Long-Term Follow-up of Foamy Viral Vector-Mediated Gene Therapy for Canine Leukocyte Adhesion Deficiency

original article

© The American Society of Gene & Cell Therapy

Long-Term Follow-up of Foamy Viral Vector-Mediated Gene Therapy for Canine Leukocyte Adhesion Deficiency Thomas R Bauer Jr1, Laura M Tuschong1, Katherine R Calvo2, Heather R Shive1, Tanya H Burkholder3, Eleanor K Karlsson3, Robert R West1, David W Russell4,5 and Dennis D Hickstein1 Experimental Transplantation and Immunology Branch, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, ­ aryland, USA; 2Hematology Section, Department of Laboratory Medicine, NIH Clinical Center, Bethesda, Maryland, USA; 3Division of Veterinary M Resources, Office of Research Services, National Institutes of Health, Bethesda, Maryland, USA; 4Division of Hematology, Department of Medicine, University of Washington, Seattle, Maryland, USA; 5Department of Biochemistry, University of Washington, Seattle, Maryland, USA 1

The development of leukemia following gammaretroviral vector-mediated gene therapy for X-linked severe combined immunodeficiency disease and chronic granulomatous disease (CGD) has emphasized the need for long-term follow-up in animals treated with hematopoietic stem cell gene therapy. In this study, we report the long-term follow-up (4–7 years) of four dogs with canine leukocyte adhesion deficiency (CLAD) treated with foamy viral (FV) vector-mediated gene therapy. All four CLAD dogs previously received nonmyeloablative conditioning with 200 cGy total body irradiation followed by infusion of autologous, CD34+ hematopoietic stem cells transduced by a FV vector expressing canine CD18 from an internal Murine Stem Cell Virus (MSCV) promoter. CD18+ leukocyte levels were >2% following infusion of vector-transduced cells leading to ongoing reversal of the CLAD phenotype for >4 years. There was no clinical development of lymphoid or myeloid leukemia in any of the four dogs and integration site analysis did not reveal insertional oncogenesis. These results showing disease correction/amelioration of disease in CLAD without significant adverse events provide support for the use of a FV vector to treat children with leukocyte adhesion deficiency type 1 (LAD-1) in a human gene therapy clinical trial. Received 2 October 2012; accepted 30 January 2013; advance online publication 26 March 2013. doi:10.1038/mt.2013.34

Introduction

Foamy viral (FV) vectors are currently being investigated for the treatment of a number of diseases, including leukocyte adhesion deficiency type 1 (LAD-1),1 β-thalassemia,2 Wiskott– Aldrich syndrome (WAS),3 and chronic granulomatous disease (CGD).4 FV vectors possess several advantages over standard gammaretroviral vectors including wide tropism,5 large packaging capacity,6 increased stability in quiescent cells,7 and lack of

pathogenicity.8 The development of leukemia in X-linked severe combined immunodeficiency disease (X-SCID)9 and WAS,10 and the development of myelodysplastic syndrome (MDS) in CGD11 have helped accelerate development of self-inactivating vectors, including self-inactivating FV vectors for use in human gene therapy. We investigated the use of FV vectors for treating dogs with canine leukocyte adhesion deficiency (CLAD). CLAD dogs recapitulate the phenotype of LAD-1 in humans.1,12 Children with LAD-1 and dogs with CLAD suffer from severe, recurrent bacterial infections due to the lack of CD11/CD18 on the neutrophil surface, thus preventing neutrophil migration to the sites of infection and inflammation.13 Consequently, patients with LAD-1, as well as dogs with CLAD, typically die at an early age from bacterial and fungal infections.14 CLAD represents a model system for gene therapy for several reasons: only a small fraction of corrected neutrophils (1–2%) in circulation is required to reverse the severe phenotype,15,16 corrected leukocytes in the peripheral blood are easily monitored by flow cytometry, and clinical improvement is easily gauged. In addition, the life span of the dog allows long-term observation. The latter is important in that the leukemia that developed in X-SCID and WAS gene therapy patients arose 2–6 years following the infusion of genecorrected cells. In the current studies, we report the long-term follow-up (4–7 years) of four CLAD dogs following gene therapy using a FV vector. We previously reported our studies for all four dogs at 2 years after infusion,1 indicating short-term correction of CLAD disease with a less potentially oncogenic insertion profile by the FV vector than a gammaretrovirus-based vector. All four dogs have had continued clinical improvement from a CLAD phenotype, with leukocyte correction levels ranging from 3 to 14%. We found no clinical evidence of leukemia or MDS in any dog, and limited insertion site analysis did not indicate a significant increase in potential insertional oncogenesis over time or evidence of clonal dominance resulting in a significant growth advantage to the transduced cells.

The last two authors contributed equally to this work. Correspondence: Dennis D Hickstein, ETIB/NCI/NIH,10 Center Dr, MSC1203, Bldg 10-CRC, Rm 3-3142, Bethesda, MD 20892, USA. E-mail: [email protected]

964

www.moleculartherapy.org vol. 21 no. 5, 964–972 may 2013

© The American Society of Gene & Cell Therapy

Follow-up of FV Vector Gene Therapy for CLAD

FD4

70 60

‡

50 ‡

40 30 20 10

0

1

2

3

4

5

6

0

7

0

1

FD2

0

1

2

3

4

2

3

4

5

6

7

TD1

70 60 50 40 30 20 10 0

‡

0

1

Years after infusion

%CD18

%CD18

Years after infusion 70 60 50 40 30 20 10 0

%CD18

FD1 Neutrophils T-lymphocytes Monocytes

BM transplant

5

6

7

70 60 50 40 30 20 10 0

FD3

‡

0

1

Years after infusion

2

3

4

5

Years after infusion

2

3

4

5

6

7

Years after infusion

%CD18

70 60 50 40 30 20 10 0

%CD18

%CD18

Gene therapy

6

7

70 60 50 40 30 20 10 0

TD2

0

1

2

3

‡

4

5

6

7

Years after infusion

Figure 1  Myeloid and lymphoid chimerism after gene therapy or transplantation. The percentage of CD18+ neutrophils (square), CD14+ monocytes (triangle), and CD3+ T-lymphocytes (circle) was determined by flow cytometry at the designated time points after treatment. Y axis represents the percentage of CD18+ corrected cells, whereas the X axis represents the time (years) after infusion. Double-crosses represent end-of-experiment time points for the designated animals.

a

‡

FD1 FD2 ‡

FD3

‡

FD4 0

6

12

18

24

30

36

42

48

54

60

66

72

78

84

Time (month) after birth

b

80 FD1‡

WBC count (× 103/ul)

70

FD2

60

FD3‡

50

FD4‡

40 30 20 10 0 −3 0

6

12 18 24 30 36 42 48 54 60 66 72 78 84 Time (month) after infusion

Figure 2 Clinical course and white blood counts of treated animals. (a) The times at which each transplanted animal had infectious episodes, as indicated by fever, intensive care, and/or parenteral antibiotics, are shown from 90 days before receiving gene therapy until the latest time point or the end of study (indicated by a double-cross) and indicated by the shaded boxes. (b) The peripheral blood white blood cell (WBC) counts are shown for each transplanted animal over the same time period. The normal WBC range for dogs is shaded in the figure. Each horizontal line represents the follow-up of an animal (ar row represents ongoing follow-up), with the day of infusion indicated by the filled triangle.

