- Email: [email protected]
Low-density lipoprotein receptor-related protein 8 gene association with egg traits in dwarf chickens
Research Note Low-density lipoprotein receptor-related protein 8 gene association with egg traits in dwarf chickens J. F. Yao,1 Z. X. Chen,1 G. Y. Xu,1 X. L. Wang, Z. H. Ning, J. X. Zheng, L. J. Qu, and N. Yang2 National Engineering Laboratory for Animal Breeding and Department of Animal Genetics and Breeding, China Agricultural University, Beijing 100193, China sured, except for yolk color, in which color was deeper for the TT genotype than CC or CT (P < 0.05). For shell traits, strength and thickness were greater for TT than CC (P < 0.05), with CT intermediate and not different from either. Shape index was lower for CT than either TT or CC, which did not differ, whereas for shell color, CT was intermediate to the homozygotes, which differed (CC > TT). The present results indicated that LRP8, as a new member of eggshell matrix protein, may be a candidate gene associated with eggshell traits.
Key words: low-density lipoprotein receptor-related protein 8, candidate gene, eggshell trait, single nucleotide polymorphism, matrix-assisted laser desorption-ionization time-of-flight mass spectrometry 2010 Poultry Science 89:883–886 doi:10.3382/ps.2009-00613
INTRODUCTION
traits directly or by mediating other genes associated with these traits. In this note, we report 1 SNP identified in LRP8 using a high-throughput genotyping method, matrixassisted laser desorption-ionisation time-of-flight mass spectrometry (MALDI-TOF MS), to evaluate its relationship with established and novel measurements of egg traits.
Low-density lipoprotein receptor-related protein 8 (LRP8, also called apolipoprotein E receptor 2 in mammals) is a member of the low-density lipoprotein receptor gene family (kim et al., 1997). Chicken LRP8 is located on chromosome 8 and contains 18 exons that span a genomic region of about 150 kb. The LRP8 gene has a 6.5-kb receptor transcript and is expressed in the brain and ovary of chickens (Novak et al., 1996). Previous studies have shown that LRP8 participates in transmitting Reelin signal from extracellular to intracellular signaling processes (Hiesberger et al., 1999). The LRP8 gene is a component of the selenium delivery pathway to spermatogenic cells of the mouse (Olson et al., 2007) and may have a role in cholesterol supply for steroid biosynthesis, which enables folliculogenesis and selection processes to occur in bovines (Argov et al., 2004). In the formation process of eggs, a mass of lipids, proteins, vitamins, and minerals is needed. The role of LRP8 in transporting lipids and special expression in the ovary suggest that the gene may affect egg
MATERIALS AND METHODS Chickens and Egg Traits Pureline dwarf layers (n = 747) from 44 sire families were selected for study. All hens were from 1 hatch and 3 eggs from each hen were collected during their 40th wk. Egg weight (EW), shape index (ESI), shell weight, shell strength (ESS), shell color (ESC), shell thickness (EST), shell ratio, albumen weight, albumen height, yolk weight, yolk color (YC), Haugh unit, albumen ratio, and yolk ratio were measured within 24 h after lay. In the analysis, the average of the 3 eggs was the unit. The ESI was calculated as ESI = ESL/ELL, where ESL was the short length and ELL was the long vertical length of an egg. Shell ratio, albumen ratio, and yolk ratio were calculated by shell weight/EW × 100, albumen weight/EW × 100, and yolk weight/EW × 100, respectively (Zhang et al., 2005).
