Lovastatin attenuates ionizing radiation-induced normal tissue damage in vivo

Radiotherapy and Oncology 92 (2009) 492–499

Contents lists available at ScienceDirect

Radiotherapy and Oncology journal homepage: www.thegreenjournal.com

Experimental radiobiology

Lovastatin attenuates ionizing radiation-induced normal tissue damage in vivo Christian Ostrau a,1, Johannes Hülsenbeck a,1, Melanie Herzog a, Arno Schad b, Michael Torzewski c, Karl J. Lackner c, Gerhard Fritz a,* a

Department of Toxicology, University Medical Center of the Johannes Gutenberg University Mainz, Germany Institute of Pathology, University Medical Center of the Johannes Gutenberg University Mainz, Germany c Institute of Clinical Chemistry and Laboratory Medicine, University Medical Center of the Johannes Gutenberg University Mainz, Germany b

a r t i c l e

i n f o

Article history: Received 24 April 2009 Received in revised form 22 June 2009 Accepted 24 June 2009 Available online 15 July 2009 Keywords: Ionizing radiation Normal tissue damage Stress responses Cell death Statins

a b s t r a c t Background and purpose: HMG-CoA-reductase inhibitors (statins) are widely used lipid-lowering drugs. Moreover, they have pleiotropic effects on cellular stress responses, proliferation and apoptosis in vitro. Here, we investigated whether lovastatin attenuates acute and subchronic ionizing radiationinduced normal tissue toxicity in vivo. Materials and methods: Four hours to 24 h after total body irradiation (6 Gy) of Balb/c mice, acute proinflammatory and pro-fibrotic responses were analyzed. To comprise subchronic radiation toxicity, mice were irradiated twice with 2.5 Gy and analyses were performed 3 weeks after the first radiation treatment. Molecular markers of inflammation and fibrosis as well as organ toxicities were measured. Results: Lovastatin attenuated IR-induced activation of NF-jB, mRNA expression of cell adhesion molecules and mRNA expression of pro-inflammatory and pro-fibrotic marker genes (i.e. TNFa, IL-6, TGFb, CTGF, and type I and type III collagen) in a tissue- and time-dependent manner. cH2AX phosphorylation stimulated by IR was not affected by lovastatin, indicating that the statin has no major impact on the induction of DNA damage in vivo. Radiation-induced thrombopenia was significantly alleviated by lovastatin. Conclusions: Lovastatin inhibits both acute and subchronic IR-induced pro-inflammatory and pro-fibrotic responses and cell death in normal tissue in vivo. Therefore, lovastatin might be useful for selectively attenuating acute and subchronic normal tissue damage caused by radiotherapy. Ó 2009 Elsevier Ireland Ltd. All rights reserved. Radiotherapy and Oncology 92 (2009) 492–499

Radiotherapy is frequently used as part of cancer treatment to achieve tumor control. Apart from inducing anti-proliferative and cell-killing effects in tumor tissue, radiotherapy also provokes normal tissue damage. Pro-inflammatory and pro-fibrotic responses as well as induction of cell death can occur as acute, subchronic or late chronic side effects of radiation-based anticancer therapy and impact the life quality of the patients. Hence, pharmacological interference with radiation-induced stress responses is a promising therapeutical approach to attenuate side effects of radiotherapy. Various cytokines, including IL-1, IL-6 and TGFb are important for normal tissue reactions after radiotherapy [1–3]. Transforming growth factor beta (TGFb) and connective tissue growth factor (CTGF) as well as matrix metalloproteases (MMPs) and tissue inhibitors of metalloproteases (TIMPs) appear to be of particular relevance for late radiation reactions such as fibrosis and late enteritis [4–6]. Mechanisms of DNA repair [7] and DNA damage response (DDR) [8–10], as well as checkpoint control and

* Corresponding author. Address: Department of Toxicology, Universitätsmedizin der Johannes Gutenberg-Universität Mainz, Obere Zahlbacher Str. 67, D-55131 Mainz, Germany. E-mail address: [email protected] (G. Fritz). 1 These authors contributed equally to this work. 0167-8140/$ - see front matter Ó 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.radonc.2009.06.020

apoptosis, play key roles in the regulation of radiation-induced cell death [11]. Activation of the transcription factor NF-jB is one of the hallmarks of cellular responses to ionizing radiation [12–14]. NF-jB is of particular relevance for the regulation of inflammatory processes [15,16] and, furthermore, affects cell survival after radiation exposure [17,18]. A pharmacological approach to interfere with radiation-induced stress responses is based on the fact that small GTPases of the Rho family are required for cytokine- and genotoxic stress-stimulated activation of NF-jB [19,20]. Rho GTPases control a wide range of cellular functions, including gene expression, cell adhesion, motility and apoptosis [21–25]. They require C-terminal prenylation for correct intracellular localization and function [26]. The clinically highly relevant group of HMG-CoA-reductase inhibitors (statins), which are widely used for lipid-lowering reason, causes a depletion of the cellular pool of isoprene precursor molecules. Thereby, statins impact C-terminal prenylation of Rho GTPases, thus in turn leading to a down-modulation of Rho-regulated signal mechanisms [21,27–30]. High dose of statins, including lovastatin, cerivastatin, simvastatin and atorvastatin, is reported to promote the killing effects of tumor-therapeutic drugs and radiation on tumor cells [29,31–34] by impairing G1-S transition [35] and triggering apoptosis [36]. On the other hand, low dose