Results CD18+ leukocytes in the peripheral blood following FV vector gene therapy

CD18+ lymphocytes, monocytes, and neutrophils were present in the blood in all four CLAD dogs within a few weeks following Molecular Therapy vol. 21 no. 5 may 2013

infusion of transduced CD34+ cells, as previously shown.1 These levels were sustained, albeit at low levels in some subsets, for >4 years following infusion (Figure 1 and Supplementary Figure S1 and Supplementary Table S1). The numbers of CD18+ lymphocytes, primarily CD3+ T cells, gradually increased over time, even up to 7 years after infusion (Figure 1 and Supplementary Figure S1b). Two CLAD dogs who received allogeneic bone marrow cells from a normal matched littermate, TD1 and TD2, also displayed increased CD3+ CD18+ T cells, as did all of our previously transplanted CLAD dogs.15 These results are consistent with the role of the CD11/CD18 as a costimulatory molecule for T-cell receptor (TCR) activation and proliferation, as postulated previously.17–19 The levels of CD18+ cells in the myeloid compartment (monocytes and neutrophils) in the FV vector-treated CLAD dogs were stable over time for FD2 and FD3, however there was a decrease in myeloid chimerism levels over 2–4 years in two FV-treated dogs (FD1 and FD4). Despite this decrease in the CD18+ neutrophil levels, these levels were sufficient for reversal of the CLAD phenotype.15,16 We have previously reported that CD18+ neutrophil levels in the peripheral blood may underestimate the total available CD18+ neutrophils due to selective extravasation of the CD18 expressing neutrophils to external surfaces, a phenomenon that is particularly enhanced in dogs with lower CD18+ neutrophil levels.15 To assess this possibility, we obtained bone marrow samples at the time of necropsy for FD1 and FD4. Analysis of progenitor cells in the bone marrow showed increased CD34+ CD18+ levels versus neutrophil CD18+ levels in the peripheral blood, supporting the selective extravasation theory (Supplementary Table S1).

Clinical correction of CLAD with FV vector gene therapy All four dogs had sustained reversal of the CLAD phenotype—a syndrome of recurrent, life-threatening bacterial 965

© The American Society of Gene & Cell Therapy

Follow-up of FV Vector Gene Therapy for CLAD

a

b

c

d

Figure 3  Bone marrow aspirate and biopsy taken from FV vector-treated CLAD dogs FD1 (a) and FD2 (b) at 4–5 years after therapy. Bone marrow aspirates show normal myeloid and erythroid development with no increase in immature myeloid cells (Wright Giemsa, 500X). Bone marrow biopsies have normal cellularity with megakaryocytes present in the center of each section (hematoxylin and eosin, 500X).

infections—over 4–7 years of follow-up (Figure 2a). Although each of the dogs had episodes of infection, some of which required parenteral antibiotics, no dog died or was euthanized due to CLAD. Of note, none of the four dogs had recurrence of hypertrophic osteodystrophy or cranial mandibular osteodystrophy, which are hallmarks of severe CLAD.12,20 All dogs were housed in normal runs with littermates. Comparison of the clinical course of the treated CLAD dogs with a cohort of normal dogs was not possible, because we derived our CLAD dogs from the breeding of two previously treated CLAD animals; thus, only CLAD affected animals were produced. All four FV vector-treated CLAD dogs maintained normal white blood cell (WBC) counts, except in the presence of brief episodes of infection where leukocytosis is a normal physiologic response (Figure  2b). In contrast, untreated CLAD dogs had extremely elevated WBC counts and succumbed to infection within 6 months of age.1,21 Of note, none of the treated dogs required blood product support at any time following transplant due to irradiation, infection, or other pathological state, maintaining normal platelet and RBC levels.

Bone marrow aspirate and biopsies on FV vectortreated CLAD dogs Three of the four dogs had a bone marrow aspiration and biopsy. All aspirates and biopsies showed normal cellularity with normal myeloid and erythroid maturation and no increase in blasts. Results for two dogs are shown (Figure  3) at approximately 5 years after infusion. Similar results were seen in FD1 at the time of euthanasia at 7 years of age (data not shown). 966

Clinical observations Three of the four dogs either sired or delivered litters following gene therapy. FD1 sired two litters, one with FD4. FD2 sired four litters at 1, 2.5, 3.5, and 4.5 years after gene therapy. These results extend our previous studies indicating that 200 cGy total body irradiation does not impair fertility of male or female CLAD dogs.22 Three of the four dogs were euthanized following the end of the study. FD3 was euthanized after 4.5 years of follow-up, because he had been neutered previously, and thus could not contribute further to the development of the colony. FD4 was euthanized at 4.5 years of follow-up, because her “coefficient of inbreeding” to the remaining males in the colony was unacceptably high. FD1 sired two litters earlier in life and was euthanized at 7 years of age, because he was no longer an active breeding male. FD2 had the highest genetic diversity to our breeding colony, and he remains an active breeder. Necropsies were performed on all three dogs that were euthanized. In one dog, FD1, a pancreatic β cell carcinoma was detected, with metastasis to the liver and mesenteric lymph nodes. This type of cancer has been found in normal dogs and is not derived from hematopoietic cells.23,24 To determine if the carcinoma was due to insertional oncogenesis, we examined tissue from the carcinoma for the presence of FV vector. Leukocyte-free areas of carcinoma tissue were obtained by laser capture micro dissection, and genomic DNA was isolated and subjected to PCR amplification using FV vectorspecific primers. Whereas all tissues yielded positive results using a control set of primers against CD4 (Figure  4), indicating PCR amplifiable material was present, tissue from the carcinoma and www.moleculartherapy.org vol. 21 no. 5 may 2013

© The American Society of Gene & Cell Therapy

Follow-up of FV Vector Gene Therapy for CLAD

prostate from FD1, and peripheral blood leukocytes (PBL) from an uninfected dog, were all negative for vector DNA (Figure  4), indicating the carcinoma was not due to insertional oncogenesis. In contrast, DNA samples from a mandibular lymph node and PBL from FD1 at the time of necropsy were positive for the presence of vector, even when diluted 250-fold (data not shown), as expected due to the presence of transduced cells (Figure 4).

M 200 bp

100 bp FV

Figure 4  Analysis for the presence of FV vector DNA in carcinoma and control tissues. PCR of DNA from tissue samples from pancreatic carcinoma (carcinoma), prostate (prostate), mandibular lymph node (lymph node) and peripheral blood leukocytes (PBL) from FD1 at time of necropsy, and from peripheral blood leukocytes from an untreated dog (untreated). PCR was performed with canine CD4 specific primers (CD4) or FV vector-specific primers (FV). Water (H2O) was used as a cross-contamination control. M indicates 100 bp ladder. The gel picture was inverted and levels were globally adjusted to darken the image.