©2010 Poultry Science Association Inc. Received December 17, 2009. Accepted January 10, 2010. 1 These authors contributed equally to the work. 2 Corresponding author: [email protected]
883
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
ABSTRACT Low-density lipoprotein receptor-related protein 8 (LRP8), a member of the low-density lipoprotein receptor gene family with a role in clusterin processing, was investigated as a candidate gene for egg quality-related traits. One SNP from C to T at position 1623 of the open reading frame of LRP8 was identified and genotyped by a high-throughput genotyping method, matrix-assisted laser desorption-ionization time-offlight mass spectrometry in 747 egg-type dwarf layers from 44 sire families. There were no significant differences among genotypes for any interior egg traits mea-
884
Yao et al. Table 1. Genotypic and allelic frequencies of the SNP (C1623T) in chicken low-density lipoprotein receptor-related protein 8 gene Genotypic frequency
Allelic frequency
Number of chickens
CC
CT
TT
C
T
χ2
P-value
747
0.85
0.13
0.02
0.91
0.09
7.31
0.03
Genotyping
Statistical Analysis The frequency of genotypes and P-values for HardyWeinberg equilibrium test were estimated and calculated by the procedure FREQ in SAS system 9.1.3 (SAS Institute, Cary, NC) for χ2. Using the procedure GLM, associations between the SNP and egg traits were analyzed by the following model: Yij = μ + Si + Gj + eij,
RESULTS AND DISCUSSION According to LRP8 genotypes, 747 hens were divided into 3 groups, CC homozygotes (n = 635), CT heterozygotes (n = 96), and TT homozygotes (n = 16). Table 1 shows genotypic and allelic frequencies of SNP (C1623T) of LRP8. The frequencies of the C and T alleles were 0.91 and 0.09, respectively. According to χ2 fitness test, the observed frequencies of the genotypes were not in agreement with Hardy-Weinberg equilibrium (P < 0.05), indicating that selection might have influence on gene frequencies. Egg traits (means ± SE) for CC, CT, and TT genotypes of the SNP (C1623T; Table 2) were different for ESS, EST, ESC, ESI, and YC (P < 0.05). For shell traits of ESS and EST, the values for TT were higher than for CC with CT intermediate (P < 0.05). For ESC, TT was intermediate to CC and CT, which were different (P < 0.05). For ESI, genotypes TT and CC were similar and higher than for CT (P < 0.05). There were no significant associations between the SNP and
Table 2. Least squares means ± SE for egg traits among genotypes of the SNP (C1623T) in chicken low-density lipoprotein receptor-related protein 8 gene Genotype Egg trait1 ESS (kgf) EST (μm) ESC ESI YC EW (g) ESW (g) ESR (%) AW (g) AH (mm) YW (g) HU AR (%) YR (%) a,bMeans
CC 3.23 342.9 41.9 0.740 6.77 53.95 7.07 13.12 32.14 7.29 14.73 86.36 59.52 27.36
± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.03b 0.9b 0.2a
0.001a 0.02b 0.14 0.03 0.05 0.12 0.05 0.04 0.30 0.09 0.07
CT 3.31 347.2 40.6 0.733 6.79 54.11 7.14 13.23 32.17 7.04 14.80 84.75 59.34 27.43
± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.07ab 2.5ab 0.6ab 0.003b 0.04b 0.38 0.07 0.13 0.31 0.12 0.11 0.77 0.23 0.18
TT 3.59 355.4 39.9 0.749 7.00 52.89 7.12 13.47 31.46 7.49 14.30 88.20 59.39 27.14
± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.16a 5.7a 1.3b 0.006a 0.10a 0.87 0.17 0.31 0.70 0.29 0.25 1.79 0.54 0.41
in a row without a common superscript differ significantly (P < 0.05). = shell strength; EST = shell thickness; ESC = shell color; ESI = shape index; YC = yolk color; EW = egg weight; ESW = shell weight; ESR (%) = shell ratio × 100; AW = albumen weight; AH = albumen height; YW = yolk weight; HU = Haugh unit; AR (%) = albumen ratio × 100; YR (%) = yolk ratio × 100. 1ESS
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
Using the BLAST program on the Web site of National Center for Biotechnology Information (http://www. ncbi.nlm.nih.gov/), 1 SNP of LRP8 (NM_205186.1, C1623T) was selected for current study. Chicken genomic DNA was extracted from fresh anticoagulated blood by the phenol-chloroform method. Single nucleotide polymorphism genotyping was completed using the MALDI-TOF MS based on Sequenom’s MassARRAY iPLEX Platform (Sequenom, San Diego, CA). Three primers including 2 PCR primers and 1 extend primer were designed. The PCR primers were ACGTTGGATGAACAAGACTATCTCAGTGGC and ACGTTGGATGATCAACAGCAATGGCTCTCG, and the extend primer was CCTCCTCCTGCTCCC.
where Y is the observed values of egg traits, μ is the population mean, S and G are the fixed effects of sire family and genotype, respectively, and e is the random effect. The CORR procedure was applied to estimate phenotypic correlations among the egg traits.