C. Ostrau et al. / Radiotherapy and Oncology 92 (2009) 492–499

of the HMG-CoA-reductase inhibitor lovastatin was found to protect primary human endothelial cells (HUVEC) from cell death induced by the anticancer drug doxorubicin and radiation [37–39]. Furthermore, pravastatin alleviates intestinal toxicity of radiation by reducing late fibrosis in rats [40], presumably by inhibition of Rho and ROCK signaling [41]. To further investigate whether lovastatin elicits beneficial effects on IR-induced early (i.e. acute) and delayed (i.e. subchronic) stress responses and cell death of normal tissue in vivo, Balb/c mice were irradiated with 6 Gy or 2  2.5 Gy (total body irradiation (TBI)). Acute and subchronic radiation-induced pro-inflammatory, pro-fibrotic, genotoxic and cytotoxic effects in the presence or absence of lovastatin were analyzed 4 h, 24 h and 21 days post TBI. Materials and methods The RNeasy Mini Kit for total RNA preparation, Shredder columns, and the OmniScript Kit for cDNA synthesis were obtained from Qiagen. DNA oligos originate from Sigma–Aldrich. dNTPs, the PCR Y-buffer, and nitrocellulose were from Perkin-Elmer. Orange Loading Dye was obtained from Fermentas. The Absolute QPCR SYBR Green Fluorescein Mix was from Thermo Fisher. The antibody directed against cH2AX was purchased from Millipore. ERK2 antibody used in this study was obtained from Santa Cruz, antibody for phosphorylated IjBa (p-IjBa) originated from New England Biolabs. Hyperfilm ECL was from GE Healthcare. Taq DNA Polymerase was a kind gift of H. Kleinert (Mainz, Germany). For immunohistochemistry, the Cytomation Envision/Detection Kit (Dako) was used. The Mouse IL-6 ELISA was obtained from eBioscience (USA). Cell culture conditions Human hepatoma cells (HepG2) were routinely grown in RPMI medium containing 5% of fetal bovine serum at 37 °C in humidified atmosphere. Mouse experiments For all experiments, female Balb/c mice were used. Mice were bred in our local specific-pathogen free animal housing facility and were 3–4 months of age and weighed an average of 25 g at the start of the experiments. They were housed three to five per cage, exposed to 12 h light dark cycles, and given free access to sterilized pelleted food and sterilized water. Mice were divided into groups of 3 or 6 animals. The control group was left untreated. The lovastatin and the IR + lovastatin groups were treated with 10 mg/kg of lovastatin (p.o.) 48 h and 24 h before total body irradiation (TBI) was performed with 6 Gy (Co-60 source). Four hours or 24 h after radiation exposure mice were sacrificed for the analysis of acute radiation responses. In case of analysis of subchronic toxicity, TBI was performed with 2  2.5 Gy on day 3 and day 10 after the first lovastatin application (10 mg/kg, p.o). Animals were sacrificed 3 weeks after first TBI. Organs were either fixed in 4% paraformaldehyde for histological sections or immediately frozen in liquid nitrogen and stored at 80 °C for biochemical analyses. Blood samples were collected and either directly analyzed for blood cell counts or left at room temperature for 2 h to allow coagulation. Subsequently, samples were centrifuged (10 min, 5000g) to yield serum for the analysis of serum parameters. Total RNA purification and RT-PCR Total RNA from different tissues was purified using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions.

493

Briefly, 25–30 mg of tissue was lysed using an Ultra-Turrax and homogenized by passage through Shredder columns (Qiagen). Total RNA was bound to silica membranes, washed, and eluted with RNase free H2O. The RNA yield was 5–20 lg of total RNA, depending on the tissue used. The RT reaction was performed using the OmniScript Kit (Qiagen) according to the manufacturer’s protocol. For each reaction, 500 ng of total RNA was applied. PCRs were performed using the Ybuffer (Perkin-Elmer). Taq DNA Polymerase was kindly provided by H. Kleinert (Mainz, Germany). For each reaction, 2 ll of diluted (1:10) cDNA, primers (0.42 lM each), and dNTPs (0.35 lM each; Perkin-Elmer) was used. Primer sequences and product sizes are listed below. After denaturation step (95 °C, 2 min) PCR cycles (30 cycles) were performed as follows: 95 °C, 30 s; 60 °C, 30 s; 72 °C, 40 s. Reaction was terminated by incubation at 72 °C for 10 min. Orange Loading Dye (Fermentas) was then added and the PCR products were analyzed by gel electrophoresis using 1.2% agarose gels. Real-time PCR Real-time PCR was performed using the Absolute QPCR SYBR Green Fluorescein Mix (Thermo Fisher) and a MyIQ Thermal Cycler (BioRad). For each reaction, 2 ll of diluted (1:10) cDNA and specific primers (0.06 lM each) was used. After denaturation step (95 °C, 15 min), PCR (40 cycles) was conducted according to the following protocol: 95 °C, 30 s; 60 °C, 1 min; 72 °C, 1 min. At the end of each reaction, the melting curve was recorded to ensure the specificity of the reaction. From each sample, real-time PCR analysis was performed in duplicate or triplicate. Data were analyzed using IQ5 Optical System Software 2.0 (BioRad). The sequence of the forward (f) and reverse (r) primers used for amplification reactions were created using the Primer3 software [42]. GAPDH, f: AACTTTGGCATTGTGGAAGG, r: CACATTGGGGGTAGGAACAC (222 bp product); b-actin, f: GCATTGCTGACAGGATGCAG, r: CCTGCTTGCTGATCC ACATC (159 bp); CTGF, f: CAAAGCAGCTGCAAATACCA, r: GGCCAA ATGTGTCTTCCAGT (220 bp); TGFb, f: TGCGCTTGCAGAGATTAAAA, r: AGCCCTGTATTCCGTCTCCT (186 bp); IL-1a, f: AAGCAACGGGAAG ATTCTGA, r: TGACAAACTTCTGCCTGACG (179 bp); IL-6, f: AGTTGC CTTCTTGGGACTGA, r: CAGAATTGCCATTGCACAAC (191 bp); IL-10, f: AGTTGCCTTCTTGGGACTGA, r: CAGAATTGCCATTGCACAAC (194 bp); TNFa, f: AGCCCCCAGTCTGTATCCTT, r: CTCCCTTTGCAG AACTCAGG (212 bp); E-selectin, f: CCTAGACGTTGTAAGAAGGC, r: GATTGGACACTCAATGGATC (271 bp); ICAM-1, f: CGAAGGTGGT TCTTCTGAGC, r: GTCTGCTGAGACCCCTCTTG (238 bp); collagen type I, f: CACCCTCAAGAGCCTGAGTC, r: AGACGGCTGAGTAGGGAACA (220 bp); collagen type III, f: GGAGCCCCTGGACTAATAGG, r: ATCCA TCTTTGCCATCTTCG (193 bp). Preparation of protein extracts For preparation of total protein extracts, 15 mg of the respective organs was disrupted by Ultra-Turrax in lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM Na3VO4, 1 lg/ml Complete EDTA free (Roche), 1 mM PMSF, 1% Triton X-100). Subsequently, samples were sonicated. After centrifugation (10 min, 10.000  g, 4 °C), the pellet was discarded and the supernatant was used for protein determination by Bradford and subsequent Western blot analysis. Total extracts from HepG2 cells were obtained by lysis of 106 cells in SDS sample buffer. SDS–PAGE and Western blot analysis Protein extracts were separated by SDS–PAGE. Subsequently, proteins were transferred onto nitrocellulose membranes (Perkin-Elmer) using a Protean Mini Cell (BioRad). After completion of the transfer, membranes were blocked in 5% non-fat milk in