29.4%

38%

30.9%

11.3%

13.3%

27.5%

38.5%

22.7%

36.5%

29.6%

20.5%

25.5%

21.3%

24.9%

58.2%

48.8%

27.1%

16.6%

10.1%

14%

17.8%

12.8%

54.9%

42.6%

39.1%

30.3%

CD4 CD8

TCRαβ

CD8

b

33%

CD45RA

19%

CD4

a

TCRαβ

CD4

Integration site analysis DNA was isolated from PBL at 4 years (FD3, FD4), 5.5 years (FD2), or 6 years (FD1) after infusion (Supplementary Table S2). A total of 440 unique insertion sites (IS) were recovered for these later time points using linear amplification-mediated PCR (LAM-PCR) (Supplementary Tables S2 and S3). DNA samples were also obtained from sorted T-lymphocytes and neutrophils at 6 years (FD2) and 6.4 years (FD1) after infusion. A total of 78 unique IS in neutrophils were found, and 172 unique IS for lymphocytes were identified for these later time points. The dearth of recoverable IS from sorted neutrophils from FD1 may represent lack of available clones due to a diminishing corrected pool, rather than an increase in monoclonality due to a transformation event. The number of duplicate clones recovered per dog from all cell sources and time points was highest for FD1, again suggesting a diminishing pool of obtainable IS. For comparison, FD1 had the lowest clonal diversity (total clones recovered/unique clones), with an average of 3.24 clones per recovered insertion site, followed by FD4 with 2.15 clones, FD3 with 1.765 clones, and FD2 with 1.595 clones, which correlates well with the leukocyte marking levels at the time of genomic DNA isolation. In total, we found that 73 out of 644 unique IS (11.3%) at 4–6 years were maintained from earlier time points. Three IS that were previously tracked27 were identified at later time points, two from FD1 (FD1-3, FD1-4), and one from FD4 (FD4-1). The two IS from FD1 were present in a large number of recovered sequences (Supplementary Table S3), although the nearby genes for FD1-3 and FD1-4, NBN and SYNJ2BP, are not thought to be involved in oncogenesis.27

CD45RA

H2O

Untreated

PBL

Lymph node

Prostate

H2O

Carcinoma

Untreated

PBL

Lymph node

Prostate

M

Carcinoma

T-lymphocyte subsets show normal distribution In human patients who developed T-cell ALL following X-SCID gene therapy, there was a marked restriction of the T-cell phenotype of the emergent clones: an immature CD4−CD8− T-cell phenotype was present in patients P4, P7, and P10.9,25 We examined the T-cell subsets in the peripheral blood taken in our CLAD dogs at 6 years after infusion for CD4/CD8 expression, along with expression of the TCRαβ and CD45RA (naïve). T-lymphocyte analysis for two dogs, FD1 and FD2, indicated that neither dog displayed evidence of clonal expansion of T cells with an immature CD4+ CD8+ phenotype (Figure 5a,b). In addition, there was no clonal expansion of CD18+ cells with a CD45RA+ (naïve) phenotype. Nearly, all T cells were TCRαβ+ with no difference in CD18+ or CD18− populations. One notable observation for all treated dogs

was the continued presence of a small population of CD3+ T cells in the peripheral blood expressing higher levels of CD18. These CD18+hi CD3+ T cells, which are mainly CD4− CD8+ CD45RA+ and TCRαβ+, were also seen at 2 years,1 and as previously reported, are indicative of a normal, physiological, antigen-driven process rather than a pathological condition.26 These CD18+hi CD8+ T cells are also seen in the peripheral blood of normal dogs, where a large fraction of CD8+ T cells express higher levels of CD18 than CD4+ T cells (Supplementary Figure S2).

2.1%

CD18 expression

1.1%

1.8%

0.7%

CD18 expression

Figure 5 T-cell subpopulations in the peripheral blood after infusion. Peripheral blood obtained from (a) FD1 and (b) FD2 was obtained at 6.5 years and 6 years after infusion, respectively, and immunostained for CD18 expression and one of four T-cell markers: CD4, CD8, CD45RA, and TCRαβ. Lines indicate positive or negative populations with percentages noted for each quadrant.

Molecular Therapy vol. 21 no. 5 may 2013

967

© The American Society of Gene & Cell Therapy

Follow-up of FV Vector Gene Therapy for CLAD

b

a

c

PMN

PBL Within 15 kb Tx start sites

RND

1 year 4–6 years 1 year 4–6 years RND

Within genes

1 year 4–6 years RND

In/near 30 kb oncogenes 0

5

Within 15 kb Tx start sites

2 years 6 years 2 years

Within genes

6 years

In/near 30 kb oncogenes

2 years 6 years 0

10 15 20 25 30 35 40 45

5

Lymphocytes Within 15 kb Tx start sites

2 years 6 years 2 years 6 years

Within genes

2 years 6 years

In/Near 30 kb oncogenes 0

10 15 20 25 30 35 40 45

5

10 15 20 25 30 35 40 45 % Of IS sites

% Of IS sites

% Of IS sites

Figure 6  Integration sites in FV vector-treated dogs. The percentage of all integration sites within 15 kb of transcriptional (Tx) start sites, within genes, and within 30 kb of human oncogenes are shown for (a) peripheral blood leukocytes (PBL) 1 year after transplant (1 year), 4–6 years after transplant (4–6 years), and computer-generated random sites (RND); (b) sorted neutrophils (PMN); and (c) sorted lymphocytes. IS, insertion sites. Table 1 Summary of significant gene ontology categories. Early time pointsa

Late time pointsb

Gene hitsc

Total genesd

%

Gene hits

Total genes

%

Significancee

  Regulation of RNA metabolic process

 82

635

12.91

 36

678

5.31

1.7 × 10−6

  Regulation of transcription, DNA  dependent

 79

635

12.44

 35

678

5.16

3.1 × 10−6

  Ion binding

218

635

34.33

136

678

20.06

6.3 × 10−9

  Transition metal ion binding

143

635

22.52

 75

678

11.06

3.1 × 10−8

  Cation binding

211

635

33.23

135

678

19.91

4.6 × 10−8

  Metal ion binding

210

635

33.07

135

678

19.91

6.3 × 10−8

  Zinc ion binding

116

635

18.27

 64

678

9.44

4.1 × 10−6

  Transcription regulator activity

 79

635

12.44

 40

678

5.90

4.6 × 10−5

  Transcription factor activity

 50

635

 7.87

 20

678

2.95

7.0 × 10−5

Biological process categories

Molecular function categories

Genes found in or near IS in peripheral blood leukocytes from dogs at 1–2 years after infusion. Genes found in or near IS in peripheral blood leukocytes from dogs at 4–7 years after infusion. cGenes found in proximity to IS sites for a particular category. dTotal genes found in proximity to all IS sites which may or may not be categorized. eSignificance is calculated by dividing 0.05 significance level from two-tailed Fishers exact test by the total number of terms for the particular category (Bonferroni correction). The total number of terms for biological processes was 1,144, so the adjusted significance level is 4.4 × 10−5. The total number of terms for molecular functions was 312, so the significance level was 1.6 × 10−4. a