885
RESEARCH NOTE Table 3. Phenotypic correlations between the egg traits Egg trait1 EW ESI ESW ESS ESC EST AW AH YW YC
ESI
ESW
ESS
ESC
EST
AW
AH
YW
YC
HU
−0.02
0.45 0.04
−0.09 0.17 0.26
−0.03 0.01 −0.13 −0.20
0.12 0.08 0.44 0.68 −0.25
0.94 −0.02 0.25 −0.17 0.02 0.03
0.24 0.20 0.26 −0.04 −0.03 −0.06 0.26
0.60 −0.05 0.22 −0.02 −0.09 0.05 0.35 −0.05
0.01 −0.10 −0.04 0.01 −0.05 0.05 0.002 −0.08 0.07
0.08 0.20 0.18 −0.01 −0.03 −0.06 0.11 0.97 −0.14 −0.07
1EW = egg weight; ESI = shape index; ESW = shell weight; ESS = shell strength; ESC = shell color; EST = shell thickness; AW = albumen weight; AH = albumen height; YW = yolk weight; YC = yolk color; HU = Haugh unit.
shell matrix components for ordered mineralization in the uterine fluid (Mann et al., 2003). Although it is not well understood how LRP8 polymorphisms are associated with eggshell traits, possible mechanisms could be speculated. The secondary structure of the LRP8 mRNA and efficiency of translation or stability of the mRNA may be changed by the polymorphism, thus altering its level of expression. The change of mRNA expression may uptake clusterin synthesization, thus affecting calcification of the shell of an egg. Alternatively, the polymorphism may affect splicing by yet unknown mechanisms or in linkage disequilibrium with unexamined intron alterations that affect splicing. Further research will be taken for confirmation of the putative association of the LRP8 C1623T polymorphism on the eggshell and elucidation of the mechanisms of any such association. This preliminary study with 747 hens from 44 sire families demonstrates for the first time that a SNP in LRP8 has association with external eggshell traits and suggests that LRP8 may be a new member of eggshell matrix protein. The efficient and accurate genotyping by MALDI-TOF MS makes genetic screening in large populations feasible and reliable.
ACKNOWLEDGMENTS The current research was funded in part by the National High Technology Development Plan of China (2008AA101009), the National Basic Research Program of China (2006CB102102), and the National Scientific Supporting Projects of China (2006BDA01A09, 2008BADB2B06).
REFERENCES Argov, N., U. Moallem, and D. Sklan. 2004. Lipid transport in the developing bovine follicle: Messenger RNA expression increases for selective uptake receptors and decreases for endocytosis receptors. Biol. Reprod. 71:479–485. Azhar, S., S. Medicherla, W. J. Shen, Y. Fujioka, L. G. Fong, E. Reaven, and A. D. Cooper. 2006. LDL and cAMP cooperate to regulate the functional expression of the LRP in rat ovarian granulosa cells. J. Lipid Res. 47:2538–2550.