494

Lovastatin and IR-induced normal tissue toxicity

TBS/0.1% Tween 20 for at least 60 min. Incubation with the primary antibody (as indicated) was conducted overnight at 4 °C. Incubation with peroxidase conjugated anti-mouse or anti-rabbit secondary antibody (1:2000) (Rockland) was performed for 120 min at room temperature. Bound antibodies were then visualized using a chemiluminescence reaction and Hyperfilm ECL (GE Healthcare). For densitometrical quantification of the autoradiographies, the Multi Analyst software (BioRad) was applied. Immunohistochemistry Paraffin-embedded tissue was cut to obtain sections of about 4 lm thickness. Paraffin was removed by incubation in Xylol. Samples were rehydrated using an ethanol/H2O gradient. For antigen demasking, sections were incubated in citrate buffer (0.1 M sodiumcitrate, pH 6, 10 mM EDTA) in a steam boiler for 20 min. Samples were then blocked for 120 min using 5% BSA in PBS. Incubation with the primary antibody (cH2AX: 1:100) was conducted overnight at 4 °C. Incubation with the secondary antibody (1:100) was done for 120 min at room temperature. Bound antibodies were visualized using the Chemmate Envision/Detection Kit (Dako). With this method, phosphorylated H2AX is detectable by a brown nuclear staining. Sections were analyzed microscopically using an Axiovert 35 microscope (Zeiss, Germany). Analysis of cH2AX foci formation in HepG2 cells was performed as described [43]. Briefly, cells were seeded onto cover slips. After fixation step (4% formaldehyde followed by a second fixation step with 100% methanol ( 20 °C, 20 min)) and blocking in PBS/5% BSA (+0.3% Triton X-100), cH2AX antibody (1:1000) was added onto the cells. After overnight incubation at 4 °C and washing, cells were incubated with Alexa Fluor 488-coupled anti-mouse antibody (1:500; 2 h, RT). DNA was stained by DAPI. Fifty cells were scored per experiment. Each experiment was repeated 3 times.

Serum GPT and GLDH activities were assayed to detect liver toxicity and creatinine level in serum was taken as indicator of nephrotoxicity. Serum was analyzed using an Architect C8000 (Abbot, United Kingdom). All these parameters were determined by routine analysis in the Institute of Clinical Chemistry and Laboratory Medicine (University Medical Center of the Johannes Gutenberg University, Mainz, Germany). The serum level of IL-6 was determined using the Mouse IL-6 ELISA (eBioscience, USA) according to the manufacturer’s instructions. Briefly, ELISA plates were coated with capture antibody overnight. After blocking, samples were applied and incubated overnight. Subsequently, bound IL-6 was detected using a horseradish-peroxidase coupled detection antibody and a colorimetric substrate (measured densitometrically at 450 nm). Results were quantified using a standard curve generated from purified IL-6. Results In a first set of experiments we aimed to investigate the effect of lovastatin on acute radiation responses. To this end, lovastatin was orally administered to Balb/c mice for two days before total body irradiation (TBI) with a dose of 6 Gy. A well-known hallmark of acute IR-induced normal tissue reactions is the activation of the transcription factor NF-jB followed by the expression of distinct cytokines [2,46,47]. As analyzed 4 h after TBI in liver extracts, IR exposure resulted in an activation of NF-jB as indicated by the increase in the phosphorylation of its inhibitory molecule IjBa (Fig. 1A). IR-stimulated activation of NF-jB was largely attenuated by lovastatin pretreatment (Fig. 1A). IR and inflammatory cytokines are able to upregulate the expression of cell adhesion molecules, including inter-cellular adhesion molecule 1 (ICAM-1) and endothelial selectin (E-selectin) in a NF-jB dependent manner

Analysis of IR-induced genotoxic effects Phosphorylation of histone H2AX (cH2AX), which is catalyzed by protein kinases ATM/ATR and DNA-PKcs is known to be highly indicative for the formation of DNA double strand breaks (DSBs) [44,45]. To investigate the effect of lovastatin on IR-induced genotoxicity, phosphorylation status of H2AX was analyzed by Western blot analysis or by immunohistochemistry. Immunohistochemical detection of cH2AX foci is described above. Time dependent decrease in the number of cH2AX foci can be taken as indication of the cellular DSB repair capacity [44]. Additionally, in order to detect the formation of DNA strand breaks in leukocytes, the alkaline comet assay was performed as described [39]. Briefly, at different time points after exposure, 104 blood leukocytes were embedded in low melting-point agarose and transferred onto agarose-covered microscope slides. Cells were lysed for 1 h in lysis buffer (2.5 M NaCl, 100 mM EDTA, 10 mM Tris, 1% Na-laurylsarcosinate, 1% Triton X-100, 10% DMSO, pH 10), followed by incubation in alkaline electrophoresis buffer (300 mM NaOH, 1 mM EDTA, pH 13) for 25 min before electrophoresis was performed (25 V, 300 mA for 15 min). Afterwards, cells were washed with 0.4 M Tris (pH 7.5), distilled H2O and finally with ethanol. DNA was stained with ethidium bromide. Comets were visualized by microscopy and quantified by determination of the ‘‘Olive tail moment” (OTM) using computer-based software (Komet 4.02, Kinetics Imaging, United Kingdom). Fifty cells were analyzed per measurement for the calculation of the mean value. Determination of hematotoxicity and analysis of blood serum parameters To measure IR-induced hematotoxicity, the number of blood cells was determined using an ADVIA 120 (Siemens, Germany).

Fig. 1. Lovastatin attenuates IR-induced activation of NF-jB and mRNA expression of ICAM-1. (A) Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 6 Gy. Four hours after TBI, protein extracts were isolated from liver and the level of phosphorylated IjBa (p-IjBa) was determined by Western blot analysis as described in Materials and methods. Shown is the autoradiography of a single representative experiment. ERK2 protein expression was monitored as internal loading control. For densitometrical quantitation, the relative level of pIjBa expression in untreated control was set to 1.0. Con, untreated; Lova, Lovatreated; IR, irradiated; IR + Lova, TBI after lovastatin pretreatment. (B) mRNA level of the adhesion molecule ICAM-1 in large blood vessels. Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 6 Gy as described in Materials and methods. Four hours after TBI, large blood vessels (i.e. pulmonary artery and vein as well as abdominal aorta) were isolated and pooled for the isolation of total RNA. Subsequently, semiquantitative PCR analysis was performed to detect the expression of the cell adhesion molecule ICAM-1. Amplification products were loaded onto 1.2% agarose gels and visualized by ethidium bromide staining. Shown is the gel from one representative set of experiments. ICAM-1 mRNA expression shown in the histogram was assayed by real-time PCR analysis (triplicate determinations). The level of ICAM-1 mRNA was normalized to the levels of GAPDH and b-actin and set to 1.0 in the untreated control (Con).

