- Email: [email protected]
Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression Ruinan Xing a, Xiaoli Cheng b, Yanping Qi b, Xiaoxiang Tian b, Chenghui Yan b, Dan Liu b, **, Yaling Han a, * a
Second Clinical College of Dalian Medical University, Dalian, Liaoning Province, 116044, China Department of Cardiology and Cardiovascular Research Institute of PLA, General Hospital of Northern Theater Command, Shenyang, Liaoning Province, 110016, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 November 2019 Accepted 14 November 2019 Available online xxx
Nicotine as a major component of addiction in cigarettes has been reported to play protective roles in some pathological processes. It is reported that activation of the nicotinic acetylcholine receptor also has a cardioprotective effect. Thus, in our study, we investigated the effect and mechanism of nicotine on the autophagy of cardiomyocytes, and whether nicotine protects cardiomyocytes against palmitic acid (PA) injury. The results indicated that low-dose nicotine promoted neonatal mouse cardiac myocytes (NMCMs) autophagy and accelerated autophagic flux while inhibiting NMCMs apoptosis, but high-dose nicotine inhibited autophagy and promoted apoptosis. Moreover, low-dose nicotine upregulated heme oxygenase-1 (HO-1) expression and knocking down HO-1 abolished the effects of nicotine on the autophagy and apoptosis of NMCMs. Methyllycaconitine citrate (a7-nAChR blocker, MLA) inhibited HO-1 expression and the effects of nicotine on autophagy and apoptosis of NMCMs. Furthermore, low-dose nicotine improved the inhibited autophagy and increased apoptosis induced by palmitic acid (PA) in NMCMs and these effects were reversed by knocking down HO-1. In conclusion, our data suggested that low-dose nicotine promoted autophagy and inhibited apoptosis of cardiomyocytes by upregulating HO-1. © 2019 Elsevier Inc. All rights reserved.
Keywords: Nicotine Autophagy Apoptosis HO-1
1. Introduction Autophagy is a highly conservative process of lysosomemediated long-lived protein and impaired organelle degradation to maintain cellular homeostasis and metabolism [1]. The major form of autophagy involves the formation of autophagosomes and the fusion of autophagosomes with lysosomes, after which cellular contents and targeted proteins are degraded in the resulting autolysosome by lysosomal proteases [2,3]. Autophagy plays an important role in many mechanisms of human disease pathogenesis, including those in cardiovascular disease and metabolic disease [4]. Recent findings show that the inhibition of autophagy
* Corresponding author. Second Clinical College of Dalian Medical University, Dalian, Liaoning Province, 116044, China. ** Corresponding author. Department of Cardiology and Cardiovascular Research Institute of PLA, General Hospital of Northern Theater Command, Shenyang, Liaoning Province, 110016, China E-mail addresses: [email protected] (D. Liu), [email protected] (Y. Han).
leads to myocardial damage caused by lipotoxicity. In addition, autophagic flux restoration of cardiomyocytes mitigates lipid toxicity and improves cardiac hypertrophy [5,6]. Therefore, autophagy plays a significant role in lipid-induced myocardial damage. Nicotine is a major addictive component in cigarettes. There is no doubt that smoking is a major risk factor for many diseases, especially cancer and cardiovascular diseases [7,8]. However, studies have found that the main components of cigarettes that causes cancer and cardiovascular disease are oxidizing chemicals and toxic organic chemicals [9,10]. In recent research, nicotine improves obesity and hepatic steatosis and exerts beneficial effects on the peripheral metabolism [11]. In the cardiovascular system, activation of the a-7 nicotinic acetylcholine receptor reduces ischemic injury in rat heart [12]. Moreover, nicotinic agonist inhibits cardiomyocyte apoptosis in CVB3-induced myocarditis [13]. However, the effects of nicotine on cardiac autophagy and PAinduced cardiac injury have not been reported. The aim of our study is to investigate the effect of nicotine on autophagy of cardiomyocytes and its role in PA-induced autophagy dysfunction.
https://doi.org/10.1016/j.bbrc.2019.11.086 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
2
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2. Method
Germany). The levels of autophagic flux were analyzed as previously described [16].
