- Email: [email protected]
Loss of LINC01939 expression predicts progression and poor survival in gastric cancer
Pathology - Research and Practice xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp
Loss of LINC01939 expression predicts progression and poor survival in gastric cancer Chun-Li Chena, Qing Kea, Ming Luoa, Zi-Ye Gaoa, Zhi-Jiu Lia, Zhi-Guo Luoa, a b
⁎⁎,1
, Dong-Bo Liub,
⁎,1
Department of Clinical Oncology, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei, China Cancer Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1095 Jiefang Road, Wuhan, 430030, Hubei, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Gastric cancer Long non-coding RNAs LINC01939 Progression Survival
As highly tissue-specific genes, it is increasingly recognized that long non-coding RNAs (lncRNAs) are considered as promising prognostic biomarkers for multiple human cancers. However, lack of tissue-specific lncRNAs in gastric cancer (GC) still exist. In this study, we identified a novel lncRNA LINC01939 which showed the largest fold change in GC than other human cancers from lnCAR database by bioinformatic analysis. Reverse transcription quantitative polymerase chain reaction (qPCR) assay confirmed that LINC01939 was significantly downregulated in GC tissues compared with matched normal tissues. Low expression of LINC01939 was positively associated with advanced TNM stage and lymphatic metastasis. Patients with low LINC01939 expression have remarkably shorter overall survival (OS) and progression-free survival (PFS) than those with high LINC01939 expression. Univariate and multivariate analysis showed that LINC01939 is an independent protective predictor of OS and PFS in GC patients. Therefore, our data suggest that the newly identified lncRNA LINC01939 might act as a potential prognostic biomarker for GC.
1. Introduction According to the latest statistics, gastric cancer (GC) is one of the most common gastrointestinal malignancies and the third leading cause of cancer death worldwide [1]. In general, gastric cancer mainly occurs in Eastern Asia, with an extraordinarily high incidence and mortality in China [1,2]. Although it is curable if detected early, most patients have poor prognosis because disease is frequently diagnosed at an advanced stage [3,4]. In spite of recent advances in chemotherapy and molecular targeted therapy, 5-year overall survival (OS) rate of patients with advanced GC is less than 30% [4]. Therefore, it is of great importance to identify and characterize novel biomarkers for predicting patient survival and developing new therapeutic strategies. Non-coding RNAs (ncRNAs) are considered as one of the most unexpected findings of the genomics ear of biology [5]. Among which are a new group of RNAs, known as long non-coding RNAs (lncRNAs) (ncRNAs longer than 200 nucleotides). Up to date, more than 58,000 lncRNAs have been identified and are uniquely expressed in differentiated tissues or specific cancer types [6]. According to location with
nearby coding genes, lncRNAs are classified as sense, antisense, intergenic and bidirectional lncRNAs [7]. Efforts over the past decade revealed that lncRNAs participate in various biological processes of multiple human cancers, such as proliferation, differentiation, viability and motility [8,9]. Undoubtedly, lncRNA expression profiles are important and novel biomarkers for the development and progression of human cancers [10,11]. Recently, several lines of evidence have suggested that the dysregulation of lncRNAs are involved in GC initiation, progression, metastasis and recurrence [12]. For instance, upregulation of lncRNA H19 was positively correlated with invasion depth and lymphatic metastasis in GC. H19 promoted GC cell proliferation by regulating miR-675 to modulate RUNX1 expression [13,14]. HOX transcript antisense intergenic RNA (HOTAIR) was overexpressed in advanced GC tissues, and inhibited apoptosis and promoted metastasis and chemoresistance in GC cells [15–17]. Qi et al. [18] reported that lncRNA MALAT1 also enhanced GC invasion and migration by binding EZH2 to inhibit the tumor suppressor gene PCDH10 expression. Based on bioinformatic analysis, we first found that a novel lncRNA LINC01939 expression was
⁎
Corresponding author. Corresponding author at: Department of Clinical Oncology, Taihe Hospital, Hubei University of Medicine, 32 South Renmin Road, Shiyan, 442000, Hubei, China. E-mail addresses: [email protected] (C.-L. Chen), [email protected] (Q. Ke), [email protected] (M. Luo), [email protected] (Z.-Y. Gao), [email protected] (Z.-J. Li), [email protected] (Z.-G. Luo), [email protected] (D.-B. Liu). 1 These authors contributed equally. ⁎⁎
https://doi.org/10.1016/j.prp.2018.07.007 Received 23 May 2018; Received in revised form 17 June 2018; Accepted 5 July 2018 0344-0338/ © 2018 Elsevier GmbH. All rights reserved.
Please cite this article as: Chen, C.-L., Pathology - Research and Practice (2018), https://doi.org/10.1016/j.prp.2018.07.007
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
Fig. 1. LINC01939 expression was significantly underexpressed in GC tissues and associated with GC progression. (A) Relative expression of LINC01939 in 11 common human cancers from lnCAR database. GC, gastric cancer; PC, prostate cancer; HCC, hepatocellular cancer; BC, breast cancer; ESCC, esophageal squamous cell carcinoma; OC, ovarian cancer; SCLC, small cell lung cancer; LAC, lung adenocarcinoma; LSCC, lung squamous cell carcinoma; CC, cholangiocarcinoma; CRC, colorectal cancer. (B) Relative expression of LINC01939 in 120 paired GC tissues and adjacent normal tissues. qPCR was performed to examine the expression of LINC01939 and GAPDH was used as the internal control. Results were presented as Δ cycle threshold (ΔCt) in tumor samples compared to normal samples. (C) Relative expression of LINC01939 in gastric cancer with TNM stage I-II (n = 45) and stage III-IV (n = 75). (D) Relative expression of LINC01939 in gastric cancer with (n = 32) and without (n = 88) lymphatic metastasis. Error bars: mean ± SD. All * P < 0.05, ** P < 0.01.
Next, we evaluated the clinicopathological role of LINC01939 in 120 GC patients. All patients were divided into two groups (high and low expression groups) based on the cutoff value of the median level (0.218) of relative LINC01939 expression. Chi-square test demonstrated that 64.4% (29/45) of patients with high LINC01939 expression have tumor-node-metastasis stage (TNM stage) I-II while only 35.6% (16/45) of ones with low expression have stage I-II (P = 0.014, Table 1); 65.6% (21/32) of patients with high expression have no lymphatic metastasis (NLM) while only 34.4% (11/32) of ones with low expression have NLM (P = 0.039, Table 1). Moreover, we further examined the relative expression of LINC01939 in patient subgroups stratified by TNM stage and lymphatic metastasis. The results showed that LINC01939 expression was strikingly reduced in advanced TNM stage and lymph node metastasis (all P < 0.05, Fig. 1C and D). Taken together, these results imply that LINC01939 might play important roles in the progression and metastasis of GC.
significantly reduced in gastric cancer. Further investigation showed that LINC01939 was lowly expressed in GC tissues compared with normal tissues and patients with high LINC01939 expression had longer survival time. Our data suggest that LINC01939 may serve as a new prognostic marker or therapeutic target of GC. 2. Results 2.1. Identifying differentially expressed lncRNAs in gastric cancer GC lncRNAs expression cohort was downloaded and identified from the website lnCAR (http://lncar.renlab.org/). Regarding to the common criteria (details are provided in Methods section), we filtered 24.807 significantly differential expression of lncRNAs in GC. In view of lncRNAs expression in highly tumor type-specific manner, we noted a novel lncRNA LINC01939, that is obviously underexpressed in GC with the largest decreasing fold (log fold change (logFC) = −1.6886). We further downloaded the raw expression files of LINC01939 in GC and other human cancers from the website lnCAR. As showed in Fig. 1A, LINC01939 expression was apparently decreased in four common human cancers (particularly in gastric cancer), but only significantly increased in cholangiocarcinoma (CC). The altered expression of LINC01939 in tumor type-dependent manner suggests that LINC01939 may serve as a potential biomarker for GC.