We found no significant differences between the early and long-term IS from the peripheral blood in regards to sites near transcription start sites, within genes, or near oncogenes (Figure 6a). IS from sorted polymorphonuclear or lymphocytes also did not demonstrate significant differences between early and later time points (Figure 6b,c). In contrast to the CGD trial, only six insertions near the MECOM locus were recovered, three from a total of 884 unique insertions from early time points and three from 644 unique IS insertions from the later time points. No insertions were found near PRDM16 or SETBP1. Similarly, no insertions were found near LMO2, which has been implicated in leukemogenic transformation in X-SCID and WAS, although IS clones were found near CCND2.10,25 It is possible that some clones were missed due to the technical limitations of the LAM-PCR technique.10 To examine whether the IS found in later time points conferred a survival advantage, we performed gene ontology analysis to search potential gene class differences between genes found near early time points versus those found near late time points. 968

b

After applying Bonferroni correction for multiple comparisons,28 genes involved in ion binding or transcription activity were significantly different between the two time points (Table  1), with an unexpectedly higher representation of these genes involved in the early time points rather than late time points, despite a greater number of genes for late time point IS (635 hits in early time points, 678 hits in late time points). However, these gene classes were not involved in oncogenesis, and likely contributed a modest, if any, survival advantage.

Discussion

This study represents the longest follow-up of a single cohort of  dogs treated with FV vector-mediated gene therapy. Four CLAD dogs were followed for 4–7 years after gene therapy, and all four dogs maintained gene-corrected neutrophil levels sufficient to prevent the CLAD phenotype. Although there was a consistent elevation of CD18+ T-cell levels over time, there was no evidence of either a T cell or myeloid leukemia as demonstrated by normal white blood counts outside infectious episodes, normal T-cell www.moleculartherapy.org vol. 21 no. 5 may 2013

© The American Society of Gene & Cell Therapy

subsets, and normal tri-lineage hematopoiesis in bone marrow aspirates and biopsies. Comparison of vector IS did not demonstrate significant differences in the locations of IS between early and late time points, although clonal diversity decreased with lower leukocyte correction percentages. These results provide support for the use of FV vectors for the treatment of hematopoietic diseases. Since the development of leukemia in a X-SCID gene therapy trial in 2003,9 a concerted effort has been made to develop alternative vectors for the treatment of hematopoietic diseases. Towards this end, we have developed FV vectors1,29 and lentiviral (LV) vectors30–32 for the treatment of dogs with CLAD. Although we did not observe leukemic transformation in two CLAD dogs treated using a gammaretroviral vector followed for 5 years (the only two dogs with >3 years follow-up, unpublished),33 we noted a greater propensity by the gammaretroviral vector compared with the FV vector to integrate near oncogenes.1,34 Of note, in studies by Zhang and colleagues, two of two dogs developed leukemia approximately 2 years after the use of a gammaretroviral vector harboring a HOXB4 expansion gene, demonstrating the capability of dogs to develop leukemia.35 In addition, the shorter ex vivo exposure time of hematopoietic stem cells to FV or LV vectors during transduction may also contribute to fewer pathogenic IS; the extended culture techniques required for transduction by gammaretroviral vectors appear to favor integrations near known oncogenes such as MDS-EVI1.36 The development of T-cell ALL in gene therapy clinical trials in five patients with X-SCID, T-cell ALL in patients with WAS, and MDS in two patients with CGD, has emphasized the oncogenic potential of gammaretroviral vectors. Moreover, clonal dominance after the use of a LV vector for human gene therapy of β thalassemia has been recently reported.37 In the X-SCID trial by Fischer and colleagues, T-cell ALL developed 30–68 months after infusion of transduced cells.25 Pathological symptoms were apparent, with hepatosplenomegaly, highly elevated WBCs, and 90–95% lymphoblasts. In the X-SCID trial by Thrasher and colleagues, a T-cell ALL in one patient showed similar pathophysiology with development of apparent leukemia at 24 months after infusion.38 That clinical trial was notable for abdominal distension and high WBC counts with circulating blasts (>400,000/ul). In contrast to these studies, at no time did any of the treated CLAD dogs develop hepatosplenomegaly, a persistently elevated WBC count (Figure  2b), or the presence of blasts in either the bone marrow (Figure 3a,b) or peripheral blood (data not shown). There are several possibilities to explain the lack of oncogenicity in the presence of a selective advantage for CD18+ T cells. First, CD18 can only be expressed on the surface of leukocytes as a heterodimer with a CD11 partner chain, thus limiting its activity to more differentiated cells. Although IL-2Rγ is expressed on cells as a partner for several different proteins (IL-2R, IL-4R, IL-7R, IL-9R, IL-15R, IL-21R), the dysregulated expression at earlier time points may contribute to its pathogenicity, which when coupled to a very strong selection bias, leads to nearly 100% corrected CD3+ T cells in the peripheral blood of treated patients.39 In contrast, we have observed <25% CD18+ T-cell levels for nearly all dogs treated using any gene therapy regimen at 12 months after infusion, indicating a slow, antigen-driven process.1,29–32 Molecular Therapy vol. 21 no. 5 may 2013