2.1. Cell culture and nicotine treatment in vitro Neonatal mouse cardiac myocytes (NMCMs) were isolated from 1 to 3-day-old C57BL/6J neonatal mice using the primary cardiomyocyte isolation kit (Thermo, USA), as described previously [14]. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 20% fetal bovine serum (FBS) and 1% penicillin/ streptomycin, and the cells suspension was then plated in multiwell™ Primaria™ 6-well plates (Becton Dickinson, USA) at 37 C in a 5% CO2 incubator. After 24 h, the NMCMs were exposed to different concentrations of nicotine (0, 0.5, 1, 5, 10 and 15 mM, Sigma, USA), either alone or in combination with a silencer of heme oxygenase-1 (HO-1) (sieHOe1, Santa, USA), 20 mM methyllycaconitine citrate (MLA, Sigma, USA), 10 mM chloroquine (CQ, Sigma, USA) or 400 mM palmitic acid (PA, Sigma, USA) for 24 h. 2.2. Cell viability assay Cell viability was measured by MTT assay. Briefly, when the NMCMs reached 90% confluence, the cells were treated with different concentrations of nicotine for 24 h. Then, the cells were incubated in MTT reagent in an incubator at 37 C for 4 h. The absorbance was then measured by an Infinite M Plex Fully Loaded Multimode Plate Reader (Tecan, Switzerland) at a wavelength of 540 nm. 2.3. Cell transfection For cell transfection, HO-1 siRNA (Santa, USA) was transfected into NMCMs using lipofectamine™ RNAiMAX transfection reagent (Thermo, USA). For 6-well plate transfection, 10 MOI of HO-1 siRNA was added to NMCMs. Cells were harvested at 24 h posttransfection.
2.7. TUNEL staining NMCMs were cultured on coverslips and stimulated with nicotine, CQ, or PA, or transfected with HO-1 siRNA. NMCMs were harvested and fixed with 4% paraformaldehyde. The TUNEL staining kit (Abcam, USA) was used for analyzing the proportion of cell apoptosis in heart tissue and NMCM. All fluorescent images were examined by a 20 magnification fluorescence microscope (Zeiss, Germany). 2.8. Immunofluorescence analysis An immunofluorescence assay was used to ascertain the expression of cellular HO-1. NMCMs were cultured on coverslips and stimulated with nicotine or MLA. NMCMs were harvested and fixed with 4% paraformaldehyde. Then, NMCMs were washed three times with PBS and incubated with 0.5% Triton X-100 for 10 min and then with blocking buffer for 30 min at room temperature. After that, NMCMs were incubated with antibodies to HO-1 at a 1:100 dilution at 4 C overnight. Subsequently, the cells were washed and incubated for 1 h at room temperature with Cy3conjugated anti-rabbit IgG at a 1:500 dilution. Cell nuclei were stained with 6-diamidino-2-phenylindole (DAPI, Sigma, USA). All fluorescent images were examined by a 20 magnification fluorescence microscope (Zeiss, Germany). Data were shown as the means ± SEM. All data were analyzed by SPSS 19.0 statistical software (USA). Differences between the two groups were calculated by unpaired Student’s t-test. Differences among three or more groups were assessed by using one-way analysis of variance. P < 0.05 was considered statistically significant.