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
internal egg traits, except YC in which TT was greater than CC and CT (P < 0.05), which were similar. In general, TT is the favorable genotype for ESS and EST. Selection for the TT genotype will increase ESS and EST appropriately. Greater ESS and EST can reduce the risk of egg breakage and cracking and thus reduce economic losses. Phenotypic correlations among egg traits were estimated (Table 3), and the results were similar to those in a previous report by Zhang et al. (2005). The correlations of ESS and EST with other egg traits are generally small. Improvement of ESS and EST resulted from selection for the TT genotype, which did not change other egg traits significantly, except ESC. A paler eggshell for eggs with higher ESS and EST could be expected because increased EST and ESS might not have been compensated by protoporphyrin pigmentation (Gosler et al., 2005). Better consideration is needed to balance the unfavorable change in ESC if this SNP is incorporated into the selection program. Gallus gallus LRP8 was first reported (Novak et al., 1996) in brains and ovary of chickens as a member of the low-density lipoprotein receptor homolog with 8 ligand-binding repeats and has the typical o-linked sugar region and Phe-Asp-Asn-Pro-Val-Tyr internalization signal as a low-density lipoprotein receptor gene family member. As a receptor of apolipoprotein E in mammals, LRP8 may inhibit platelet aggregation and deliver cholesterol to steroidogenic cells (Riddell et al., 1999; Argov et al., 2004).The LRP8 gene has a role in follicular growth and spermatogenesis by paracrine interaction (Fayad et al., 2007; Olson et al., 2007). An LRP8 SNP in maternal genotype was demonstrated to be associated with birth weight of progeny in black women (Wang et al., 2006) and has a role as a low-density lipoprotein receptor-related protein in lipoprotein-supported ovarian granulosa cell steroidogenesis in rats (Azhar et al., 2006). Molecular mechanisms and functions of chicken LRP8, however, have received little attention. The LRP8 gene may affect clusterin processing by internalizing cell-derived granulose (Mahon et al., 1999). Clusterin is a component of the eggshell matrix and of egg white in chickens and prevents assembling the premature aggregation and precipitation of
886
Yao et al. Mann, K., J. Gautron, Y. Nys, M. D. McKee, T. Bajari, W. J. Schneider, and M. T. Hincke. 2003. Disulfide-linked heterodimeric clusterin is a component of the chicken eggshell matrix and egg white. Matrix Biol. 22:397–407. Novak, S., T. Hiesberger, W. J. Schneider, and J. Nimpf. 1996. A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse. J. Biol. Chem. 271:11732–11736. Olson, G. E., V. P. Winfrey, S. K. Nagdas, K. E. Hill, and R. F. Burk. 2007. Apolipoprotein E receptor-2 (ApoER2) mediates selenium uptake from selenoprotein P by the mouse testis. J. Biol. Chem. 282:12290–12297. Riddell, D. R., D. V. Vinogradov, A. K. Stannard, N. Chadwick, and J. S. Owen. 1999. Identification and characterization of LRP8 (apoER2) in human blood platelets. J. Lipid Res. 40:1925– 1930. Wang, L., X. Wang, N. Laird, B. Zuckerman, P. Stubblefield, and X. Xu. 2006. Polymorphism in maternal LRP8 gene is associated with fetal growth. Am. J. Hum. Genet. 78:770–777. Zhang, L. C., Z. H. Ning, G. Y. Xu, Z. C. Hou, and N. Yang. 2005. Heritabilities and genetic and phenotypic correlations of egg quality traits in brown-egg dwarf layers. Poult. Sci. 84:1209–1213.
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
Fayad, T., R. Lefebvre, J. Nimpf, D. W. Silversides, and J. G. Lussier. 2007. Low-density lipoprotein receptor-related protein 8 (LRP8) is upregulated in granulosa cells of bovine dominant follicle: Molecular characterization and spatio-temporal expression studies. Biol. Reprod. 76:466–475. Gosler, A. G., J. P. Higham, and S. J. Reynolds. 2005. Why are birds’ eggs speckled? Ecol. Lett. 8:1105–1113. Hiesberger, T., M. Trommsdorff, B. W. Howell, A. Goffinet, M. C. Mumby, J. A. Cooper, and J. Herz. 1999. Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron 24:481–489. Kim, D. H., K. Magoori, T. R. Inoue, C. C. Mao, H. J. Kim, H. Suzuki, T. Fujita, Y. Endo, S. Saeki, and T. T. Yamamoto. 1997. Exon/intron organization, chromosome localization, alternative splicing, and transcription units of the human apolipoprotein E receptor 2 gene. J. Biol. Chem. 272:8498–8504. Mahon, M. G., K. A. Lindstedt, M. Hermann, J. Nimpf, and W. J. Schneider. 1999. Multiple involvement of clusterin in chicken ovarian follicle development. Binding to two oocyte-specific members of the low density lipoprotein receptor gene family. J. Biol. Chem. 274:4036–4044.