Follow-up of FV Vector Gene Therapy for CLAD

The stage at which selection occurs may also play a role in the absence of oncogenicity in that CD18+ cells undergo selection only after antigenic stimulation of mature T cells. The lack of oncogenicity in ADA-SCID gene therapy trials may be due to a selection bias occurring only at a late stage of T-cell development, even in the presence of IS sites near LMO2.40,41 The lymphoblasts in three of the patients with X-SCID developing T-cell ALL were of an immature T-cell phenotype, with a clonal CD4− CD8− population in patients.9,25 Clonal populations of a CD4− CD8+ phenotype were present in patient 5,9 and a CD4+ CD8+ clonal population in one patient with X-SCID.38 Examination of CD4 and CD8 subsets in FV-treated CLAD dogs did not show evidence of clonal expansion towards any of these cell phenotypes. Despite finding some IS in the MECOM locus in our study, none of the dogs developed any symptoms of MDS. Insertions near the MECOM locus did not appear to provide a selective advantage, consistent with earlier tracking results,27 and only single clones were obtained. In the gene therapy trial for X-CGD by Grez and colleagues,42 two patients treated with gammaretroviral vectors showed a rapid clonal proliferation within 5 months of when cells containing IS near MECOM, PRDM16, and SETBP1 were detected. However, by 15 months, patient 1 had declining WBC and platelet levels, and decreasing cellularity in the bone marrow.11 By 43 months after infusion, the patient had severe bone marrow hypocellularity, and multilineage dysplasia. In contrast, bone marrow aspirates taken from treated CLAD dogs showed normal marrow cellularity with multilineage differentiation. WBC counts never decreased below normal levels for any dog following engraftment. In addition, there were no clinical signs of chronic, severe anemia or thrombocytopenia in any of the FV vector-treated dogs, and hematocrits and platelet counts were within normal ranges. Our analysis of the gene ontology for genes found near IS indicated some differences between early and late time points, with overrepresentation of ion binding class (including metal, cation, and zinc ions) and transcription activity/regulation classes for earlier time points. It is possible that these gene classes may play a more important role in the initial engraftment process, leading to their overrepresentation in earlier time points than later time points, possibly via insertional activation, without leading to pathogenic consequences. Gene ontology and pathway analysis from other studies have hinted at potential roles of the vector and/ or transgene in influencing gene expression near IS, such as in an ADA-SCID gene therapy trial43 with overrepresentation of protein binding molecular function gene classes, and pretransplant versus posttransplant analysis in X-SCID gene therapy trials44,45 suggesting overrepresentation of phosphorus metabolism, transferase activity, receptor signaling, and DNA binding in pooled RIS. The influence of particular clones have also been studied using clonal tracking of RIS over time.46 These types of studies may help identify not only particularly troublesome clones, but may also indicate cooperation or influence of vector elements (enhancers, promoters, etc.) and/or therapeutic transgenes on cellular function. Finally, our studies indicate that viral promoters in the context of FV vectors may have reduced oncogenic potential due to diminished activation of neighboring genes, in agreement with in vitro studies.47 In addition, LV vectors may have a higher read-through transcription in comparison with FV vectors,47,48 which may contribute to a higher 969

Follow-up of FV Vector Gene Therapy for CLAD

oncogenic potential from LV vectors. Our studies in CLAD using alternative cellular promoters such as PGK, EF1a, CD18 promoter, and CD11b promoter have shown that the cellular promoters direct low levels of expression of CD18 when used in LV or FV vectors.29–32 Vectors with these promoters will require higher copy numbers per cell, and hence a higher multiplicity of infection, for therapeutic expression in neutrophils. Thus, a viral promoter such as the MSCV LTR could allow efficient expression of CD18 in neutrophils at lower multiplicity of infections, and may be the optimal choice for human LAD-1 gene therapy trials. The current limiting step in FV vector-based human gene therapy trials has been the production of large quantities of FV vector sufficient to treat patients, and with additional safety testing due to its novel nature, in contrast to a LV vector-based study, which could be first initiated in HIV clinical trials (e.g. NIH OBA Protocol 0107-488). In conclusion, these results demonstrate the utility of a FV vector harboring the MSCV internal promoter driving CD18 expression. All four dogs survived >4 years free of CLAD disease, displayed no evidence of leukemia or increased oncogenicity from the FV vector. These studies, along with several current preclinical studies in other animal models, demonstrate the potential of FV vectors to treat human hematopoietic diseases such as LAD-1.

Materials and Methods

Animals. The NCI Institutional Animal Care and Use Committee approved

all animal protocols. CLAD animals were treated prophylactically with oral amoxicillin/potassium clavulanate upon diagnosis of CLAD. More intensive treatment with oral or parenteral antibiotics, fluids, and analgesics were provided when necessary.

Animal procedures. Peripheral blood samples were obtained at multiple

time points, and cell counts and differentials were performed at a commercial laboratory (Antech Diagnostics, Lake Success, NY) or at the National Institutes of Health Clinical Center laboratory.

Flow cytometry. CD18 expression was measured by flow cytometry with a mouse antibody to canine CD18 (CA1.4E9; AbD Serotec, Raleigh, NC). Neutrophil and monocyte populations, as well as lymphocyte subsets, were analyzed at various time points using specific antibodies to ACKlysed peripheral blood samples (CD3, CA17.2A12: AbD Serotec; CD4, YKIX302.9: AbD Serotec; CD8, YCATE55.9: AbD Serotec; CD14, TUK4: Dako; CD21, CA2.1D6: AbD Serotec; CD45RA, CA4.1D3: AbD Serotec; dog neutrophils, CADO48A, VMRD (Pullman, WA); TCRαβ, CA15.8G7: Dr Peter Moore, UC Davis) as previously described.15 Fluorescence-activated cell sorting. Sorting for CD18+ leukocytes was performed with an antibody to canine CD18 (CA1.4E9; AbD Serotec) conjugated with AlexaFluor 647. Leukocyte subsets were sorted for T cells using an antibody to canine CD3 (CA17.2A12; AbD Serotec) conjugated to FITC, and for granulocytes using a high side-scatter profile and CD3 negative gating. CD3+ sorted cell purities for FD2 were 93% CD3+, 95% CD18+. Sorted granulocyte purities for FD1 were 99% CD3 negative and high SSC. CD3+ sorted cell purities for FD1 were 97% CD3+ and 97% CD18+. Sorted granu-

locyte purities for FD1 were 99% CD3 negative and high SSC. Labeled cells were sorted using a BD BioSciences Influx running BD Sortware ver 1.0 (BD BioSciences, San Jose, CA), 70 micron nozzle, 40 KHz frequency, and equipped with a 488 nm Sapphire laser at 200 mW and a 628 nm red fiber laser at 100 mW.

Bone marrow cores and aspirates. Core biopsies and aspirates were obtained from FD1 and FD2 at approximately 5 years after infusion. Core

970

© The American Society of Gene & Cell Therapy

biopsies were decalcified and fixed in a B5 formalin solution with subsequent tissue processing (Tissue Tek, Sakura Finetek USA, Torrance, CA), paraffin embedding, and serial 4 micron sectioning. Core biopsy sections were stained with hematoxylin and eosin. Wright Giemsa staining of aspirate smears was performed using a Midas III stainer (EMD Chemicals, Gibbstown, NJ). Photographs of core biopsy sections and aspirate smears were taken on an Olympus BX41 microscope with an Olympus DP20 camera (Olympus America, Center Valley, PA). Laser capture microdissection and DNA extraction from paraffin­embedded dog tissues. Routine full necropsy was performed on FD1

with tissues collected, fixed in formalin, paraffin embedded, and sections were hematoxylin and eosin stained for histologic analysis (Division of Veterinary Resources, Office of Research Services, National Institutes of Health). Unstained formalin-fixed tissue sections of 7 micron were prepared from paraffin-embedded blocks (Histoserv, Gaithersburg, MD) on PEN-membrane glass slides (Fisher Scientific, Pittsburg, PA) and routinely processed for hematoxylin staining. Histologically identified leukocyte-free areas of the pancreatic carcinoma and prostate (negative control), and areas of a mandibular lymph node (positive control), were individually collected with an LMD 6000 microdissection system (Leica Microsystems, Bannockburn, IL). DNA specimens from microdissected tissues were extracted with an Ambion RecoverAll Total Nucleic Acid Isolation Kit (Life Technologies, Grand Island, NY) according to the manufacturer’s protocol. DNA concentrations were determined with a Nanodrop spectrophotometer (ThermoScientific, Wilmington, DE). PCR amplification of FV vector and CD4. DNA isolated from laser cap-