2.3. Loss of LINC01939 expression predicts poor survival in GC patients In the light of the relationship between low LINC01939 expression and GC progression, we reasoned that LINC01939 is correlated with the prognosis of GC patients. As expected, Kaplan-Meier methods with logrank tests indicated that patients with high LINC0193 expression have significantly longer overall survival (OS) and progression-free survival (PFS) than those with low expression (all P < 0.0001, Fig. 2A and 2B). The 5-year OS and PFS rates of LINC01939 high expression group were significantly better than those of low expression group (OS:68.98% vs. 22.51%, PFS: 64.84% vs. 23.41%) (Fig. 2A and 2B). These results hint that LINC01939 is a tumor suppressor lncRNA in GC. To access whether LINC01939 expression is an independent predictor for GC patients, univariate and multivariate Cox regression analyses were conducted. Univariate analysis verified that TNM stage, lymphatic metastasis, distant metastasis and LINC01939 expression were significantly associated with OS and PFS of GC patients (all P < 0.01, Table 2). However, multivariate Cox regression demonstrated that only TNM stage and LINC01939 expression were independent prognostic predictors for OS and PFS (all P < = 0.05, Table 2). In addition,
2.2. LINC01939 is downregulated in GC tissues and associated with GC progression Because LINC01939 is a novel lncRNA, we did not get any information of this lncRNA expression in gastric cancer from TCGA, cBioPortal and GEO databases. To validate the differential expression of LINC01939 from lnCAR database, we performed qPCR analysis to examine the expression of LINC01939 in 120 GC tissues and matched normal tissues. The results showed that LINC01939 was remarkably downregulated in GC tissues compared with paired normal tissues (P = 0.0139, Fig. 1B), which is consistent with the result of above bioinformatic analysis. 2
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
be considered as potential and sensitive biomarkers for human cancers [20,21]. Therefore, lncRNAs may provide the missing piece of risk assessment for GC patients. To date, several researches have convincingly shown that numerous lncRNAs are involved in complex oncogenic and tumor-suppressor regulatory network to contribute to the occurrence and progression of GC [12,22]. For example, a famous lncRNA XIST (X-inactive specific transcript), which reinforced malignant phenotype of GC, was identified as a potential biomarker for GC patient outcomes including prognosis and metastasis [23]. Zhou et al [24] reported that Linc00153 expression was increased in GC and promoted tumor growth and migration by activating EGFR/PI3K/Akt pathway. In this study, we screened out a novel lncRNA LINC01939 based on bioinformatic analysis, which has a notable tissue-dependent expression pattern in GC. In an expression cohort of GC tissues and adjacent non-cancerous tissues, we confirmed that LINC01939 expression was significantly decreased in GC tissues. And low expression of LINC01939 was positively correlated with GC progression. Further analysis showed that patients with high expression level of LINC01939 have better outcomes (OS and PFS) than patients with low expression. Multivariate analyses demonstrated that LINC01939 is an independent protective factor for GC patients. Our findings suggest that LINC01939 may be play an inhibitory role in GC progression and metastasis. As a novel lncRNA, LINC01939 locates in human chromosome 2 with 694 nucleotides in length. However, many important questions of LINC01939, such as its biological functions and molecular mechanisms underlying the progression and metastasis of GC, remain unanswered. Current studies have confirmed that lncRNAs exert their biological functions via directly or indirectly interacting with chromatin, miRNAs, mRNAs and transcriptional factors (TF) to regulate complicated signaling pathways [25,26]. In the future studies, we will focus on the subcellular localization, biological functions and inhibitory mechanisms of LINC01939 in gastric cancer. In summary, we first found a novel lncRNA LINC01939 is downregulated in GC by online bioinformatic analyses. Loss of LINC01939 expression in our patient cohort is a common event and associated with the progression and metastasis of GC. Moreover, low expression of LINC01939 predicts poor survival and is an independent prognostic factor for GC patients. However, the precise mechanism underlying LINC01939 regulation in GC progression and metastasis warrant further investigation.
Table 1 Correlation between clinicopathological characteristics and LINC01939 expression in gastric cancer. Characteristics
N
LINC01939 Expression Low (N, %)
High (N, %)
P value
Sex Male Female
78 42
36 (46.2%) 24 (57.1%)
42 (53.8%) 18 (42.9%)
0.251
Age (years) < 60 ≥ 60
70 50
34 (48.6%) 26 (52.0%)
36 (51.4%) 24 (48.0%)
0.711
Tumor location Upper Middle Down
31 31 58
19 (61.3%) 18 (58.1%) 23 (39.7%)
12 (38.7%) 13 (41.9%) 35 (60.3%)
0.088
Tumor size < 5 cm ≥ 5 cm
51 69
26 (51.0%) 34(49.3%)
25 (49.0%) 35 (50.7%)
0.853
Differentiation Well/Moderate Poor
24 96
10 (41.7%) 50 (52.1%)
14 (58.3%) 46 (47.9%)
0.361
TNM stage I-II III-IV
45 75
16 (35.6%) 44 (58.7%)
29 (64.4%) 31 (41.3%)
0.014
Lymphatic metastasis Negative Positive
32 88
11 (34.4%) 49 (55.7%)
21 (65.6%) 39 (44.3%)
0.039
Distant metastasis Negative Positive
100 20
49 (49.0%) 11 (55.0%)
51 (51.0%) 9 (45.0%)
0.624
Note: TNM stage, tumor-node-metastasis stage. The bold type represents P values smaller than 0.05.