495

C. Ostrau et al. / Radiotherapy and Oncology 92 (2009) 492–499

[47–50]. Therefore, we investigated the effect of IR and lovastatin on the mRNA expression of ICAM-1 and E-selectin in large blood vessels (i.e. pulmonary artery and vein and abdominal aorta). As shown in Fig. 1B, ICAM-1 mRNA level was upregulated in response to TBI. Pretreatment with lovastatin attenuated the IR-induced increase in the mRNA expression of ICAM-1 (Fig. 1B). Under identical experimental condition, E-selectin mRNA expression was also induced by IR and lovastatin blocked this response (data not shown). These in vivo data are in line with in vitro results recently reported for primary human endothelial cells (HUVEC) [51]. Next, we analyzed the effect of lovastatin pretreatment on mRNA expression of pro-inflammatory and pro-fibrotic cytokines in the liver 4 h after TBI. We found that, under our experimental conditions, lovastatin impaired the IR-induced upregulation of TNFa (Fig. 2A) and of pro-fibrotic Connective Tissue Growth Factor (CTGF) (Fig. 2B). Apart from TNFa and CTGF, liver specific mRNA expression of other markers of inflammation, including IL-1a, IL6 and TGFb was not affected at this early time point (i.e. 4 h) after irradiation (Table 1). In the intestine, radiation caused rapid upregulation of both TGFb and CTGF mRNA expression which was sensitive to lovastatin (Fig. 2C and Table 1). Yet, TBI failed to stimulate intestinal mRNA expression of IL-1a and IL-6 (Table 1). Radiation, however, resulted in an increase in the serum protein level of IL6, as analyzed by ELISA-based method (data not shown). This rise in IL-6 was only tendentially, yet not significantly, affected by lovastatin pretreatment (data not shown). TBI did not provoke signif-

Fig. 2. Effect of lovastatin on mRNA expression of pro-inflammatory and profibrotic marker genes 4 h after TBI of Balb/c mice. (A and B) Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 6 Gy. Four hours after irradiation total RNA was isolated from liver and used to synthesize cDNA as described in Materials and methods. Subsequently, real-time PCR analyses were performed. The levels of TNFa (A) and CTGF (B) mRNA were normalized to the levels of GAPDH and b-actin and set to 1.0 in the untreated control (Con). Data shown are the mean ± SD from n = 3 mice. (C) Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 6 Gy. Four hours after irradiation total RNA was isolated from intestinal tissue and used to synthesize cDNA as described in Materials and methods. Subsequently, real-time PCR analyses were performed. The levels of CTGF and TGFb mRNA were normalized to the levels of GAPDH and b-actin and set to 1.0 in the untreated control (Con). Data shown are the mean ± SD from n = 3 mice.

Table 1 Expression of pro-inflammatory and pro-fibrotic markers genes 4 h after TBI (6 Gy) of Balb/c mice. Balb/c mice were pretreated with lovastatin and irradiated as described in Materials and methods. Four hours after irradiation, total mRNA was isolated from liver, lung and intestine and used for the synthesis of cDNA as described in Materials and methods. Subsequently, semiquantitative RT-PCR analyses as well as real-time PCR analyses were performed to detect the mRNA expression level of the marker genes indicated. In case of semiquantitative analyses, amplification reactions were separated onto 1.2% agarose gels and visualized by ethidium bromide staining. These gels were densitometrically evaluated to quantify the effects of IR and lovastatin on gene expression. Additionally, real-time PCR analyses were performed as described in Materials and methods. Data shown are based on the analysis of n = 3 mice. A positive result (+) indicates an upregulation of the mRNA expression of a given gene by >1.5fold. Real-time PCR runs were performed in duplicate. 0, no effect; nd, not determined; – not applicable as TBI showed no stimulatory effects. Marker protein

Liver

Lung

Intestine

Effect Attenuated of IR by lovastatin?

Effect Attenuated of IR by lovastatin?

Effect Attenuated of IR by lovastatin?

CTGF TGFb TNFa IL-1a IL-6 IL-10 Coll type I Coll type III

+ 0 + 0 0 0 0 0

0 0 0 0 0 0 0 0

+ + 0 0 0 0 nd nd

Yes – Yes – – – – –

– – – – – – – –

Yes Yes – – – – nd nd

icant changes in the mRNA expression of pro-inflammatory and pro-fibrotic cytokines in the lung (Table 1) or kidney (data not shown). Analysing the effect of lovastatin pretreatment on TBI-induced tissue responses 24 h after irradiation, similar protective effects were observed as described for the 4 h time point. For instance, 24 h after IR exposure, lovastatin was found to abrogate IR-stimulated upregulation of CTGF in the liver (data not shown). Furthermore, it attenuated the TBI-provoked upregulation of TGFb, CTGF, MMP9 and IL-10 mRNA expression in the intestine (data not shown). Summarizing, the data show that lovastatin is able to impair acute (i.e. 4 and 24 h after TBI) pro-inflammatory and pro-fibrotic radiation responses in vivo in a tissue-specific manner. Ionizing radiation generates DNA double strand breaks (DSBs), which rapidly lead to the activation of the serine/threonine protein kinases Ataxia telangiectasia mutated (ATM) and DNA protein kinase (DNA-PKcs) [44,45]. These kinases, which play key roles in the regulation of the DNA damage response, catalyze the phosphorylation the histone H2AX (cH2AX) [44,45]. Hence, cH2AX is indicative of DNA damage, in particular of DSB. To check whether the level of initial DNA damage induced after TBI is altered by lovastatin pretreatment, H2AX phosphorylation was determined in liver extracts by Western blot analysis. As shown in Fig. 3A, the basal level of cH2AX was low in untreated mice and in mice pretreated with lovastatin. Irradiation resulted in increased level of cH2AX as expected (Fig. 3A). This IR-induced stimulation of H2AX phosphorylation was not affected by administration of lovastatin (Fig. 3A). Apparently, lovastatin does not impact DNA damage induction by TBI in vivo. Similar results were obtained upon immunohistochemical analysis of cH2AX phosphorylation in liver sections (Fig. 3B). Lovastatin also did not affect TBI-induced DNA strand breaks formation in peripheral blood leukocytes as analyzed by the Comet assay (data not shown). In vitro experiments using human hepatoma cells (HepG2) showed that the level of phosphorylated H2AX, as assayed by Western blot analysis 0.5 and 4 h after irradiation (2.5 Gy), was not affected by lovastatin (Fig. 3C). Also the number of cH2AX foci measured 4 h after irradiation was identical in statin-pretreated and non-treated cells (Fig. 3D). However, 30 min after irradiation the statin-pretreated cells revealed a slight (i.e. about 25%), but statistically significant, reduction in the number of cH2AX foci. This finding indicates that lovastatin might