Key words: low-density lipoprotein receptor-related protein 8, candidate gene, eggshell trait, single nucleotide polymorphism, matrix-assisted laser desorption-ionization time-of-flight mass spectrometry 2010 Poultry Science 89:883–886 doi:10.3382/ps.2009-00613
INTRODUCTION
traits directly or by mediating other genes associated with these traits. In this note, we report 1 SNP identified in LRP8 using a high-throughput genotyping method, matrixassisted laser desorption-ionisation time-of-flight mass spectrometry (MALDI-TOF MS), to evaluate its relationship with established and novel measurements of egg traits.
Low-density lipoprotein receptor-related protein 8 (LRP8, also called apolipoprotein E receptor 2 in mammals) is a member of the low-density lipoprotein receptor gene family (kim et al., 1997). Chicken LRP8 is located on chromosome 8 and contains 18 exons that span a genomic region of about 150 kb. The LRP8 gene has a 6.5-kb receptor transcript and is expressed in the brain and ovary of chickens (Novak et al., 1996). Previous studies have shown that LRP8 participates in transmitting Reelin signal from extracellular to intracellular signaling processes (Hiesberger et al., 1999). The LRP8 gene is a component of the selenium delivery pathway to spermatogenic cells of the mouse (Olson et al., 2007) and may have a role in cholesterol supply for steroid biosynthesis, which enables folliculogenesis and selection processes to occur in bovines (Argov et al., 2004). In the formation process of eggs, a mass of lipids, proteins, vitamins, and minerals is needed. The role of LRP8 in transporting lipids and special expression in the ovary suggest that the gene may affect egg
MATERIALS AND METHODS Chickens and Egg Traits Pureline dwarf layers (n = 747) from 44 sire families were selected for study. All hens were from 1 hatch and 3 eggs from each hen were collected during their 40th wk. Egg weight (EW), shape index (ESI), shell weight, shell strength (ESS), shell color (ESC), shell thickness (EST), shell ratio, albumen weight, albumen height, yolk weight, yolk color (YC), Haugh unit, albumen ratio, and yolk ratio were measured within 24 h after lay. In the analysis, the average of the 3 eggs was the unit. The ESI was calculated as ESI = ESL/ELL, where ESL was the short length and ELL was the long vertical length of an egg. Shell ratio, albumen ratio, and yolk ratio were calculated by shell weight/EW × 100, albumen weight/EW × 100, and yolk weight/EW × 100, respectively (Zhang et al., 2005).
©2010 Poultry Science Association Inc. Received December 17, 2009. Accepted January 10, 2010. 1 These authors contributed equally to the work. 2 Corresponding author: [email protected]
883
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
ABSTRACT Low-density lipoprotein receptor-related protein 8 (LRP8), a member of the low-density lipoprotein receptor gene family with a role in clusterin processing, was investigated as a candidate gene for egg quality-related traits. One SNP from C to T at position 1623 of the open reading frame of LRP8 was identified and genotyped by a high-throughput genotyping method, matrix-assisted laser desorption-ionization time-offlight mass spectrometry in 747 egg-type dwarf layers from 44 sire families. There were no significant differences among genotypes for any interior egg traits mea-
884
Yao et al. Table 1. Genotypic and allelic frequencies of the SNP (C1623T) in chicken low-density lipoprotein receptor-related protein 8 gene Genotypic frequency
Allelic frequency
Number of chickens
CC
CT
TT
C
T
χ2
P-value