ture microdissection tissues in addition to genomic DNA isolated from PBL from FD1 at necropsy using a Wizard genomic DNA purification kit (Promega, Madison, WI), and DNA from PBL of an untreated normal dog, were subjected to PCR amplification for the presence of a control gene (CD4) and FV vector. DNA of 25 ng was amplified for CD4 using 20 pmol of forward primer dCD4-F1 (5′-GCTGAAGCATCGTGTTGAATCG-3′) and reverse primer dCD4-R1 (5′-CCTCTTGCCTCTTGTCTGTGTCAC-3′), 1 unit of Platinum Taq High Fidelity Polymerase (Life Technologies) with cycling conditions of an initial denaturation at 94 °C for 2 minutes, 50 cycles of exponential amplification (94 °C for 30 seconds, 55 °C for 30 seconds, 68 °C for 60 seconds), and a final extension at 68 °C for 2 minutes, with an expected product size of 125 bp. For FV vector detection, amplification conditions were performed identically except for the substitution of FV vector specific forward primer FV-Int-F1 (5′-CCTGCTTCTTTGAGACCTCGTTG-3′) and reverse primer FV-IntR1A (5′-TGGTGGTGCCATTCTGATGAG-3′), with an expected product size of 151 bp. PCR products were electrophoresed in a 1.5% agarose gel and 1X TBE buffer. The gel image was obtained using a UVP Biochemi system (UVP, Upland, CA) using Labworks imaging and analysis software using a 12-bit collection mode.

Isolation of FV vector IS by LAM-PCR. Genomic DNA was purified using a blood and cell culture DNA kit (Qiagen, Valencia, CA) or Wizard genomic DNA purification kit (Promega) according to the manufacturer’s directions. We performed LAM-PCR as previously described with modifications.1,29 The junction sequence between the viral LTR and the host genome was linear amplified using 0.25 pmol of the FV vector-specific 5′ biotinylated primer FV-LAM-Linear-1 [5′–GAACCTTGTGTCTCTCATCCC–3′] with 1.3 units of Taq polymerase (Qiagen) with cycling conditions of initial denaturation at 95 °C for 1 minute, 50 cycles of amplification (95 °C for 15 seconds, 55 °C for 30 seconds, 72 °C for 60 seconds), and a final extension at 72 °C for 3 minutes. Reaction products were subjected to additional linear amplification by the addition of 1.3 units of Taq polymerase with the same cycling parameters. Samples were enriched for insertions using magnetic bead capture (Dynabeads M-280 Streptavidin; Life Technologies). Enriched products underwent second strand synthesis www.moleculartherapy.org vol. 21 no. 5 may 2013

© The American Society of Gene & Cell Therapy

using hexanucleotide priming (Hexanucleotide mix, 10X concentration; Roche Diagnostics, Indianapolis, IN) and extension using Klenow (Roche). Double stranded products were restriction enzyme digested using 10U of TasI (New England Biolabs, Ipswich, MA). Restriction enzyme digested products were ligated to a linker cassette (LamLinker-US 5′-GACCCGG GAGATCTGAATTCAGTGGCACAGCAGTTAGG-3′; LAMLinker-BSTAS 5′-AATTCCTAACTGCTGTGCCACTGAATTCAGATC-3′) using a Fast-Link DNA Ligation kit (Epicentre Biotechnologies, Madison, WI). Ligated products were denatured and single-stranded ­ product was subjected to PCR. Exponential amplification of products was  performed using 12.5 pmol each of FV vector-specific primer FV-LAM-LTR [5′–GTCTATGAGGAGCAGGAGTA–3′] and linker cassette-specific primer LAMLink-PCR [5′–GACCCGGGAGATCTGAATTC–3′] with 1.3 units of Qiagen Taq polymerase with cycling conditions of initial denaturation at 95 °C for 1 minute, 35 cycles of amplification (95 °C for 30 seconds, 58 °C for 30 seconds, 72 °C for 45 seconds), and a final extension at 72 °C for 3 minutes. Eight percent of the first exponential PCR reaction was then used as template for a second, nested PCR amplification using 12.5 pmol each of nested FV vector-specific primer FV-LAM-LTRNest [5′- CCTCCTTCCCTGTAATACTC–3′] and nested linker cassette-specific primer LAMLink-PCRNest [5′- AGTGGCACAGCAGTTAGG–3′] using conditions identical to the first PCR. PCR reactions were purified using a Qiaquick PCR Purification Kit (Qiagen) and cloned into a pCR4-TOPO or pCR2.1-TOPO vector using a TOPO TA cloning kit (Life Technologies). DNA sequencing was performed on positive colonies. It is estimated that 177 IS are present per 100 ng LAM-PCR reaction per 1% transduced cells. DNA sequencing of clones was performed until the number of unique IS approximately equaled the earlier 1–2 year timepoints to allow statistical comparison. Integration site analysis. Provirus junctions from LAM-PCR clones were examined for the presence of the PCR primer and 5′LTR sequences. Integrations were considered valid if the end of the 5′LTR was not >3 bp from the matching genomic sequence within the integration, there was at least 90% homology to the canine genome, <95% score to second best hit, and 20 bp of matching genomic sequence. Integration sites were analyzed with custom Perl script programs. Integration sites were identified using BLAT to UCSC Blat server with Dog genome assembly May 2005 (Broad canFam2). Functional analysis of genes near integration sites was performed using the DAVID Informatics Database (http://niaid.abcc. ncifcrf.gov/home.jsp) after removing duplicates and overlapping genes with the same orientation. The remaining Entrez Gene identifiers were submitted to the DAVID website. For ontology analysis, only those terms within either the biological process or molecular function categories were used. The resulting hits within specific terms were corrected for multiple entries. Statistical analysis. We performed statistical analysis comparing differ-

ences between early and late time point IS near transcription start sites, within genes, and near oncogenes using a two-tailed Fisher’s Exact test for significance (α = 0.05). Significance for gene ontology terms was corrected for multiple comparisons using a Bonferroni correction.28 The total number of terms for biological processes was 1,144, so the adjusted significance level was α = 4.4 × 10−5. The total number of terms for molecular functions was 312, so the significance level was α = 1.6 × 10−4.

SUPPLEMENTARY MATERIAL Figure S1.  Leukocyte and B-cell chimerism after gene therapy. Figure S2. T-cell subpopulations in the peripheral blood after infusion. Table S1.  Summary of CD18+ gene-corrected cells in the peripheral blood or bone marrow at latest available time point from FV vectortreated or allogeneic transplant CLAD dogs. Table S2.  Summary of insertion sites by time point and cell source. Table S3.  List of integration sites by cell source.