496

Lovastatin and IR-induced normal tissue toxicity

accelerate the repair of radiation-induced DSB in vitro without affecting the residual level of damage. In order to investigate the effect of lovastatin on subchronic radiation responses, Balb/c mice were irradiated twice (TBI; 2  2.5 Gy) and sacrificed 21 days after the first radiation treatment. Lovastatin pretreatment (10 mg/kg, p.o.) was performed for 48 h before TBI. Lovastatin post-treatment (10 mg/kg, p.o.) was done on a regular basis (3 times per week). The mRNA expression of a variety of pro-inflammatory and pro-fibrotic markers was analyzed in different organs, in particular in liver, lung and intestine, 3 weeks after the first irradiation. The results obtained are summarized in Table 2. Out of all marker molecules checked, none exhibited an altered expression level as compared to untreated control animals in the liver and intestine (Table 2). The same negative results were obtained with kidney (data not shown). In contrast to these organs, the lung seemed to be more prone to subchronic pro-inflammatory and pro-fibrotic responses after TBI. This tissue showed an upregulation of the mRNA levels of TGFb collagen type I and type III (Fig. 4A) as well as of IL-6 (Fig. 4B). Notably, IR-induced upregulation of each of these factors was

Table 2 Effect of lovastatin on TBI-induced subchronic tissue toxicity. Balb/c mice were treated with lovastatin and irradiated twice with 2.5 Gy as described in Materials and methods. On day 21 after the first radiation treatment, total mRNA was isolated from liver, lung and intestine and was used for the synthesis of cDNA. Subsequently, semiquantitative RT-PCR analyses as well as real-time PCR analyses were performed to detect the mRNA expression level of the marker genes indicated. In case of semiquantitative analyses, amplification reactions were separated onto 1.2% agarose gels and visualized by ethidium bromide staining. For quantitation, gels were densitometrically analyzed. In addition, real-time PCR analyses were performed as described in Materials and methods. Data shown are based on the analysis of n = 3–6 mice. A positive result (+) indicates an upregulation of the mRNA expression of a given gene by >1.5-fold. Real-time PCR runs were performed in duplicate. 0, no effect; nd, not determined; – not applicable as TBI failed to evoke stimulatory effects. Marker protein

Liver

Lung

Intestine

Effect Attenuated of IR by lovastatin?

Effect Attenuated of IR by lovastatin?

Effect Attenuated of IR by lovastatin?

CTGF TGFb TNFa IL-1a IL-6 IL-10 Coll type I Coll type III

0 0 0 0 0 0 0 0

0 + 0 0 + 0 + +

0 0 0 0 0 0 0 0

– – – – – – – –

– Yes – – Yes – Yes Yes

– – – – – – – –

responsive to lovastatin treatment (Fig. 4A and B). Pathological examination of the lung of irradiated mice however failed to detect any significant morphological changes under our experimental conditions (data not shown). Measuring the activity of different liver-specific enzymes (i.e. GPT, GLDH) in the serum of control and irradiated mice, we did not find any difference between the control and irradiated groups at the time of analysis (data not shown). Kidney damage, which was analyzed by measuring the serum level of creatinine, was also not detectable under our experimental conditions (data not shown). Very likely, the low cumulative dose of 5 Gy applied and the short post-incubation time of 21 days were not sufficient to induce significant morphological changes or functional tissue damage. Apart from inducing inflammation and fibrosis, irradiation is also well known to cause bone marrow depression. To figure out whether lovastatin impacts the hematotoxicity of TBI, we checked

Fig. 3. Influence of lovastatin on histone H2AX phosphorylation in response to IR. (A) Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 6 Gy. Four hours after irradiation, protein extracts were isolated from liver as described in Materials and methods. The level of phosphorylated histone H2AX (cH2AX) and ERK2, which was used as internal loading control, were determined by Western blot analysis. Shown is the result of a representative experiment. The histogram shows the results of the densitometrical quantitation (mean ± SD; n = 3 mice). The signal intensity of cH2AX was normalized to the respective ERK2 signal and set to 1.0 in the untreated control (Con). (B) Mice were treated as described under A. Four hours after TBI, cH2AX phosphorylation was analyzed in liver sections by immunohistochemistry. The result of one representative experiment is shown. (C) Human hepatoma cells (HepG2) were pretreated overnight with 5 lM of lovastatin. Thirty minutes and 4 h after irradiation (IR) (2.5 Gy), phosphorylation of H2AX (cH2AX) was analyzed by Western blot analysis. Shown is the result of one representative experiment. ERK2 protein expression was analyzed as internal loading control. Con, untreated control. (D) Human hepatoma cells (HepG2) were pretreated overnight with 5 lM of lovastatin (Lova). 0.5 and 4 h after irradiation (IR; 2.5 Gy), the number of nuclear cH2AX foci was analyzed as described in Materials and methods. Data shown are the mean ± SD of three independent experiments. In each experiment n = 50 nuclei were analyzed. Statistical analysis was performed using the Student’s t-test. p 6 0.05 = statistically significant difference.

Fig. 4. Effect of lovastatin on TBI-induced subchronic toxic effects. (A) Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 2  2.5 Gy as described in Materials and methods. Twenty-one days after the first radiation treatment, total RNA was isolated from lung tissue and used for cDNA synthesis. Subsequently, real-time PCR analyses were performed. The levels of TGFb collagen type I and type III mRNA were normalized to the levels of GAPDH and b-actin and set to 1.0 in the untreated control (Con). Data shown are the mean ± SD from n = 3 to 6 mice. (B) Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 2  2.5 Gy as described in Materials and methods. Twenty-one days after the first radiation treatment, total RNA was isolated from lung tissue and used for cDNA synthesis. Subsequently, real-time PCR analyses were performed. The level of IL-6 mRNA was normalized to the level of GAPDH and b-actin and set to 1.0 in the untreated control (Con). Data shown are the mean ± SD from n = 3 to 6 mice.

C. Ostrau et al. / Radiotherapy and Oncology 92 (2009) 492–499

Fig. 5. Influence of lovastatin on TBI-induced hematotoxicity. Balb/c mice were pretreated with lovastatin (10 mg/kg, p.o.) and irradiated with 2  2.5 Gy as described in Materials and methods. Twenty-one days after the first TBI, animals were sacrificed and blood samples were taken by heart punctuation. Blood cell distribution was determined as described in Materials and methods. The number of thrombocytes (A) and leukocytes (B) was determined from n = 5 to 6 mice. Statistical analysis was performed using the Mann–Whitney Rank Sum Test. The horizontal line shows the median, the boxes represent the 25th and 75th percentiles. The error bars define the maximum and minimum values. A p < 0.05 is considered as statistically significant difference.