747
0.85
0.13
0.02
0.91
0.09
7.31
0.03
Genotyping
Statistical Analysis The frequency of genotypes and P-values for HardyWeinberg equilibrium test were estimated and calculated by the procedure FREQ in SAS system 9.1.3 (SAS Institute, Cary, NC) for χ2. Using the procedure GLM, associations between the SNP and egg traits were analyzed by the following model: Yij = μ + Si + Gj + eij,
RESULTS AND DISCUSSION According to LRP8 genotypes, 747 hens were divided into 3 groups, CC homozygotes (n = 635), CT heterozygotes (n = 96), and TT homozygotes (n = 16). Table 1 shows genotypic and allelic frequencies of SNP (C1623T) of LRP8. The frequencies of the C and T alleles were 0.91 and 0.09, respectively. According to χ2 fitness test, the observed frequencies of the genotypes were not in agreement with Hardy-Weinberg equilibrium (P < 0.05), indicating that selection might have influence on gene frequencies. Egg traits (means ± SE) for CC, CT, and TT genotypes of the SNP (C1623T; Table 2) were different for ESS, EST, ESC, ESI, and YC (P < 0.05). For shell traits of ESS and EST, the values for TT were higher than for CC with CT intermediate (P < 0.05). For ESC, TT was intermediate to CC and CT, which were different (P < 0.05). For ESI, genotypes TT and CC were similar and higher than for CT (P < 0.05). There were no significant associations between the SNP and
Table 2. Least squares means ± SE for egg traits among genotypes of the SNP (C1623T) in chicken low-density lipoprotein receptor-related protein 8 gene Genotype Egg trait1 ESS (kgf) EST (μm) ESC ESI YC EW (g) ESW (g) ESR (%) AW (g) AH (mm) YW (g) HU AR (%) YR (%) a,bMeans
CC 3.23 342.9 41.9 0.740 6.77 53.95 7.07 13.12 32.14 7.29 14.73 86.36 59.52 27.36
± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.03b 0.9b 0.2a
0.001a 0.02b 0.14 0.03 0.05 0.12 0.05 0.04 0.30 0.09 0.07
CT 3.31 347.2 40.6 0.733 6.79 54.11 7.14 13.23 32.17 7.04 14.80 84.75 59.34 27.43
± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.07ab 2.5ab 0.6ab 0.003b 0.04b 0.38 0.07 0.13 0.31 0.12 0.11 0.77 0.23 0.18
TT 3.59 355.4 39.9 0.749 7.00 52.89 7.12 13.47 31.46 7.49 14.30 88.20 59.39 27.14
± ± ± ± ± ± ± ± ± ± ± ± ± ±
0.16a 5.7a 1.3b 0.006a 0.10a 0.87 0.17 0.31 0.70 0.29 0.25 1.79 0.54 0.41
in a row without a common superscript differ significantly (P < 0.05). = shell strength; EST = shell thickness; ESC = shell color; ESI = shape index; YC = yolk color; EW = egg weight; ESW = shell weight; ESR (%) = shell ratio × 100; AW = albumen weight; AH = albumen height; YW = yolk weight; HU = Haugh unit; AR (%) = albumen ratio × 100; YR (%) = yolk ratio × 100. 1ESS
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
Using the BLAST program on the Web site of National Center for Biotechnology Information (http://www. ncbi.nlm.nih.gov/), 1 SNP of LRP8 (NM_205186.1, C1623T) was selected for current study. Chicken genomic DNA was extracted from fresh anticoagulated blood by the phenol-chloroform method. Single nucleotide polymorphism genotyping was completed using the MALDI-TOF MS based on Sequenom’s MassARRAY iPLEX Platform (Sequenom, San Diego, CA). Three primers including 2 PCR primers and 1 extend primer were designed. The PCR primers were ACGTTGGATGAACAAGACTATCTCAGTGGC and ACGTTGGATGATCAACAGCAATGGCTCTCG, and the extend primer was CCTCCTCCTGCTCCC.
where Y is the observed values of egg traits, μ is the population mean, S and G are the fixed effects of sire family and genotype, respectively, and e is the random effect. The CORR procedure was applied to estimate phenotypic correlations among the egg traits.