distant metastasis is also an independent risk factor for OS of GC patients (P = 0.003, Table 2). In general, the above results reveal that LINC01939 status could act as a useful prognostic biomarker for GC patients. 3. Discussion Despite the development of novel diagnostic and therapeutic strategies for GC in the last few decades, the prognosis of advanced GC patients was far from satisfactory [3]. At present, the primary clinical prognostic factor of human cancers is TNM staging. However, GC patients with the same TNM stages or clinicopathologic features have apparently different outcome [4,19], implying that the prognosis of GC patients might not be precisely predicted by only TNM staging system. Recently, there is sufficient evidence to demonstrate that lncRNAs have a more tissue-specific expression pattern that protein, and lncRNAs may
4. Methods 4.1. The selection of lncRNAs in GC specimens from lnCAR database To explore the significance of lncRNAs in GC, we downloaded and analyzed lncRNAs expression data (RNA-seq v2 data) in gastric cancer from the website lnCAR (http://lncar.renlab.org/). This cohort contains 1925 GC tissues which were performed on four platforms (Affymetrix
Fig. 2. Loss of LINC01939 expression was correlated with poor prognosis in GC. (A) and (B) Kaplan-Meier plot of overall survival (OS) and progression-free survival (PFS) in GC patients with LINC01939 high expression (n = 60) and LINC01939 low expression (n = 60). The P value was determined by a log-rank test. 3
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
Table 2 Univariate and multivariate analysis of various potential prognostic factors in patients with gastric cancer. Characteristics
Overall Survival Sex (Male vs. Female) Age (≥60y vs. < 60y) Tumor location (Down vs. Middle vs. Upper) Tumor size (≥5 cm vs. < 5 cm) Differentiation (Poor vs. Moderate/Well) TNM stage (III-IV vs. II-I) Lymphatic metastasis (Positive vs. Negative) Distant metastasis (Positive vs. Negative) LINC01939 expression (high vs. low) Progression-Free Survival Sex (Male vs. Female) Age (≥60y vs. < 60y) Tumor location (Down vs. Middle vs. Upper) Tumor size (≥5 cm vs. < 5 cm) Differentiation (Poor vs. Moderate/Well) TNM stage (III-IV vs. II-I) Lymphatic metastasis (Positive vs. Negative) Distant metastasis (Positive vs. Negative) LINC01939 expression (high vs. low)
Univariate analysis
Multivariate analysis
HR (95% CI)
P value
HR (95% CI)
P value
1.508 (0.892-2.547) 0.857 (0.504-1.456) 0.810 (0.596-1.100)
0.125 0.567 0.176
1.134 (0.635-2.025) 1.230 (0.678-2.231) 1.024 (0.714-1.468)
0.671 0.496 0.898
1.238 (0.734-2.088) 1.579 (0.775-3.216)
0.424 0.208
0.899 (0.520-1.555) 1.230 (0.560-2.700)
0.703 0.607
3.850 2.982 3.611 0.248
(1.991-7.446) (1.412-6.298) (1.952-6.682) (0.140-0.438)
< 0.001 0.004 < 0.001 < 0.001
2.752 0.826 2.934 0.272
(1.001-7.564) (0.275-2.479) (1.452-5.931) (0.148-0.497)
0.050 0.733 0.003 < 0.001
1.392 0.742 0.814 1.114 1.109 5.397 3.606 2.694 0.300
(0.811-2.391) (0.425-1.294) (0.592-1.119) (0.654-1.900) (0.573-2.148) (2.631-11.073) (1.628-7.985) (1.375-5.278) (0.171-0.528)
0.230 0.292 0.204 0.691 0.759 < 0.001 0.002 0.004 < 0.001
1.104 0.961 0.975 0.758 0.861 4.978 0.700 1.850 0.381
(0.606-2.013) (0.516-1.788) (0.671-1.417) (0.430-1.336) (0.411-1.802) (1.597-15.514) (0.206-2.373) (0.844-4.056) (0.209-0.695)
0.747 0.899 0.894 0.338 0.691 0.006 0.566 0.124 0.002
Note: TNM stage, tumor-node-metastasis stage; HR, hazard ratio; CI, confidence interval. The bold type represents P values smaller than 0.05.
two experienced pathologists independently according to Lauren’s and the World Health Organization’s classifications (IARC Press, Lyon, 2000). TNM stage of GC were classified according to the seventh edition of the UICC/AJCC Cancer Staging Manual. All tissues were subjected to RNase inactivation with RNAlater and snap-frozen in liquid nitrogen until RNA extraction. The study was approved by the Institutional Review Board of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Informed consents were obtained from all patients and they were approved for scientific research including this study. In our cohort, 78 were men (65%) and 42% were women (35%), with a median follow-up time of 37.5 months (ranged from 3 to 105 months). The clinicopathological characteristics of all patients are listed in Table 1. 4.3. RNA extraction and quantitative real-time PCR (qPCR) Total RNA from tissues samples was isolated with TRIzol Reagent (Invitrogen, Calsbad, CA, USA) according to the manufacturer’s protocol. RNA was quantified using a NanoDropTM 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). Reverse transcription reaction and quantitative real-time PCR (qPCR) were performed as described previously [19,27]. Briefly, 1 μg of total RNA was reverse-transcribed to cDNA in a final volume of 20 μl by using a reverse transcription kit (Takara, Dalian, China). Twenty-fold cDNA diluents were used as templates and amplified by qPCR using Power SYBR Green (Takara, Dalian, China) on a Roche Lightcycler 96 real time PCR machine (Roche Diagnostics, Indianapolis, IN, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as endogenous control to normalize lncRNAs. The following primers were used for the quantitative PCR: LINC01939 Forward: 5′- ATTACAGATGCCCGCCAC -3′; Reverse: 5′- ATGTCTTCCTTTCCCTTTCCC -3′; GAPDH Forward: 5′- CTCCTCCTGTTCGACAGTCAGC -3′; Reverse: 5′−CCCAATACGACCAAATCCGTT -3′. Each sample was performed in triplicate. LINC01939 levels of GC tissues were normalized to the expression level of GAPDH (ΔCt = CtLINC01939-CtGAPDH). These values were compared with values
Fig. 3. The flow chart used to identify candidate lncRNAs from lnCAR website. Using logFC < 0, Z-score threshold ± 2 and P < 0.05 as the criteria, we extracted putative lncRNAs from lnCAR database. Then these lncRNAs were interrogated into LNCipedia database for assembling intergenic lncRNAs with transcript length < 1000 bp. Compared with other cancers from lnCAR website, we identified candidate lncRNAs whose expression are lowest in gastric cancer.
Human Exon 1.0 ST Array, Arraystar Human LncRNA microarray V2.0 and V3.0, CBC Homo sapiens lncRNA + mRNA microarray V2.0). These four platforms cover about 34,377 lncRNA transcripts and variants. RNA dysregulation with log fold change (logFC) < 0, Z-score threshold: ± 2 and P values less than 0.05 were considered as “candidate lncRNAs”. The detailed flow chart is shown in Fig. 3 to identify the candidate lncRNAs from lnCAR website.
4.2. Gastric cancer tissues collection 120 paired GC tissues and adjacent normal tissues were obtained from patients who had received comprehensive treatment at Department of Surgery, Tongji Hospital of Tongji Medical College between 2007 and 2011. All cases of GC were histologically evaluated by 4
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
of corresponding normal tissues according to the formula: 2−ΔΔCt, where ΔΔCt = ΔCtGC tumor-ΔCtnormal.