Molecular Therapy vol. 21 no. 5 may 2013

Follow-up of FV Vector Gene Therapy for CLAD

ACKNOWLEDGMENTS We thank William Telford and Veena Kapoor (Experimental Transplantation and Immunology Branch, National Cancer Institute, National Institutes of Health) for assistance with flow cytometry and sorting. We thank Erika Wiltrout and Sharon Miller (Division of Veterinary Resources, Office of Research Services, National Institutes of Health) and the rest of the DVR staff for excellent veterinary care of dogs. We thank Matthew Starost (Division of Veterinary Resources, Office of Research Services, National Institutes of Health) for necropsy of dogs, collection of tissues, and initial histological analysis. This work was supported by the Intramural Research Program of the US National Institutes of Health, National Cancer Institute, Center for Cancer Research, and by US National Institutes of Health grant HL85107 (to D.W.R.). The authors declared no conflict of interest.

REFERENCES

1. Bauer, TR Jr, Allen, JM, Hai, M, Tuschong, LM, Khan, IF, Olson, EM et al. (2008). Successful treatment of canine leukocyte adhesion deficiency by foamy virus vectors. Nat Med 14: 93–97. 2. Morianos, I, Siapati, EK, Pongas, G and Vassilopoulos, G (2012). Comparative analysis of FV vectors with human a- or β-globin gene regulatory elements for the correction of β-thalassemia. Gene Ther 19: 303–311. 3. Uchiyama, T, Adriani, M, Jagadeesh, GJ, Paine, A and Candotti, F (2012). Foamy virus vector-mediated gene correction of a mouse model of Wiskott-Aldrich syndrome. Mol Ther 20: 1270–1279. 4. Chatziandreou, I, Siapati, EK and Vassilopoulos, G (2011). Genetic correction of X-linked chronic granulomatous disease with novel foamy virus vectors. Exp Hematol 39: 643–652. 5. Russell, DW and Miller, AD (1996). Foamy virus vectors. J Virol 70: 217–222. 6. Trobridge, G, Josephson, N, Vassilopoulos, G, Mac, J and Russell, DW (2002). Improved foamy virus vectors with minimal viral sequences. Mol Ther 6: 321–328. 7. Trobridge, G and Russell, DW (2004). Cell cycle requirements for transduction by foamy virus vectors compared to those of oncovirus and lentivirus vectors. J Virol 78: 2327–2335. 8. Falcone, V, Schweizer, M and Neumann-Haefelin, D (2003). Replication of primate foamy viruses in natural and experimental hosts. Curr Top Microbiol Immunol 277: 161–180. 9. Hacein-Bey-Abina, S, Von Kalle, C, Schmidt, M, McCormack, MP, Wulffraat, N, Leboulch, P et al. (2003). LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302: 415–419. 10. Wu, C and Dunbar, CE (2011). Stem cell gene therapy: the risks of insertional mutagenesis and approaches to minimize genotoxicity. Front Med 5: 356–371. 11. Stein, S, Ott, MG, Schultze-Strasser, S, Jauch, A, Burwinkel, B, Kinner, A et al. (2010). Genomic instability and myelodysplasia with monosomy 7 consequent to EVI1 activation after gene therapy for chronic granulomatous disease. Nat Med 16: 198–204. 12. Trowald-Wigh, G, Ekman, S, Hansson, K, Hedhammar, A and Hård af Segerstad, C (2000). Clinical, radiological and pathological features of 12 Irish setters with canine leucocyte adhesion deficiency. J Small Anim Pract 41: 211–217. 13. Anderson, DC, Smith, CW (2001). Leukocyte adhesion deficiencies. In: Scriver, CR, Beaudet, AL, Sly, WS, Valle, D (eds). The Metabolic and Molecular Bases of Inherited Disease, 8th edn. McGraw-Hill: New York. pp. 4829–4856. 14. Trowald-Wigh, G, Håkansson, L, Johannisson, A, Norrgren, L and Hård af Segerstad, C (1992). Leucocyte adhesion protein deficiency in Irish setter dogs. Vet Immunol Immunopathol 32: 261–280. 15. Bauer, TR Jr, Creevy, KE, Gu, YC, Tuschong, LM, Donahue, RE, Metzger, ME et al. (2004). Very low levels of donor CD18+ neutrophils following allogeneic hematopoietic stem cell transplantation reverse the disease phenotype in canine leukocyte adhesion deficiency. Blood 103: 3582–3589. 16. Gu, YC, Bauer, TR, Sokolic, RA, Hai, M, Tuschong, LM, Burkholder, T et al. (2006). Conversion of the severe to the moderate disease phenotype with donor leukocyte microchimerism in canine leukocyte adhesion deficiency. Bone Marrow Transplant 37: 607–614. 17. Kandula, S and Abraham, C (2004). LFA-1 on CD4+ T cells is required for optimal antigen-dependent activation in vivo. J Immunol 173: 4443–4451. 18. Van Seventer, GA, Shimizu, Y, Horgan, KJ and Shaw, S (1990). The LFA-1 ligand ICAM-1 provides an important costimulatory signal for T cell receptor-mediated activation of resting T cells. J Immunol 144: 4579–4586. 19. Varga, G, Nippe, N, Balkow, S, Peters, T, Wild, MK, Seeliger, S et al. (2010). LFA-1 contributes to signal I of T-cell activation and to the production of T(h)1 cytokines. J Invest Dermatol 130: 1005–1012. 20. Creevy, KE, Bauer, TR Jr, Tuschong, LM, Embree, LJ, Colenda, L, Cogan, K et al. (2003). Canine leukocyte adhesion deficiency colony for investigation of novel hematopoietic therapies. Vet Immunol Immunopathol 94: 11–22. 21. Bauer, TR Jr, Gu, YC, Tuschong, LM, Burkholder, T, Bacher, JD, Starost, MF et al. (2005). Nonmyeloablative hematopoietic stem cell transplantation corrects the disease phenotype in the canine model of leukocyte adhesion deficiency. Exp Hematol 33: 706–712. 22. Burkholder, TH, Colenda, L, Tuschong, LM, Starost, MF, Bauer, TR Jr and Hickstein, DD (2006). Reproductive capability in dogs with canine leukocyte adhesion deficiency treated with nonmyeloablative conditioning prior to allogeneic hematopoietic stem cell transplantation. Blood 108: 1767–1769.