2.4. RNA isolation and quantitative real-time PCR 3. Results Total cell RNA was extracted using the TRIzol method (Invitrogen, USA). HO-1 mRNA expression was measured by quantitative RT-PCR (qRT-PCR). The following primers was used for qRT-PCR. HO-1 gene (Forward, 50 -30 ) TGCACATCCGTGCAGAGAAT and (Reverse, 50 -30 ) CTGGGTTCTGCTTGTTTCGC; GAPDH gene (Forward, 50 -30 ) AGGTCGGTGTGAACGGATTTG and (Reverse, 50 -30 ) GGGGTCGTTGATGGCAACA. The primers were purchased from Sangon (China). GAPDH was used as the loading controls. The relative gene expression levels were calculated using the 2 DDCT method. 2.5. Western blotting Cells and tissue lysates for western blotting analyses were prepared as previously described [15]. GAPDH was applied as an internal control. The antibodies used for western blotting included anti-LAMP2, anti-P62, anti-LC3, anti-cleaved-caspase3, antieHOe1, and anti-GAPDH (Abcam, USA). 2.6. Determination of autophagic flux NRCMs cultured on coverslips were stimulated with nicotine, CQ, or PA, or were transfected with HO-1 siRNA. Simultaneously, cells were transfected with autophagy double-labeled adenovirus (mRFP-GFP-LC3, Sangon Biotech, China) at 20 MOI. Cells were harvested and fixed with 4% paraformaldehyde and then viewed under a 40 magnification fluorescence microscope (Zeiss,
3.1. Different doses of nicotine have different effects on autophagy and apoptosis of cardiomyocytes To investigate the role of nicotine in NMCMs autophagy and apoptosis, NMCMs were treated with different concentrations of nicotine (0, 0.5, 1, 5, 10 and 15 mM) for 24 h. The results showed that different doses of nicotine had opposite effects on the autophagy and apoptosis of NMCMs. At the low concentrations of 0.5 and 1 mM, nicotine increased the expression of lysosome-related protein LAMP2, decreased the expressions of autophagy-related protein P62 and LC3II, and significantly decreased the expression of apoptosis-related protein cleaved-caspase3 (Fig. 1AeB). In contrast, at the high concentrations of 5, 10 and 15 mM, nicotine decreased the expression of LAMP2, increased the expressions of P62 and LC3II (Fig. 1AeB). In addition, at the high concentrations of 5, 10 and 15 mM, nicotine increased the expression of cleavedcaspase3 (Fig. 1AeB). Therefore, the low-dose nicotine promoted autophagy and inhibited apoptosis of NMCMs, with a concentration of 1 mM showing the most significant effect. Conversely, the highdose nicotine significantly inhibited autophagy and increased apoptosis of NMCMs. There was no difference in cell viability between control group and nicotine (0.5,1 and 5 mM),showing that nicotine (0.5,1 and 5 mM) could not affect cell viability and didn’t have cell toxicity (Fig. 1C). However, high-dose nicotine group (10 and 15 mM) could significantly decrease cell viability due to cytotoxic effects (Fig. 1C).
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. Effects of nicotine on the autophagy and apoptosis of NMCMs. (AeB) Effects of nicotine (0, 0.5, 1, 5, 10, 15 mM) on the protein levels of LAMP2, LC3, P62 and cleavedcaspase3 were measured by western blotting. (C) Effects of nicotine (0, 0.5, 1, 5, 10, 15 mM) on cell viability were assessed by MTT assay. (D) Effects of nicotine (1 mM) on autophagic flux were measured by mRFP-GFP-LC3 transfection. (E) Effects of nicotine (1 mM) on cell apoptosis were measured by TUNEL staining. (FeG) Protein expression levels of LAMP2, LC3, P62 and cleaved-caspase3 in CQ, nicotine (1 mM) or nicotine (1 mM) þ CQ treated NMCMs were measured by western blotting. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. Nicotine group.
3.2. Low-dose nicotine promotes autophagy and inhibits apoptosis in NMCMs To further examine the effects of low-dose nicotine on autophagic flux and apoptosis, 1 mM nicotine was employed to treat NMCMs. NMCMs were transfected with mRFP-GFP-LC3, and treated with 1 mM nicotine for 24 h. Compared with the control, nicotine
increased the proportion of autolysosomes and decreased the proportion of autophagosomes, indicating that nicotine promoted autophagic flux in NMCMs (Fig. 1D). TUNEL staining indicated that the proportion of apoptotic cells in the nicotine group was significantly decreased compared with the control group (Fig. 1E). Then 1 mM nicotine was used to treat NMCMs in the absence or presence of CQ, an autophagy inhibitor. The results of western blotting
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
4
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
showed that the autophagy inhibitor CQ inhibited autophagy and enhanced apoptosis of NMCMs (Fig. 1FeG). In addition, 1 mM nicotine enhanced autophagy and inhibited apoptosis in NMCMs, and the effects of CQ were reversed by nicotine (Fig. 1FeG). These above results demonstrated that low-dose nicotine was able to promote protective autophagy in NMCMs.