[10] C. Lin, L. Yang, Long noncoding RNA in cancer: wiring signaling circuitry, Trends Cell Biol. 28 (2018) 287–301. [11] X. Wu, Z.F. Lim, Z. Li, L. Gu, W. Ma, Q. Zhou, H. Su, X. Wang, X. Yang, Z. Zhang, NORAD expression Is associated with adverse prognosis in esophageal squamous cell carcinoma, Oncol. Res. Treat. 40 (2017) 370–374. [12] M. Zhang, X. Du, Noncoding RNAs in gastric cancer: research progress and prospects, World J. Gastroenterol. 22 (2016) 6610–6618. [13] M. Zhuang, W. Gao, J. Xu, P. Wang, Y. Shu, The long non-coding RNA H19-derived miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor RUNX1, Biochem. Biophys. Res. Commun. 448 (2014) 315–322. [14] J.S. Chen, Y.F. Wang, X.Q. Zhang, J.M. Lv, Y. Li, X.X. Liu, T.P. Xu, H19 serves as a diagnostic biomarker and up-regulation of H19 expression contributes to poor prognosis in patients with gastric cancer, Neoplasma 63 (2016) 223–230. [15] H. Endo, T. Shiroki, T. Nakagawa, M. Yokoyama, K. Tamai, H. Yamanami, T. Fujiya, I. Sato, K. Yamaguchi, N. Tanaka, K. Iijima, T. Shimosegawa, K. Sugamura, K. Satoh, Enhanced expression of long non-coding RNA HOTAIR is associated with the development of gastric cancer, PLoS One 8 (2013) e77070. [16] M. Hajjari, M. Behmanesh, M. Sadeghizadeh, M. Zeinoddini, Up-regulation of HOTAIR long non-coding RNA in human gastric adenocarcinoma tissues, Med. Oncol. 30 (2013) 670. [17] W. Zhao, S. Dong, B. Duan, P. Chen, L. Shi, H. Gao, H. Qi, HOTAIR is a predictive and prognostic biomarker for patients with advanced gastric adenocarcinoma receiving fluorouracil and platinum combination chemotherapy, Am. J. Transl. Res. 7 (2015) 1295–1302. [18] Y. Qi, H.S. Ooi, J. Wu, J. Chen, X. Zhang, S. Tan, Q. Yu, Y.Y. Li, Y. Kang, H. Li, Z. Xiong, T. Zhu, B. Liu, Z. Shao, X. Zhao, MALAT1 long ncRNA promotes gastric cancer metastasis by suppressing PCDH10, Oncotarget 7 (2016) 12693–12703. [19] X.Z. Yang, S.Z. Cui, L.S. Zeng, T.T. Cheng, X.X. Li, J. Chi, R. Wang, X.F. Zheng, H.Y. Wang, Overexpression of Rab1B and MMP9 predicts poor survival and good response to chemotherapy in patients with colorectal cancer, Aging (Albany NY) 9 (2017) 914–931. [20] J.R. Prensner, M.K. Iyer, O.A. Balbin, S.M. Dhanasekaran, Q. Cao, J.C. Brenner, B. Laxman, I.A. Asangani, C.S. Grasso, H.D. Kominsky, X. Cao, X. Jing, X. Wang, J. Siddiqui, J.T. Wei, D. Robinson, H.K. Iyer, N. Palanisamy, C.A. Maher, A.M. Chinnaiyan, Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression, Nat. Biotechnol. 29 (2011) 742–749. [21] T. Derrien, R. Johnson, G. Bussotti, A. Tanzer, S. Djebali, H. Tilgner, G. Guernec, D. Martin, A. Merkel, D.G. Knowles, J. Lagarde, L. Veeravalli, X. Ruan, Y. Ruan, T. Lassmann, P. Carninci, J.B. Brown, L. Lipovich, J.M. Gonzalez, M. Thomas, C.A. Davis, R. Shiekhattar, T.R. Gingeras, T.J. Hubbard, C. Notredame, J. Harrow, R. Guigo, The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression, Genome Res. 22 (2012) 1775–1789. [22] R.J. Taft, K.C. Pang, T.R. Mercer, M. Dinger, J.S. Mattick, Non-coding RNAs: regulators of disease, J. Pathol. 220 (2010) 126–139. [23] D.L. Chen, H.Q. Ju, Y.X. Lu, L.Z. Chen, Z.L. Zeng, D.S. Zhang, H.Y. Luo, F. Wang, M.Z. Qiu, D.S. Wang, D.Z. Xu, Z.W. Zhou, H. Pelicano, P. Huang, D. Xie, F.H. Wang, Y.H. Li, R.H. Xu, Long non-coding RNA XIST regulates gastric cancer progression by acting as a molecular sponge of miR-101 to modulate EZH2 expression, J. Exp. Clin. Cancer Res. 35 (2016) 142. [24] J. Zhou, X. Zhi, L. Wang, W. Wang, Z. Li, J. Tang, J. Wang, Q. Zhang, Z. Xu, Linc00152 promotes proliferation in gastric cancer through the EGFR-dependent pathway, J. Exp. Clin. Cancer Res. 34 (2015) 135. [25] Y.G. Chen, A.T. Satpathy, H.Y. Chang, Gene regulation in the immune system by long noncoding RNAs, Nat. Immunol. 18 (2017) 962–972. [26] K.C. Wang, H.Y. Chang, Molecular mechanisms of long noncoding RNAs, Mol. Cell 43 (2011) 904–914. [27] Z. Li, X. Wu, L. Gu, Q. Shen, W. Luo, C. Deng, Q. Zhou, X. Chen, Y. Li, Z. Lim, X. Wang, J. Wang, X. Yang, Long non-coding RNA ATB promotes malignancy of esophageal squamous cell carcinoma by regulating miR-200b/Kindlin-2 axis, Cell Death Dis. 8 (2017) e2888.
4.4. Statistical analysis All data are presented as mean ± S.D or SEM of at least three independent experiments. Student’s t-test or one-way ANOVA was used to evaluate significant differences between two groups or among three groups. The correlation between LINC01939 expression and clinicopathological characteristics was calculated by Chi-square test or Fisher’s exact test. Survival curves were performed using the Kaplan–Meier method, and the log-rank test was used to compare the differences between curves. The independent predictive value was estimated by univariate and multivariate Cox proportional hazards regression model. All statistical analyses were performed using SPSS 23.0 software package (Chicago, IL, USA) and GraphPad Prism 6.0 software (GraphPad Software, La Jolla, CA). P values < 0.05 were considered to indicate a statistically significant difference. Competing interests The authors declare that they have no competing interest. Acknowledgements This present study was supported by the National Natural Science Foundation of China (grant no. 81602391) and the Natural Science Foundation of Hubei Province (grant no. 2018CFB405). References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2015) 87–108. [2] W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X.Q. Yu, J. He, Cancer statistics in China, 2015, CA Cancer J. Clin. 66 (2016) 115–132. [3] E. Van Cutsem, X. Sagaert, B. Topal, K. Haustermans, H. Prenen, Gastric cancer, Lancet 388 (2016) 2654–2664. [4] M. Chen, X. Wu, W. Ma, Q. Zhou, X. Wang, R. Zhang, J. Wang, X. Yang, Decreased expression of lncRNA VPS9D1-AS1 in gastric cancer and its clinical significance, Cancer Biomark. (2017). [5] A.M. Schmitt, H.Y. Chang, Long noncoding RNAs in cancer pathways, Cancer Cell 29 (2016) 452–463. [6] A. Jandura, H.M. Krause, The New RNA world: growing evidence for Long noncoding RNA functionality, Trends Genet. 33 (2017) 665–676. [7] J. Zhang, N. Zhu, X. Chen, A novel long noncoding RNA LINC01133 is upregulated in lung squamous cell cancer and predicts survival, Tumour Biol. 36 (2015) 7465–7471. [8] J.J. Quinn, H.Y. Chang, Unique features of long non-coding RNA biogenesis and function, Nat. Rev. Genet. 17 (2016) 47–62. [9] X. Wu, X. Dinglin, X. Wang, W. Luo, Q. Shen, Y. Li, L. Gu, Q. Zhou, H. Zhu, Y. Li, C. Tan, X. Yang, Z. Zhang, Long noncoding RNA XIST promotes malignancies of esophageal squamous cell carcinoma via regulation of miR-101/EZH2, Oncotarget 8 (2017) 76015–76028.