971

Follow-up of FV Vector Gene Therapy for CLAD

23. Dahlgren, RR and Emerick, FM (1985). Pancreatic beta-cell carcinoma with renal metastasis in a dog. J Am Vet Med Assoc 187: 425–426. 24. Pickens, EH, Kim, DY, Gaunt, S and Neer, TM (2005). Unique radiographic appearance of bone marrow metastasis of an insulin-secreting beta-cell carcinoma in a dog. J Vet Intern Med 19: 350–354. 25. Hacein-Bey-Abina, S, Garrigue, A, Wang, GP, Soulier, J, Lim, A, Morillon, E et al. (2008). Insertional oncogenesis in 4 patients after retrovirus-mediated gene therapy of SCID-X1. J Clin Invest 118: 3132–3142. 26. Tone, Y, Wada, T, Shibata, F, Toma, T, Hashida, Y, Kasahara, Y et al. (2007). Somatic revertant mosaicism in a patient with leukocyte adhesion deficiency type 1. Blood 109: 1182–1184. 27. Ohmine, K, Li, Y, Bauer, TR Jr, Hickstein, DD and Russell, DW (2011). Tracking of specific integrant clones in dogs treated with foamy virus vectors. Hum Gene Ther 22: 217–224. 28. Montini, E, Cesana, D, Schmidt, M, Sanvito, F, Ponzoni, M, Bartholomae, C et al. (2006). Hematopoietic stem cell gene transfer in a tumor-prone mouse model uncovers low genotoxicity of lentiviral vector integration. Nat Biotechnol 24: 687–696. 29. Bauer, TR Jr, Olson, EM, Huo, Y, Tuschong, LM, Allen, JM, Li, Y et al. (2011). Treatment of canine leukocyte adhesion deficiency by foamy virus vectors expressing CD18 from a PGK promoter. Gene Ther 18: 553–559. 30. Hunter, MJ, Tuschong, LM, Fowler, CJ, Bauer, TR Jr, Burkholder, TH and Hickstein, DD (2011). Gene therapy of canine leukocyte adhesion deficiency using lentiviral vectors with human CD11b and CD18 promoters driving canine CD18 expression. Mol Ther 19: 113–121. 31. Hunter, MJ, Zhao, H, Tuschong, LM, Bauer, TR Jr, Burkholder, TH, Persons, DA et al. (2011). Gene therapy for canine leukocyte adhesion deficiency with lentiviral vectors using the murine stem cell virus and human phosphoglycerate kinase promoters. Hum Gene Ther 22: 689–696. 32. Nelson, EJ, Tuschong, LM, Hunter, MJ, Bauer, TR Jr, Burkholder, TH and Hickstein, DD (2010). Lentiviral vectors incorporating a human elongation factor 1alpha promoter for the treatment of canine leukocyte adhesion deficiency. Gene Ther 17: 672–677. 33. Bauer, TR Jr, Hai, M, Tuschong, LM, Burkholder, TH, Gu, YC, Sokolic, RA et al. (2006). Correction of the disease phenotype in canine leukocyte adhesion deficiency using ex vivo hematopoietic stem cell gene therapy. Blood 108: 3313–3320. 34. Hai, M, Adler, RL, Bauer, TR Jr, Tuschong, LM, Gu, YC, Wu, X et al. (2008). Potential genotoxicity from integration sites in CLAD dogs treated successfully with gammaretroviral vector-mediated gene therapy. Gene Ther 15: 1067–1071. 35. Zhang, XB, Beard, BC, Trobridge, GD, Wood, BL, Sale, GE, Sud, R et al. (2008). High incidence of leukemia in large animals after stem cell gene therapy with a HOXB4expressing retroviral vector. J Clin Invest 118: 1502–1510. 36. Sellers, S, Gomes, TJ, Larochelle, A, Lopez, R, Adler, R, Krouse, A et al. (2010). Ex vivo expansion of retrovirally transduced primate CD34+ cells results in overrepresentation

972

© The American Society of Gene & Cell Therapy

of clones with MDS1/EVI1 insertion sites in the myeloid lineage after transplantation. Mol Ther 18: 1633–1639. 37. Cavazzana-Calvo, M, Payen, E, Negre, O, Wang, G, Hehir, K, Fusil, F et al. (2010). Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia. Nature 467: 318–322. 38. Howe, SJ, Mansour, MR, Schwarzwaelder, K, Bartholomae, C, Hubank, M, Kempski, H et al. (2008). Insertional mutagenesis combined with acquired somatic mutations causes leukemogenesis following gene therapy of SCID-X1 patients. J Clin Invest 118: 3143–3150. 39. Hacein-Bey-Abina, S, Le Deist, F, Carlier, F, Bouneaud, C, Hue, C, De Villartay, JP et al. (2002). Sustained correction of X-linked severe combined immunodeficiency by ex vivo gene therapy. N Engl J Med 346: 1185–1193. 40. Aiuti, A, Cattaneo, F, Galimberti, S, Benninghoff, U, Cassani, B, Callegaro, L et al. (2009). Gene therapy for immunodeficiency due to adenosine deaminase deficiency. N Engl J Med 360: 447–458. 41. Cassani, B, Montini, E, Maruggi, G, Ambrosi, A, Mirolo, M, Selleri, S et al. (2009). Integration of retroviral vectors induces minor changes in the transcriptional activity of T cells from ADA-SCID patients treated with gene therapy. Blood 114: 3546–3556. 42. Ott, MG, Schmidt, M, Schwarzwaelder, K, Stein, S, Siler, U, Koehl, U et al. (2006). Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1, PRDM16 or SETBP1. Nat Med 12: 401–409. 43. Aiuti, A, Cassani, B, Andolfi, G, Mirolo, M, Biasco, L, Recchia, A et al. (2007). Multilineage hematopoietic reconstitution without clonal selection in ADA-SCID patients treated with stem cell gene therapy. J Clin Invest 117: 2233–2240. 44. Deichmann, A, Hacein-Bey-Abina, S, Schmidt, M, Garrigue, A, Brugman, MH, Hu, J et al. (2007). Vector integration is nonrandom and clustered and influences the fate of lymphopoiesis in SCID-X1 gene therapy. J Clin Invest 117: 2225–2232. 45. Schwarzwaelder, K, Howe, SJ, Schmidt, M, Brugman, MH, Deichmann, A, Glimm, H et al. (2007). Gammaretrovirus-mediated correction of SCID-X1 is associated with skewed vector integration site distribution in vivo. J Clin Invest 117: 2241–2249. 46. Cartier, N, Hacein-Bey-Abina, S, Bartholomae, CC, Veres, G, Schmidt, M, Kutschera, I et al. (2009). Hematopoietic stem cell gene therapy with a lentiviral vector in X-linked adrenoleukodystrophy. Science 326: 818–823. 47. Hendrie, PC, Huo, Y, Stolitenko, RB and Russell, DW (2008). A rapid and quantitative assay for measuring neighboring gene activation by vector proviruses. Mol Ther 16: 534–540. 48. Almarza, D, Bussadori, G, Navarro, M, Mavilio, F, Larcher, F and Murillas, R (2011). Risk assessment in skin gene therapy: viral-cellular fusion transcripts generated by proviral transcriptional read-through in keratinocytes transduced with self-inactivating lentiviral vectors. Gene Ther 18: 674–681.

www.moleculartherapy.org vol. 21 no. 5 may 2013