the number of discrete blood cell populations in the mice 21 days after the first radiation exposure. Whereas the red blood cell count was not altered in response to IR-treatment (data not shown), a clear cytotoxic effect of irradiation was observed regarding the number of thrombocytes and leukocytes. Both their numbers were significantly reduced in irradiated animals as compared to the nonirradiated control (Fig. 5A and B). Lovastatin exhibited unequal effects on IR-induced hematotoxicity; while it did not protect from IR-induced leukopenia (Fig. 5B), lovastatin significantly reduced IR-induced thrombopenia (Fig. 5A). Apparently, lovastatin has cell-type specific protective effects against radiation-induced hematotoxicity. Discussion Statins are clinically established lipid-lowering drugs which display numerous additional biological effects independent of their cholesterol lowering activity [29,52]. By depleting the cellular pool of isoprene precursor molecules, statins impact the C-terminal prenylation of regulatory proteins, including small GTPases of the Ras and Rho family. Therefore, Ras/Rho GTPases are believed to be physiologically relevant targets of statins [21,27,28]. With respect to tumor therapy, various statins have been reported to be proapoptotic on tumor cells [31,34,53] and to potentiate the cell killing efficiency of anticancer therapeutics, including antineoplastic drugs and radiation [29,52]. Unfortunately these anticancer effects of statins require rather high concentrations (i.e. >10 lM) and, hence, it remains questionable whether these concentrations can be achieved in men without eliciting serious side effects (i.e. rhabdomyolysis). On the other hand, lower doses of lovastatin (i.e. <10 lM) protect primary human endothelial cells from cell killing by IR and the anticancer drug doxorubicin [37,38]. In line with these data, pravastatin was reported to protect rats from late intestinal fibrosis after local radiotherapy [6,40,54]. This protective ef-

497

fect of pravastatin appears to be due to the inhibition of Rho/ ROCK signaling since similar protective effects were observed by use of a specific ROCK inhibitor [41,55]. Overall these data indicate that statins might be useful to alleviate side effects of radiotherapy on normal tissue by attenuating Rho-signaling. Here, we further addressed the question of putative beneficial effects of statins on radiation-induced normal tissue toxicity. To this end mice were irradiated with either 6 Gy or 2  2.5 Gy. Acute and subchronic pro-inflammatory and pro-fibrotic stress responses and cell death were analyzed 4 h, 24 h and 21 days after TBI in various tissues. Regarding the acute (i.e. 4 and 24 h after TBI with 6 Gy) radiation responses, lovastatin was found to inhibit the activation of the transcription factor NF-jB and the expression of proinflammatory cell adhesion molecules such as ICAM-1 and E-selectin. Similar results have been obtained in vitro in endothelial cells [51,56]. Furthermore, we found that lovastatin attenuated the IRstimulated mRNA expression of the pro-fibrotic factor CTGF in both liver and intestine. This finding is in line with data obtained from other group [6]. In this context it should be noted that basal CTGF expression is also inhibited by statins in vitro, with simvastatin and lovastatin being much more efficient than pravastatin [57]. Bearing this in mind, it is tempting to speculate that simvastatin and lovastatin might be more effective in counteracting radiation-induced side effects than pravastatin. CTGF is known as a downstream target of TGFb [6]. Correspondingly, we observed that lovastatin attenuated early (i.e. 4 h) IR-induced TGFb and CTGF expression in the intestine as anticipated. Strikingly, in the liver, only CTGF expression was observed to be upregulated by TBI. Possibly, tissue-specific differences in the onset and duration of stress responses account for this observation. Another tissue specificity observed was that the mRNA expression of TNFa was induced by TBI in liver but not in the intestine. Notably, liver-specific TNFa expression was impaired by lovastatin, too. IR-induced cell killing is mainly the consequence of the induction of DNA damage, in particular of DNA double strand breaks (DSBs). As tissue damage gives rise to inflammatory and fibrotic responses, it appears feasible that the protective effect of lovastatin results from a reduction in IR-provoked DNA damage and DNA damage-triggered cell death [58]. Measuring H2AX phosphorylation (cH2AX), which is highly indicative of DNA damage induction [59], in liver extracts by Western blot analysis, we did not find any difference between the lovastatin pretreated and non-pretreated irradiated groups. Immunohistochemical detection of cH2AX foci in liver sections and alkaline comet-based strand-break analysis in peripheral blood lymphocytes supported the notion that lovastatin does not impact initial DNA damage induction by IR in vivo. Moreover, in vitro analysis using human hepatoma cells showed that lovastatin neither reduces early (i.e. 30 min) phosphorylation of H2AX nor the residual (i.e. 4 h) level of cH2AX phosphorylation. Also the level of residual cH2AX foci, as measured 4 h after radiation exposure by immunohistochemistry, was very similar in statin-pretreated and non-pretreated HepG2 cells. These data are in agreement with the previously reported in vitro data obtained by use of endothelial cells (HUVEC) [37]. Notably, however, the number of cH2AX foci measured 30 min after radiation treatment was reduced in lovastatin pretreated HepG2 cells by 25%. This finding implicates that lovastatin slightly accelerates the repair of DSB, at least in vitro. In line with these data, it has been recently reported that atorvastatin ameliorates the repair of oxidative DNA damage in vascular smooth muscle cells (VSMCs) without affecting the initial level of DNA damage [60]. Summarizing, the observed inhibitory effects of lovastatin on TBI-induced acute stress responses of normal tissue in vivo are very likely not due to a reduction in initial DNA damage formation. Rather, they might be related to an enhanced repair of DNA damage. Yet, whether there is a causal relationship between DNA repair and

498

Lovastatin and IR-induced normal tissue toxicity

acute, tissue-specific inflammatory stress responses remains to be elucidated in forthcoming studies. Another important question that needs to be addressed in future is, whether the slight acceleration of DSB repair by lovastatin is sufficient to promote cell survival at late time points. Up to now, pro-survival effects of lovastatin have only been reported for human endothelial cells [37] and, very recently, for VSMCs [60]. Neither human fibroblasts [37] nor human tumor cells [33,61] show radioresistance upon administration of statins. Apart from having impact on acute radiation-induced responses, lovastatin also attenuated subchronic (i.e. 3 weeks post TBI) pro-inflammatory and pro-fibrotic radiation effects such as an increase in the mRNA expression of IL-6, TGFb, CTGF and type I and type III collagen. Noteworthy, these IR-induced responses and protective statin effects are restricted to lung tissue and were observed neither for liver, intestine nor kidney, again pointing to the tissue specificity of both radiation and lovastatin effects. The observed tissue-specificities might result from differences in the expression pattern of Rho GTPases [62], which play key roles in stress-signaling and as targets of statins [21]. Pathological examination of lung tissue failed to detect clear morphological changes in irradiated mice. Absence of radiation-induced morphological changes in the lung is very likely due to the low cumulative radiation dose (5 Gy) and, furthermore, the limited post-incubation period of 3 weeks, which is too short for the manifestation of histopathologically detectable changes. Under our experimental setup, the cumulative TBI dose of 5 Gy also failed to induce significant subchronic liver or kidney toxicities as indicated by analyses of the corresponding serum parameters (i.e. GPT and GLDH to detect liver toxicity and creatinine to detect kidney toxicity). Lack of functional toxicity is probably due to the early time point (i.e. 3 weeks) of analysis and/or the low TBI dose of 5 Gy. However, 5 Gy was sufficient to induce massive bone marrow depression as reflected by the significant decrease in the number of peripheral blood lymphocytes and thrombocytes. Notably, lovastatin significantly protected the mice from IR-induced thrombopenia without having beneficial effects on IR-induced leukopenia. Hence, it appears that lovastatin selectively interferes with particular steps in hematopoiesis. Our data indicate that lovastatin specifically maintains the function of megakaryocytes, which are the source of thrombocytes, upon radiation exposure. Radiation-induced loss in viability and function of myeloblasts and/or lymphoid progenitor cells seems not to be affected by lovastatin. Overall the data show that lovastatin has tissue-specific antiinflammatory and anti-fibrotic effects in vivo, thereby counteracting acute and subchronic normal tissue damage provoked by radiation. The protective effect of lovastatin appears to be independent of radiation-induced formation of DSB. Yet, it might be related to an accelerated repair of DSB. Based on the data we suggest that lovastatin is clinically useful to alleviate side effects of radiotherapy, thus improving the overall therapeutic efficiency and tolerance of radiation-based tumor therapy. Acknowledgements This work was supported by the Deutsche Krebshilfe (107361). We are very grateful to B. Kaina and W.P. Roos for helpful discussions. Furthermore, we thank Katrin Roth for excellent technical support. References [1] Zhao W, Robbins ME. Inflammation and chronic oxidative stress in radiationinduced late normal tissue injury: therapeutic implications. Curr Med Chem 2009;16:130–43.