5
Contents lists available at ScienceDirect
Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp
Loss of LINC01939 expression predicts progression and poor survival in gastric cancer Chun-Li Chena, Qing Kea, Ming Luoa, Zi-Ye Gaoa, Zhi-Jiu Lia, Zhi-Guo Luoa, a b
⁎⁎,1
, Dong-Bo Liub,
⁎,1
Department of Clinical Oncology, Taihe Hospital, Hubei University of Medicine, Shiyan, Hubei, China Cancer Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, 1095 Jiefang Road, Wuhan, 430030, Hubei, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Gastric cancer Long non-coding RNAs LINC01939 Progression Survival
As highly tissue-specific genes, it is increasingly recognized that long non-coding RNAs (lncRNAs) are considered as promising prognostic biomarkers for multiple human cancers. However, lack of tissue-specific lncRNAs in gastric cancer (GC) still exist. In this study, we identified a novel lncRNA LINC01939 which showed the largest fold change in GC than other human cancers from lnCAR database by bioinformatic analysis. Reverse transcription quantitative polymerase chain reaction (qPCR) assay confirmed that LINC01939 was significantly downregulated in GC tissues compared with matched normal tissues. Low expression of LINC01939 was positively associated with advanced TNM stage and lymphatic metastasis. Patients with low LINC01939 expression have remarkably shorter overall survival (OS) and progression-free survival (PFS) than those with high LINC01939 expression. Univariate and multivariate analysis showed that LINC01939 is an independent protective predictor of OS and PFS in GC patients. Therefore, our data suggest that the newly identified lncRNA LINC01939 might act as a potential prognostic biomarker for GC.
1. Introduction According to the latest statistics, gastric cancer (GC) is one of the most common gastrointestinal malignancies and the third leading cause of cancer death worldwide [1]. In general, gastric cancer mainly occurs in Eastern Asia, with an extraordinarily high incidence and mortality in China [1,2]. Although it is curable if detected early, most patients have poor prognosis because disease is frequently diagnosed at an advanced stage [3,4]. In spite of recent advances in chemotherapy and molecular targeted therapy, 5-year overall survival (OS) rate of patients with advanced GC is less than 30% [4]. Therefore, it is of great importance to identify and characterize novel biomarkers for predicting patient survival and developing new therapeutic strategies. Non-coding RNAs (ncRNAs) are considered as one of the most unexpected findings of the genomics ear of biology [5]. Among which are a new group of RNAs, known as long non-coding RNAs (lncRNAs) (ncRNAs longer than 200 nucleotides). Up to date, more than 58,000 lncRNAs have been identified and are uniquely expressed in differentiated tissues or specific cancer types [6]. According to location with
nearby coding genes, lncRNAs are classified as sense, antisense, intergenic and bidirectional lncRNAs [7]. Efforts over the past decade revealed that lncRNAs participate in various biological processes of multiple human cancers, such as proliferation, differentiation, viability and motility [8,9]. Undoubtedly, lncRNA expression profiles are important and novel biomarkers for the development and progression of human cancers [10,11]. Recently, several lines of evidence have suggested that the dysregulation of lncRNAs are involved in GC initiation, progression, metastasis and recurrence [12]. For instance, upregulation of lncRNA H19 was positively correlated with invasion depth and lymphatic metastasis in GC. H19 promoted GC cell proliferation by regulating miR-675 to modulate RUNX1 expression [13,14]. HOX transcript antisense intergenic RNA (HOTAIR) was overexpressed in advanced GC tissues, and inhibited apoptosis and promoted metastasis and chemoresistance in GC cells [15–17]. Qi et al. [18] reported that lncRNA MALAT1 also enhanced GC invasion and migration by binding EZH2 to inhibit the tumor suppressor gene PCDH10 expression. Based on bioinformatic analysis, we first found that a novel lncRNA LINC01939 expression was
⁎
Corresponding author. Corresponding author at: Department of Clinical Oncology, Taihe Hospital, Hubei University of Medicine, 32 South Renmin Road, Shiyan, 442000, Hubei, China. E-mail addresses: [email protected] (C.-L. Chen), [email protected] (Q. Ke), [email protected] (M. Luo), [email protected] (Z.-Y. Gao), [email protected] (Z.-J. Li), [email protected] (Z.-G. Luo), [email protected] (D.-B. Liu). 1 These authors contributed equally. ⁎⁎
https://doi.org/10.1016/j.prp.2018.07.007 Received 23 May 2018; Received in revised form 17 June 2018; Accepted 5 July 2018 0344-0338/ © 2018 Elsevier GmbH. All rights reserved.
Please cite this article as: Chen, C.-L., Pathology - Research and Practice (2018), https://doi.org/10.1016/j.prp.2018.07.007
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
Fig. 1. LINC01939 expression was significantly underexpressed in GC tissues and associated with GC progression. (A) Relative expression of LINC01939 in 11 common human cancers from lnCAR database. GC, gastric cancer; PC, prostate cancer; HCC, hepatocellular cancer; BC, breast cancer; ESCC, esophageal squamous cell carcinoma; OC, ovarian cancer; SCLC, small cell lung cancer; LAC, lung adenocarcinoma; LSCC, lung squamous cell carcinoma; CC, cholangiocarcinoma; CRC, colorectal cancer. (B) Relative expression of LINC01939 in 120 paired GC tissues and adjacent normal tissues. qPCR was performed to examine the expression of LINC01939 and GAPDH was used as the internal control. Results were presented as Δ cycle threshold (ΔCt) in tumor samples compared to normal samples. (C) Relative expression of LINC01939 in gastric cancer with TNM stage I-II (n = 45) and stage III-IV (n = 75). (D) Relative expression of LINC01939 in gastric cancer with (n = 32) and without (n = 88) lymphatic metastasis. Error bars: mean ± SD. All * P < 0.05, ** P < 0.01.
Next, we evaluated the clinicopathological role of LINC01939 in 120 GC patients. All patients were divided into two groups (high and low expression groups) based on the cutoff value of the median level (0.218) of relative LINC01939 expression. Chi-square test demonstrated that 64.4% (29/45) of patients with high LINC01939 expression have tumor-node-metastasis stage (TNM stage) I-II while only 35.6% (16/45) of ones with low expression have stage I-II (P = 0.014, Table 1); 65.6% (21/32) of patients with high expression have no lymphatic metastasis (NLM) while only 34.4% (11/32) of ones with low expression have NLM (P = 0.039, Table 1). Moreover, we further examined the relative expression of LINC01939 in patient subgroups stratified by TNM stage and lymphatic metastasis. The results showed that LINC01939 expression was strikingly reduced in advanced TNM stage and lymph node metastasis (all P < 0.05, Fig. 1C and D). Taken together, these results imply that LINC01939 might play important roles in the progression and metastasis of GC.
significantly reduced in gastric cancer. Further investigation showed that LINC01939 was lowly expressed in GC tissues compared with normal tissues and patients with high LINC01939 expression had longer survival time. Our data suggest that LINC01939 may serve as a new prognostic marker or therapeutic target of GC. 2. Results 2.1. Identifying differentially expressed lncRNAs in gastric cancer GC lncRNAs expression cohort was downloaded and identified from the website lnCAR (http://lncar.renlab.org/). Regarding to the common criteria (details are provided in Methods section), we filtered 24.807 significantly differential expression of lncRNAs in GC. In view of lncRNAs expression in highly tumor type-specific manner, we noted a novel lncRNA LINC01939, that is obviously underexpressed in GC with the largest decreasing fold (log fold change (logFC) = −1.6886). We further downloaded the raw expression files of LINC01939 in GC and other human cancers from the website lnCAR. As showed in Fig. 1A, LINC01939 expression was apparently decreased in four common human cancers (particularly in gastric cancer), but only significantly increased in cholangiocarcinoma (CC). The altered expression of LINC01939 in tumor type-dependent manner suggests that LINC01939 may serve as a potential biomarker for GC.