885
RESEARCH NOTE Table 3. Phenotypic correlations between the egg traits Egg trait1 EW ESI ESW ESS ESC EST AW AH YW YC
ESI
ESW
ESS
ESC
EST
AW
AH
YW
YC
HU
−0.02
0.45 0.04
−0.09 0.17 0.26
−0.03 0.01 −0.13 −0.20
0.12 0.08 0.44 0.68 −0.25
0.94 −0.02 0.25 −0.17 0.02 0.03
0.24 0.20 0.26 −0.04 −0.03 −0.06 0.26
0.60 −0.05 0.22 −0.02 −0.09 0.05 0.35 −0.05
0.01 −0.10 −0.04 0.01 −0.05 0.05 0.002 −0.08 0.07
0.08 0.20 0.18 −0.01 −0.03 −0.06 0.11 0.97 −0.14 −0.07
1EW = egg weight; ESI = shape index; ESW = shell weight; ESS = shell strength; ESC = shell color; EST = shell thickness; AW = albumen weight; AH = albumen height; YW = yolk weight; YC = yolk color; HU = Haugh unit.
shell matrix components for ordered mineralization in the uterine fluid (Mann et al., 2003). Although it is not well understood how LRP8 polymorphisms are associated with eggshell traits, possible mechanisms could be speculated. The secondary structure of the LRP8 mRNA and efficiency of translation or stability of the mRNA may be changed by the polymorphism, thus altering its level of expression. The change of mRNA expression may uptake clusterin synthesization, thus affecting calcification of the shell of an egg. Alternatively, the polymorphism may affect splicing by yet unknown mechanisms or in linkage disequilibrium with unexamined intron alterations that affect splicing. Further research will be taken for confirmation of the putative association of the LRP8 C1623T polymorphism on the eggshell and elucidation of the mechanisms of any such association. This preliminary study with 747 hens from 44 sire families demonstrates for the first time that a SNP in LRP8 has association with external eggshell traits and suggests that LRP8 may be a new member of eggshell matrix protein. The efficient and accurate genotyping by MALDI-TOF MS makes genetic screening in large populations feasible and reliable.
ACKNOWLEDGMENTS The current research was funded in part by the National High Technology Development Plan of China (2008AA101009), the National Basic Research Program of China (2006CB102102), and the National Scientific Supporting Projects of China (2006BDA01A09, 2008BADB2B06).
REFERENCES Argov, N., U. Moallem, and D. Sklan. 2004. Lipid transport in the developing bovine follicle: Messenger RNA expression increases for selective uptake receptors and decreases for endocytosis receptors. Biol. Reprod. 71:479–485. Azhar, S., S. Medicherla, W. J. Shen, Y. Fujioka, L. G. Fong, E. Reaven, and A. D. Cooper. 2006. LDL and cAMP cooperate to regulate the functional expression of the LRP in rat ovarian granulosa cells. J. Lipid Res. 47:2538–2550.