[2] Herskind C, Bamberg M, Rodemann HP. The role of cytokines in the development of normal-tissue reactions after radiotherapy. Strahlenther Onkol 1998;174:12–5. [3] Haase O, Rodemann HP. Fibrosis and cytokine mechanisms: relevant in hadron therapy? Radiother Oncol 2004;73:S144–7. [4] Strup-Perrot C, Mathe D, Linard C, Violot D, Milliat F, Francois A, et al. Global gene expression profiles reveal an increase in mRNA levels of collagens, MMPs, and TIMPs in late radiation enteritis. Am J Physiol Gastrointest Liver Physiol 2004;287:G875–85. [5] Vozenin-Brotons MC, Milliat F, Sabourin JC, de Gouville AC, Francois A, Lasser P, et al. Fibrogenic signals in patients with radiation enteritis are associated with increased connective tissue growth factor expression. Int J Radiat Oncol Biol Phys 2003;56:561–72. [6] Haydont V, Mathe D, Bourgier C, Abdelali J, Aigueperse J, Bourhis J, et al. Induction of CTGF by TGF-beta1 in normal and radiation enteritis human smooth muscle cells: Smad/Rho balance and therapeutic perspectives. Radiother Oncol 2005;76:219–25. [7] Friedberg EC, Wallner GC, Siede W. DNA repair and mutagenesis. Washington: ASM Press; 1995. [8] Iliakis G, Wang Y, Guan J, Wang H. DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene 2003;22:5834–47. [9] Yang J, Yu Y, Hamrick HE, Duerksen-Hughes PJ. ATM, ATR and DNA-PK: initiators of the cellular genotoxic stress responses. Carcinogenesis 2003;24:1571–80. [10] Cortez D, Guntuku S, Qin J, Elledge SJ. ATR and ATRIP: partners in checkpoint signaling. Science 2001;294:1713–6. [11] Sancar A, Lindsey-Boltz LA, Unsal-Kacmaz K, Linn S. Molecular mechanisms of mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem 2004;73:39–85. [12] Devary Y, Rosette C, DiDonato JA, Karin M. NFkappaB activation by ultraviolet light not dependent on a nuclear signal. Science 1993;261:1442–5. [13] Rosette C, Karin M. Ultraviolet light and osmotic stress: activation of the JNK cascade through multiple growth factor and cytokine receptors. Science 1996;274:1194–7. [14] Canman CE, Kastan MB. Three paths to stress relief. Nature 1996;384:213–4. [15] Baeuerle PA, Baltimore D. NF-kappa B: ten years after. Cell 1996;87:13–20. [16] Lenardo MJ, Baltimore D. NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 1989;58:227–9. [17] Baichwal VR, Baeuerle PA. Activate NF-kappa B or die? Curr Biol 1997;7:R94–6. [18] Wang CY, Mayo MW, Baldwin Jr AS. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB. Science 1996;274:784–7. [19] Gnad R, Kaina B, Fritz G. Rho GTPases are involved in the regulation of NF-jB by genotoxic stress. Exp Cell Res 2001;264:244–9. [20] Jefferies CA, O’Neill LA. Rac1 regulates interleukin 1-induced nuclear factor kappaB activation in an inhibitory protein kappaBalpha-independent manner by enhancing the ability of the p65 subunit to transactivate gene expression. J Biol Chem 2000;275:3114–20. [21] Fritz G, Kaina B. Rho GTPases: promising cellular targets for novel anticancer drugs. Curr Cancer Drug Targets 2006;6:1–14. [22] Ridley AJ. Rho proteins and cancer. Breast Cancer Res Treat 2004;84:13–9. [23] Ridley AJ. Rho family proteins: coordinating cell responses. Trends Cell Biol 2001;11:471–7. [24] Aznar S, Fernandez-Valeron P, Espina C, Lacal JC. Rho GTPases: potential candidates for anticancer therapy. Cancer Lett 2004;206:181–91. [25] Heasman SJ, Ridley AJ. Mammalian Rho GTPases: new insights into their functions from in vivo studies. Nat Rev Mol Cell Biol 2008;9:690–701. [26] Adamson P, Marshall CJ, Hall A, Tilbrook PA. Post-translational modifications of p21rho proteins. J Biol Chem 1992;267:20033–8. [27] Liao JK, Laufs U. Pleiotropic effects of statins. Annu Rev Pharmacol Toxicol 2005;45:89–118. [28] Walker K, Olson MF. Targeting Ras and Rho GTPases as opportunities for cancer therapeutics. Curr Opin Genet Dev 2005;15:62–8. [29] Graaf MR, Richel DJ, van Noorden CJ, Guchelaar HJ. Effects of statins and farnesyltransferase inhibitors on the development and progression of cancer. Cancer Treat Rev 2004;30:609–41. [30] Nuebel T, Dippold W, Kleinert H, Kaina B, Fritz G. Lovastatin inhibits Rhoregulated expression of E-selectin by TNFalpha and attenuates tumor cell adhesion. FASEB J 2004;18:140–2. [31] Cafforio P, Dammacco F, Gernone A, Silvestris F. Statins activate the mitochondrial pathway of apoptosis in human lymphoblasts and myeloma cells. Carcinogenesis 2005;26:883–91. [32] McKenna WG, Muschel RJ, Gupta AK, Hahn SM, Bernhard EJ. Farnesyltransferase inhibitors as radiation sensitizers. Semin Radiat Oncol 2002;12:27–32. [33] Fritz G, Brachetti C, Kaina B. Lovastatin causes sensitization of HeLa cells to ionizing radiation-induced apoptosis by the abrogation of G2 blockage. Int J Radiat Biol 2003;79:601–10. [34] Agarwal B, Bhendwal S, Halmos B, Moss SF, Ramey WG, Holt PR. Lovastatin augments apoptosis induced by chemotherapeutic agents in colon cancer cells. Clin Cancer Res 1999;5:2223–9. [35] Rao S, Lowe M, Herliczek TW, Keyomarsi K. Lovastatin mediated G1 arrest in normal and tumor breast cells is through inhibition of CDK2 activity and redistribution of p21 and p27, independent of p53. Oncogene 1998;17:2393–402.