2.3. Loss of LINC01939 expression predicts poor survival in GC patients In the light of the relationship between low LINC01939 expression and GC progression, we reasoned that LINC01939 is correlated with the prognosis of GC patients. As expected, Kaplan-Meier methods with logrank tests indicated that patients with high LINC0193 expression have significantly longer overall survival (OS) and progression-free survival (PFS) than those with low expression (all P < 0.0001, Fig. 2A and 2B). The 5-year OS and PFS rates of LINC01939 high expression group were significantly better than those of low expression group (OS:68.98% vs. 22.51%, PFS: 64.84% vs. 23.41%) (Fig. 2A and 2B). These results hint that LINC01939 is a tumor suppressor lncRNA in GC. To access whether LINC01939 expression is an independent predictor for GC patients, univariate and multivariate Cox regression analyses were conducted. Univariate analysis verified that TNM stage, lymphatic metastasis, distant metastasis and LINC01939 expression were significantly associated with OS and PFS of GC patients (all P < 0.01, Table 2). However, multivariate Cox regression demonstrated that only TNM stage and LINC01939 expression were independent prognostic predictors for OS and PFS (all P < = 0.05, Table 2). In addition,
2.2. LINC01939 is downregulated in GC tissues and associated with GC progression Because LINC01939 is a novel lncRNA, we did not get any information of this lncRNA expression in gastric cancer from TCGA, cBioPortal and GEO databases. To validate the differential expression of LINC01939 from lnCAR database, we performed qPCR analysis to examine the expression of LINC01939 in 120 GC tissues and matched normal tissues. The results showed that LINC01939 was remarkably downregulated in GC tissues compared with paired normal tissues (P = 0.0139, Fig. 1B), which is consistent with the result of above bioinformatic analysis. 2
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
be considered as potential and sensitive biomarkers for human cancers [20,21]. Therefore, lncRNAs may provide the missing piece of risk assessment for GC patients. To date, several researches have convincingly shown that numerous lncRNAs are involved in complex oncogenic and tumor-suppressor regulatory network to contribute to the occurrence and progression of GC [12,22]. For example, a famous lncRNA XIST (X-inactive specific transcript), which reinforced malignant phenotype of GC, was identified as a potential biomarker for GC patient outcomes including prognosis and metastasis [23]. Zhou et al [24] reported that Linc00153 expression was increased in GC and promoted tumor growth and migration by activating EGFR/PI3K/Akt pathway. In this study, we screened out a novel lncRNA LINC01939 based on bioinformatic analysis, which has a notable tissue-dependent expression pattern in GC. In an expression cohort of GC tissues and adjacent non-cancerous tissues, we confirmed that LINC01939 expression was significantly decreased in GC tissues. And low expression of LINC01939 was positively correlated with GC progression. Further analysis showed that patients with high expression level of LINC01939 have better outcomes (OS and PFS) than patients with low expression. Multivariate analyses demonstrated that LINC01939 is an independent protective factor for GC patients. Our findings suggest that LINC01939 may be play an inhibitory role in GC progression and metastasis. As a novel lncRNA, LINC01939 locates in human chromosome 2 with 694 nucleotides in length. However, many important questions of LINC01939, such as its biological functions and molecular mechanisms underlying the progression and metastasis of GC, remain unanswered. Current studies have confirmed that lncRNAs exert their biological functions via directly or indirectly interacting with chromatin, miRNAs, mRNAs and transcriptional factors (TF) to regulate complicated signaling pathways [25,26]. In the future studies, we will focus on the subcellular localization, biological functions and inhibitory mechanisms of LINC01939 in gastric cancer. In summary, we first found a novel lncRNA LINC01939 is downregulated in GC by online bioinformatic analyses. Loss of LINC01939 expression in our patient cohort is a common event and associated with the progression and metastasis of GC. Moreover, low expression of LINC01939 predicts poor survival and is an independent prognostic factor for GC patients. However, the precise mechanism underlying LINC01939 regulation in GC progression and metastasis warrant further investigation.
Table 1 Correlation between clinicopathological characteristics and LINC01939 expression in gastric cancer. Characteristics
N
LINC01939 Expression Low (N, %)
High (N, %)
P value
Sex Male Female
78 42
36 (46.2%) 24 (57.1%)
42 (53.8%) 18 (42.9%)
0.251
Age (years) < 60 ≥ 60
70 50
34 (48.6%) 26 (52.0%)
36 (51.4%) 24 (48.0%)
0.711
Tumor location Upper Middle Down
31 31 58
19 (61.3%) 18 (58.1%) 23 (39.7%)
12 (38.7%) 13 (41.9%) 35 (60.3%)
0.088
Tumor size < 5 cm ≥ 5 cm
51 69
26 (51.0%) 34(49.3%)
25 (49.0%) 35 (50.7%)
0.853
Differentiation Well/Moderate Poor
24 96
10 (41.7%) 50 (52.1%)
14 (58.3%) 46 (47.9%)
0.361
TNM stage I-II III-IV
45 75
16 (35.6%) 44 (58.7%)
29 (64.4%) 31 (41.3%)
0.014
Lymphatic metastasis Negative Positive
32 88
11 (34.4%) 49 (55.7%)
21 (65.6%) 39 (44.3%)
0.039
Distant metastasis Negative Positive
100 20
49 (49.0%) 11 (55.0%)
51 (51.0%) 9 (45.0%)
0.624
Note: TNM stage, tumor-node-metastasis stage. The bold type represents P values smaller than 0.05.