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
internal egg traits, except YC in which TT was greater than CC and CT (P < 0.05), which were similar. In general, TT is the favorable genotype for ESS and EST. Selection for the TT genotype will increase ESS and EST appropriately. Greater ESS and EST can reduce the risk of egg breakage and cracking and thus reduce economic losses. Phenotypic correlations among egg traits were estimated (Table 3), and the results were similar to those in a previous report by Zhang et al. (2005). The correlations of ESS and EST with other egg traits are generally small. Improvement of ESS and EST resulted from selection for the TT genotype, which did not change other egg traits significantly, except ESC. A paler eggshell for eggs with higher ESS and EST could be expected because increased EST and ESS might not have been compensated by protoporphyrin pigmentation (Gosler et al., 2005). Better consideration is needed to balance the unfavorable change in ESC if this SNP is incorporated into the selection program. Gallus gallus LRP8 was first reported (Novak et al., 1996) in brains and ovary of chickens as a member of the low-density lipoprotein receptor homolog with 8 ligand-binding repeats and has the typical o-linked sugar region and Phe-Asp-Asn-Pro-Val-Tyr internalization signal as a low-density lipoprotein receptor gene family member. As a receptor of apolipoprotein E in mammals, LRP8 may inhibit platelet aggregation and deliver cholesterol to steroidogenic cells (Riddell et al., 1999; Argov et al., 2004).The LRP8 gene has a role in follicular growth and spermatogenesis by paracrine interaction (Fayad et al., 2007; Olson et al., 2007). An LRP8 SNP in maternal genotype was demonstrated to be associated with birth weight of progeny in black women (Wang et al., 2006) and has a role as a low-density lipoprotein receptor-related protein in lipoprotein-supported ovarian granulosa cell steroidogenesis in rats (Azhar et al., 2006). Molecular mechanisms and functions of chicken LRP8, however, have received little attention. The LRP8 gene may affect clusterin processing by internalizing cell-derived granulose (Mahon et al., 1999). Clusterin is a component of the eggshell matrix and of egg white in chickens and prevents assembling the premature aggregation and precipitation of
886
Yao et al. Mann, K., J. Gautron, Y. Nys, M. D. McKee, T. Bajari, W. J. Schneider, and M. T. Hincke. 2003. Disulfide-linked heterodimeric clusterin is a component of the chicken eggshell matrix and egg white. Matrix Biol. 22:397–407. Novak, S., T. Hiesberger, W. J. Schneider, and J. Nimpf. 1996. A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse. J. Biol. Chem. 271:11732–11736. Olson, G. E., V. P. Winfrey, S. K. Nagdas, K. E. Hill, and R. F. Burk. 2007. Apolipoprotein E receptor-2 (ApoER2) mediates selenium uptake from selenoprotein P by the mouse testis. J. Biol. Chem. 282:12290–12297. Riddell, D. R., D. V. Vinogradov, A. K. Stannard, N. Chadwick, and J. S. Owen. 1999. Identification and characterization of LRP8 (apoER2) in human blood platelets. J. Lipid Res. 40:1925– 1930. Wang, L., X. Wang, N. Laird, B. Zuckerman, P. Stubblefield, and X. Xu. 2006. Polymorphism in maternal LRP8 gene is associated with fetal growth. Am. J. Hum. Genet. 78:770–777. Zhang, L. C., Z. H. Ning, G. Y. Xu, Z. C. Hou, and N. Yang. 2005. Heritabilities and genetic and phenotypic correlations of egg quality traits in brown-egg dwarf layers. Poult. Sci. 84:1209–1213.
Downloaded from http://ps.oxfordjournals.org/ at University of Southern Queensland on March 13, 2015
Fayad, T., R. Lefebvre, J. Nimpf, D. W. Silversides, and J. G. Lussier. 2007. Low-density lipoprotein receptor-related protein 8 (LRP8) is upregulated in granulosa cells of bovine dominant follicle: Molecular characterization and spatio-temporal expression studies. Biol. Reprod. 76:466–475. Gosler, A. G., J. P. Higham, and S. J. Reynolds. 2005. Why are birds’ eggs speckled? Ecol. Lett. 8:1105–1113. Hiesberger, T., M. Trommsdorff, B. W. Howell, A. Goffinet, M. C. Mumby, J. A. Cooper, and J. Herz. 1999. Direct binding of Reelin to VLDL receptor and ApoE receptor 2 induces tyrosine phosphorylation of disabled-1 and modulates tau phosphorylation. Neuron 24:481–489. Kim, D. H., K. Magoori, T. R. Inoue, C. C. Mao, H. J. Kim, H. Suzuki, T. Fujita, Y. Endo, S. Saeki, and T. T. Yamamoto. 1997. Exon/intron organization, chromosome localization, alternative splicing, and transcription units of the human apolipoprotein E receptor 2 gene. J. Biol. Chem. 272:8498–8504. Mahon, M. G., K. A. Lindstedt, M. Hermann, J. Nimpf, and W. J. Schneider. 1999. Multiple involvement of clusterin in chicken ovarian follicle development. Binding to two oocyte-specific members of the low density lipoprotein receptor gene family. J. Biol. Chem. 274:4036–4044.