C. Ostrau et al. / Radiotherapy and Oncology 92 (2009) 492–499 [36] Dimitroulakos J, Ye LY, Benzaquen M, Moore MJ, Kamel-Reid S, Freedman MH, et al. Differential sensitivity of various pediatric cancers and squamous cell carcinomas to lovastatin-induced apoptosis: therapeutic implications. Clin Cancer Res 2001;7:158–67. [37] Nuebel T, Damrot J, Roos WP, Kaina B, Fritz G. Lovastatin protects human endothelial cells from killing by ionizing radiation without impairing induction and repair of DNA double-strand breaks. Clin Cancer Res 2006;12:933–9. [38] Damrot J, Nuebel T, Epe B, Roos WP, Kaina B, Fritz G. Lovastatin protects human endothelial cells from the genotoxic and cytotoxic effects of the anticancer drugs doxorubicin and etoposide. Br J Pharmacol 2006;149:988–97. [39] von Bardeleben R, Dunkern T, Kaina B, Fritz G. The HMG-CoA reductase inhibitor lovastatin protects cells from the antineoplastic drugs doxorubicin and etoposide. Int J Mol Med 2002;10:473–9. [40] Haydont V, Bourgier C, Pocard M, Lusinchi A, Aigueperse J, Mathe D, et al. Pravastatin Inhibits the Rho/CCN2/extracellular matrix cascade in human fibrosis explants and improves radiation-induced intestinal fibrosis in rats. Clin Cancer Res 2007;13:5331–40. [41] Haydont V, Bourgier C, Vozenin-Brotons MC. Rho/ROCK pathway as a molecular target for modulation of intestinal radiation-induced toxicity. Br J Radiol 2007;80:32–40. [42] Rozen S, Skaletsky H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000;132:365–86. [43] Roos WP, Nikolova T, Quiros S, Naumann SC, Kiedron O, Zdzienicka MZ, et al. Brca2/Xrcc2 dependent HR, but not NHEJ, is required for protection against O(6)-methylguanine triggered apoptosis, DSBs and chromosomal aberrations by a process leading to SCEs. DNA Repair (Amst) 2009;8:72–86. [44] Rothkamm K, Lobrich M. Evidence for a lack of DNA double-strand break repair in human cells exposed to very low x-ray doses. Proc Natl Acad Sci USA 2003;100:5057–62. [45] Stiff T, O’Driscoll M, Rief N, Iwabuchi K, Lobrich M, Jeggo PA. ATM and DNA-PK function redundantly to phosphorylate H2AX after exposure to ionizing radiation. Cancer Res 2004;64:2390–6. [46] Li N, Karin M. Ionizing radiation and short wavelength UV activate NF-kappaB through two distinct mechanisms. Proc Natl Acad Sci USA 1998;95:13012–7. [47] Hallahan D, Kuchibhotla J, Wyble C. Cell adhesion molecules mediate radiation-induced leukocyte adhesion to the vascular endothelium. Cancer Res 1996;56:5150–5. [48] Schindler U, Baichwal VR. Three NF-kappaB binding sites in the human Eselectin gene required for maximal tumor necrosis factor alpha-induced expression. Mol Cell Biol 1994;14:5820–31.

499

[49] Hallahan DE, Kuchibhotla J, Clark E, Gewerty BL. The E-selectin promoter is a novel radiation-induced gene in endothelial cells. Proc Am Assoc Cancer Res 1995;36:605. [50] Hallahan DE, Virudachalam S, Kuchibhotla J. Nuclear factor kappaB dominant negative genetic constructs inhibit X-ray induction of cell adhesion molecules in the vascular endothelium. Cancer Res 1998;58:5484–8. [51] Nuebel T, Dippold W, Kaina B, Fritz G. Ionizing radiation-induced E-selectin gene expression and tumor cell adhesion is inhibited by lovastatin and alltrans retinoic acid. Carcinogenesis 2004;25:1335–44. [52] Fritz G. HMG-CoA reductase inhibitors (statins) as anticancer drugs (review). Int J Oncol 2005;27:1401–9. [53] Agarwal B, Halmos B, Feoktistov AS, Protiva P, Ramey WG, Chen M, et al. Mechanism of lovastatin-induced apoptosis in intestinal epithelial cells. Carcinogenesis 2002;23:521–8. [54] Gervaz P, Morel P, Vozenin-Brotons MC. Molecular aspects of intestinal radiation-induced fibrosis. Curr Mol Med 2009;9:273–80. [55] Bourgier C, Haydont V, Milliat F, Francois A, Holler V, Lasser P, et al. Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression. Gut 2005;54:336–43. [56] Gaugler MH, Vereycken-Holler V, Squiban C, Vandamme M, Vozenin-Brotons MC, Benderitter M. Pravastatin limits endothelial activation after irradiation and decreases the resulting inflammatory and thrombotic responses. Radiat Res 2005;163:479–87. [57] Eberlein M, Heusinger-Ribeiro J, Goppelt-Struebe M. Rho-dependent inhibition of the induction of connective tissue growth factor (CTGF) by HMG CoA reductase inhibitors (statins). Br J Pharmacol 2001;133:1172–80. [58] Roos WP, Kaina B. DNA damage-induced cell death by apoptosis. Trends Mol Med 2006;12:440–50. [59] Rothkamm K, Kruger I, Thompson LH, Lobrich M. Pathways of DNA doublestrand break repair during the mammalian cell cycle. Mol Cell Biol 2003;23:5706–15. [60] Mahmoudi M, Gorenne I, Mercer J, Figg N, Littlewood T, Bennett M. Statins use a novel Nijmegen breakage syndrome-1-dependent pathway to accelerate DNA repair in vascular smooth muscle cells. Circ Res 2008;103:717–25. [61] Miller AC, Kariko K, Myers CE, Clark EP, Samid D. Increased radioresistance of EJras-transformed human osteosarcoma cells and its modulation by lovastatin, an inhibitor of p21ras isoprenylation. Int J Cancer 1993;53:302–7. [62] Fritz G, Lang P, Just I. Tissue-specific variations in the expression and regulation of the small GTP-binding protein Rho. Biochim Biophys Acta 1994;1222:331–8.