distant metastasis is also an independent risk factor for OS of GC patients (P = 0.003, Table 2). In general, the above results reveal that LINC01939 status could act as a useful prognostic biomarker for GC patients. 3. Discussion Despite the development of novel diagnostic and therapeutic strategies for GC in the last few decades, the prognosis of advanced GC patients was far from satisfactory [3]. At present, the primary clinical prognostic factor of human cancers is TNM staging. However, GC patients with the same TNM stages or clinicopathologic features have apparently different outcome [4,19], implying that the prognosis of GC patients might not be precisely predicted by only TNM staging system. Recently, there is sufficient evidence to demonstrate that lncRNAs have a more tissue-specific expression pattern that protein, and lncRNAs may
4. Methods 4.1. The selection of lncRNAs in GC specimens from lnCAR database To explore the significance of lncRNAs in GC, we downloaded and analyzed lncRNAs expression data (RNA-seq v2 data) in gastric cancer from the website lnCAR (http://lncar.renlab.org/). This cohort contains 1925 GC tissues which were performed on four platforms (Affymetrix
Fig. 2. Loss of LINC01939 expression was correlated with poor prognosis in GC. (A) and (B) Kaplan-Meier plot of overall survival (OS) and progression-free survival (PFS) in GC patients with LINC01939 high expression (n = 60) and LINC01939 low expression (n = 60). The P value was determined by a log-rank test. 3
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
Table 2 Univariate and multivariate analysis of various potential prognostic factors in patients with gastric cancer. Characteristics
Overall Survival Sex (Male vs. Female) Age (≥60y vs. < 60y) Tumor location (Down vs. Middle vs. Upper) Tumor size (≥5 cm vs. < 5 cm) Differentiation (Poor vs. Moderate/Well) TNM stage (III-IV vs. II-I) Lymphatic metastasis (Positive vs. Negative) Distant metastasis (Positive vs. Negative) LINC01939 expression (high vs. low) Progression-Free Survival Sex (Male vs. Female) Age (≥60y vs. < 60y) Tumor location (Down vs. Middle vs. Upper) Tumor size (≥5 cm vs. < 5 cm) Differentiation (Poor vs. Moderate/Well) TNM stage (III-IV vs. II-I) Lymphatic metastasis (Positive vs. Negative) Distant metastasis (Positive vs. Negative) LINC01939 expression (high vs. low)
Univariate analysis
Multivariate analysis
HR (95% CI)
P value
HR (95% CI)
P value
1.508 (0.892-2.547) 0.857 (0.504-1.456) 0.810 (0.596-1.100)
0.125 0.567 0.176
1.134 (0.635-2.025) 1.230 (0.678-2.231) 1.024 (0.714-1.468)
0.671 0.496 0.898
1.238 (0.734-2.088) 1.579 (0.775-3.216)
0.424 0.208
0.899 (0.520-1.555) 1.230 (0.560-2.700)
0.703 0.607
3.850 2.982 3.611 0.248
(1.991-7.446) (1.412-6.298) (1.952-6.682) (0.140-0.438)
< 0.001 0.004 < 0.001 < 0.001
2.752 0.826 2.934 0.272
(1.001-7.564) (0.275-2.479) (1.452-5.931) (0.148-0.497)
0.050 0.733 0.003 < 0.001
1.392 0.742 0.814 1.114 1.109 5.397 3.606 2.694 0.300
(0.811-2.391) (0.425-1.294) (0.592-1.119) (0.654-1.900) (0.573-2.148) (2.631-11.073) (1.628-7.985) (1.375-5.278) (0.171-0.528)
0.230 0.292 0.204 0.691 0.759 < 0.001 0.002 0.004 < 0.001
1.104 0.961 0.975 0.758 0.861 4.978 0.700 1.850 0.381
(0.606-2.013) (0.516-1.788) (0.671-1.417) (0.430-1.336) (0.411-1.802) (1.597-15.514) (0.206-2.373) (0.844-4.056) (0.209-0.695)
0.747 0.899 0.894 0.338 0.691 0.006 0.566 0.124 0.002
Note: TNM stage, tumor-node-metastasis stage; HR, hazard ratio; CI, confidence interval. The bold type represents P values smaller than 0.05.
two experienced pathologists independently according to Lauren’s and the World Health Organization’s classifications (IARC Press, Lyon, 2000). TNM stage of GC were classified according to the seventh edition of the UICC/AJCC Cancer Staging Manual. All tissues were subjected to RNase inactivation with RNAlater and snap-frozen in liquid nitrogen until RNA extraction. The study was approved by the Institutional Review Board of Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology. Informed consents were obtained from all patients and they were approved for scientific research including this study. In our cohort, 78 were men (65%) and 42% were women (35%), with a median follow-up time of 37.5 months (ranged from 3 to 105 months). The clinicopathological characteristics of all patients are listed in Table 1. 4.3. RNA extraction and quantitative real-time PCR (qPCR) Total RNA from tissues samples was isolated with TRIzol Reagent (Invitrogen, Calsbad, CA, USA) according to the manufacturer’s protocol. RNA was quantified using a NanoDropTM 2000 spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). Reverse transcription reaction and quantitative real-time PCR (qPCR) were performed as described previously [19,27]. Briefly, 1 μg of total RNA was reverse-transcribed to cDNA in a final volume of 20 μl by using a reverse transcription kit (Takara, Dalian, China). Twenty-fold cDNA diluents were used as templates and amplified by qPCR using Power SYBR Green (Takara, Dalian, China) on a Roche Lightcycler 96 real time PCR machine (Roche Diagnostics, Indianapolis, IN, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as endogenous control to normalize lncRNAs. The following primers were used for the quantitative PCR: LINC01939 Forward: 5′- ATTACAGATGCCCGCCAC -3′; Reverse: 5′- ATGTCTTCCTTTCCCTTTCCC -3′; GAPDH Forward: 5′- CTCCTCCTGTTCGACAGTCAGC -3′; Reverse: 5′−CCCAATACGACCAAATCCGTT -3′. Each sample was performed in triplicate. LINC01939 levels of GC tissues were normalized to the expression level of GAPDH (ΔCt = CtLINC01939-CtGAPDH). These values were compared with values
Fig. 3. The flow chart used to identify candidate lncRNAs from lnCAR website. Using logFC < 0, Z-score threshold ± 2 and P < 0.05 as the criteria, we extracted putative lncRNAs from lnCAR database. Then these lncRNAs were interrogated into LNCipedia database for assembling intergenic lncRNAs with transcript length < 1000 bp. Compared with other cancers from lnCAR website, we identified candidate lncRNAs whose expression are lowest in gastric cancer.
Human Exon 1.0 ST Array, Arraystar Human LncRNA microarray V2.0 and V3.0, CBC Homo sapiens lncRNA + mRNA microarray V2.0). These four platforms cover about 34,377 lncRNA transcripts and variants. RNA dysregulation with log fold change (logFC) < 0, Z-score threshold: ± 2 and P values less than 0.05 were considered as “candidate lncRNAs”. The detailed flow chart is shown in Fig. 3 to identify the candidate lncRNAs from lnCAR website.
4.2. Gastric cancer tissues collection 120 paired GC tissues and adjacent normal tissues were obtained from patients who had received comprehensive treatment at Department of Surgery, Tongji Hospital of Tongji Medical College between 2007 and 2011. All cases of GC were histologically evaluated by 4
Pathology - Research and Practice xxx (xxxx) xxx–xxx
C.-L. Chen et al.
of corresponding normal tissues according to the formula: 2−ΔΔCt, where ΔΔCt = ΔCtGC tumor-ΔCtnormal.
