis cascade in hepatocellular carcinoma, Cancer Cell. 25 (2014) 666e681. [16] F. Yang, X.S. Huo, S.X. Yuan, L. Zhang, W.P. Zhou, F. Wang, et al., Repression of the long noncoding RNA-LET by histone deacetylase 3 contributes to hypoxiamediated metastasis, Mol. Cell. 49 (2013) 1083e1096. [17] F. Yang, H. Zhang, Y. Mei, M. Wu, Reciprocal regulation of HIF-1a and lincRNAp21 modulates the Warburg effect, Mol. Cell. 53 (2014) 88e100. [18] L. Qu, J. Ding, C. Chen, Z.J. Wu, B. Liu, Y. Gao, et al., Exosome-transmitted
lncARSR promotes sunitinib resistance in renal cancer by acting as a competing endogenous RNA, Cancer Cell. 29 (2016) 653e668. [19] D. Liu, Y. Li, G. Luo, X. Xiao, D. Tao, X. Wu, et al., LncRNA SPRY4-IT1 sponges miR-101-3p to promote proliferation and metastasis of bladder cancer cells through up-regulating EZH2, Cancer Lett. 388 (2017) 281e291. [20] J. Pan, X. Li, W. Wu, M. Xue, H. Hou, W. Zhai, et al., Long non-coding RNA UCA1 promotes cisplatin/gemcitabine resistance through CREB modulating miR196a-5p in bladder cancer cells, Cancer Lett. 382 (2016) 64e76.
Please cite this article in press as: T. Ye, et al., Long noncoding RNA linc00346 promotes the malignant phenotypes of bladder cancer, Biochemical and Biophysical Research Communications (2017), http://dx.doi.org/10.1016/j.bbrc.2017.07.045