[10] C. Lin, L. Yang, Long noncoding RNA in cancer: wiring signaling circuitry, Trends Cell Biol. 28 (2018) 287–301. [11] X. Wu, Z.F. Lim, Z. Li, L. Gu, W. Ma, Q. Zhou, H. Su, X. Wang, X. Yang, Z. Zhang, NORAD expression Is associated with adverse prognosis in esophageal squamous cell carcinoma, Oncol. Res. Treat. 40 (2017) 370–374. [12] M. Zhang, X. Du, Noncoding RNAs in gastric cancer: research progress and prospects, World J. Gastroenterol. 22 (2016) 6610–6618. [13] M. Zhuang, W. Gao, J. Xu, P. Wang, Y. Shu, The long non-coding RNA H19-derived miR-675 modulates human gastric cancer cell proliferation by targeting tumor suppressor RUNX1, Biochem. Biophys. Res. Commun. 448 (2014) 315–322. [14] J.S. Chen, Y.F. Wang, X.Q. Zhang, J.M. Lv, Y. Li, X.X. Liu, T.P. Xu, H19 serves as a diagnostic biomarker and up-regulation of H19 expression contributes to poor prognosis in patients with gastric cancer, Neoplasma 63 (2016) 223–230. [15] H. Endo, T. Shiroki, T. Nakagawa, M. Yokoyama, K. Tamai, H. Yamanami, T. Fujiya, I. Sato, K. Yamaguchi, N. Tanaka, K. Iijima, T. Shimosegawa, K. Sugamura, K. Satoh, Enhanced expression of long non-coding RNA HOTAIR is associated with the development of gastric cancer, PLoS One 8 (2013) e77070. [16] M. Hajjari, M. Behmanesh, M. Sadeghizadeh, M. Zeinoddini, Up-regulation of HOTAIR long non-coding RNA in human gastric adenocarcinoma tissues, Med. Oncol. 30 (2013) 670. [17] W. Zhao, S. Dong, B. Duan, P. Chen, L. Shi, H. Gao, H. Qi, HOTAIR is a predictive and prognostic biomarker for patients with advanced gastric adenocarcinoma receiving fluorouracil and platinum combination chemotherapy, Am. J. Transl. Res. 7 (2015) 1295–1302. [18] Y. Qi, H.S. Ooi, J. Wu, J. Chen, X. Zhang, S. Tan, Q. Yu, Y.Y. Li, Y. Kang, H. Li, Z. Xiong, T. Zhu, B. Liu, Z. Shao, X. Zhao, MALAT1 long ncRNA promotes gastric cancer metastasis by suppressing PCDH10, Oncotarget 7 (2016) 12693–12703. [19] X.Z. Yang, S.Z. Cui, L.S. Zeng, T.T. Cheng, X.X. Li, J. Chi, R. Wang, X.F. Zheng, H.Y. Wang, Overexpression of Rab1B and MMP9 predicts poor survival and good response to chemotherapy in patients with colorectal cancer, Aging (Albany NY) 9 (2017) 914–931. [20] J.R. Prensner, M.K. Iyer, O.A. Balbin, S.M. Dhanasekaran, Q. Cao, J.C. Brenner, B. Laxman, I.A. Asangani, C.S. Grasso, H.D. Kominsky, X. Cao, X. Jing, X. Wang, J. Siddiqui, J.T. Wei, D. Robinson, H.K. Iyer, N. Palanisamy, C.A. Maher, A.M. Chinnaiyan, Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression, Nat. Biotechnol. 29 (2011) 742–749. [21] T. Derrien, R. Johnson, G. Bussotti, A. Tanzer, S. Djebali, H. Tilgner, G. Guernec, D. Martin, A. Merkel, D.G. Knowles, J. Lagarde, L. Veeravalli, X. Ruan, Y. Ruan, T. Lassmann, P. Carninci, J.B. Brown, L. Lipovich, J.M. Gonzalez, M. Thomas, C.A. Davis, R. Shiekhattar, T.R. Gingeras, T.J. Hubbard, C. Notredame, J. Harrow, R. Guigo, The GENCODE v7 catalog of human long noncoding RNAs: analysis of their gene structure, evolution, and expression, Genome Res. 22 (2012) 1775–1789. [22] R.J. Taft, K.C. Pang, T.R. Mercer, M. Dinger, J.S. Mattick, Non-coding RNAs: regulators of disease, J. Pathol. 220 (2010) 126–139. [23] D.L. Chen, H.Q. Ju, Y.X. Lu, L.Z. Chen, Z.L. Zeng, D.S. Zhang, H.Y. Luo, F. Wang, M.Z. Qiu, D.S. Wang, D.Z. Xu, Z.W. Zhou, H. Pelicano, P. Huang, D. Xie, F.H. Wang, Y.H. Li, R.H. Xu, Long non-coding RNA XIST regulates gastric cancer progression by acting as a molecular sponge of miR-101 to modulate EZH2 expression, J. Exp. Clin. Cancer Res. 35 (2016) 142. [24] J. Zhou, X. Zhi, L. Wang, W. Wang, Z. Li, J. Tang, J. Wang, Q. Zhang, Z. Xu, Linc00152 promotes proliferation in gastric cancer through the EGFR-dependent pathway, J. Exp. Clin. Cancer Res. 34 (2015) 135. [25] Y.G. Chen, A.T. Satpathy, H.Y. Chang, Gene regulation in the immune system by long noncoding RNAs, Nat. Immunol. 18 (2017) 962–972. [26] K.C. Wang, H.Y. Chang, Molecular mechanisms of long noncoding RNAs, Mol. Cell 43 (2011) 904–914. [27] Z. Li, X. Wu, L. Gu, Q. Shen, W. Luo, C. Deng, Q. Zhou, X. Chen, Y. Li, Z. Lim, X. Wang, J. Wang, X. Yang, Long non-coding RNA ATB promotes malignancy of esophageal squamous cell carcinoma by regulating miR-200b/Kindlin-2 axis, Cell Death Dis. 8 (2017) e2888.
4.4. Statistical analysis All data are presented as mean ± S.D or SEM of at least three independent experiments. Student’s t-test or one-way ANOVA was used to evaluate significant differences between two groups or among three groups. The correlation between LINC01939 expression and clinicopathological characteristics was calculated by Chi-square test or Fisher’s exact test. Survival curves were performed using the Kaplan–Meier method, and the log-rank test was used to compare the differences between curves. The independent predictive value was estimated by univariate and multivariate Cox proportional hazards regression model. All statistical analyses were performed using SPSS 23.0 software package (Chicago, IL, USA) and GraphPad Prism 6.0 software (GraphPad Software, La Jolla, CA). P values < 0.05 were considered to indicate a statistically significant difference. Competing interests The authors declare that they have no competing interest. Acknowledgements This present study was supported by the National Natural Science Foundation of China (grant no. 81602391) and the Natural Science Foundation of Hubei Province (grant no. 2018CFB405). References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2015) 87–108. [2] W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X.Q. Yu, J. He, Cancer statistics in China, 2015, CA Cancer J. Clin. 66 (2016) 115–132. [3] E. Van Cutsem, X. Sagaert, B. Topal, K. Haustermans, H. Prenen, Gastric cancer, Lancet 388 (2016) 2654–2664. [4] M. Chen, X. Wu, W. Ma, Q. Zhou, X. Wang, R. Zhang, J. Wang, X. Yang, Decreased expression of lncRNA VPS9D1-AS1 in gastric cancer and its clinical significance, Cancer Biomark. (2017). [5] A.M. Schmitt, H.Y. Chang, Long noncoding RNAs in cancer pathways, Cancer Cell 29 (2016) 452–463. [6] A. Jandura, H.M. Krause, The New RNA world: growing evidence for Long noncoding RNA functionality, Trends Genet. 33 (2017) 665–676. [7] J. Zhang, N. Zhu, X. Chen, A novel long noncoding RNA LINC01133 is upregulated in lung squamous cell cancer and predicts survival, Tumour Biol. 36 (2015) 7465–7471. [8] J.J. Quinn, H.Y. Chang, Unique features of long non-coding RNA biogenesis and function, Nat. Rev. Genet. 17 (2016) 47–62. [9] X. Wu, X. Dinglin, X. Wang, W. Luo, Q. Shen, Y. Li, L. Gu, Q. Zhou, H. Zhu, Y. Li, C. Tan, X. Yang, Z. Zhang, Long noncoding RNA XIST promotes malignancies of esophageal squamous cell carcinoma via regulation of miR-101/EZH2, Oncotarget 8 (2017) 76015–76028.
5