3.3. Low-dose nicotine regulates autophagy and apoptosis by increasing HO-1 expression in NMCMs Previous studies have shown that HO-1 promotes protective autophagy and inhibits apoptosis in cardiomyocytes [17]. Therefore, we further examined whether low-dose nicotine enhanced autophagy and inhibited apoptosis through regulating HO-1. We further used HO-1 siRNA to knock down HO-1. NMCMs were treated with nicotine in the absence or presence of the HO-1 silencer. RT-PCR and western blotting analysis showed that HO-1 siRNA considerably reduced the HO-1 expression. As expected, nicotine increased
HO-1 mRNA and protein expression levels regardless of HO-1 siRNA (Fig. 2AeC). Compared with the control group, knocking down HO-1 significantly inhibited autophagy following decreased LAMP2 protein and increased P62 and LC3II protein expression (Fig. 2BeC). Moreover, nicotine reversed the inhibited autophagy induced by knocking down HO-1. Compared to the si-HO-1 group, LAMP2 protein expression was significantly increased, and P62 and LC3II proteins were decreased in the nicotine þ si-HO-1 group, (Fig. 2BeC). The autophagic flux levels were also inhibited by knocking down HO-1 and were reversed by nicotine (Fig. 2D). Western blotting and TUNEL staining revealed that knocking down HO-1 promoted NMCMs apoptosis. In the si-HO-1 group, the expression of cleaved-capase3 and the proportion of apoptotic cells were significantly increased compared with the control group (Fig. 2BeC and E). Furthermore, nicotine alleviated NMCMs apoptosis induced by si-HO-1. Compared with the si-HO-1 group, the expression of cleaved-caspase3 protein and the proportion of
Fig. 2. HO-1 mediated the effects of nicotine on the autophagy and apoptosis of NMCMs. (A) MRNA levels of HO-1 in the sieHOe1, nicotine, and nicotine þ sieHOe1 groups. (BeC) Protein expression levels of HO-1, LAMP2, LC3, P62 and cleaved-caspase3 in the sieHOe1 and nicotine þ sieHOe1 groups were measured by western blotting. (D) Autophagic flux in the sieHOe1 and nicotine þ sieHOe1 groups was measured by mRFP-GFP-LC3 transfection. (E) Cell apoptosis in the sieHOe1 and nicotine þ sieHOe1 groups was measured by TUNEL staining. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. SieHO-1 group.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
apoptotic cells were decreased in the si-HO-1 þ nicotine group (Fig. 2BeC and E). Meanwhile, compared with nicotine group, autophagy was inhibited and apoptosis was enhanced in the si-HO1 þ nicotine group (Fig. 2BeE). Taken together, these results demonstrated that low-dose nicotine enhanced autophagy and inhibited apoptosis of NMCMs by regulating HO-1 expression. 3.4. Low-dose nicotine regulates autophagy and apoptosis through the a7-nAChRs/HO-1 pathway in NMCMs Nicotine improves renal vasodilation in endotoxic rats through the a7-nAChRs/HO-1 pathway [18]. To investigate whether nicotine regulates autophagy and apoptosis through a7-nAChRs/HO-1 pathway in NMCMs, NMCMs were treated with nicotine in the absence or presence of the a7-nAChR blocker MLA. The results showed that only inhibiting a7-nAChR did not change the HO-1 expression and had no effects on autophagy and apoptosis in the absence of nicotine (Fig. 3AeB). However, MLA inhibited the expression of HO-1, and reversed the increased autophagy and decreased apoptosis induced by nicotine. Western blotting showed that compared with the nicotine group, HO-1 and LAMP2 expression levels were downregulated, LC3II, P62, and cleaved-caspase3 expressions were upregulated in the nicotine þ MLA group (Fig. 3AeB). Immunofluorescence staining revealed that the blockade of a7-nAChR in the presence of nicotine significantly inhibited upregulated HO-1 expression, which was induced by nicotine (Fig. 3C). These findings indicated that low-dose nicotine regulated autophagy and apoptosis through the a7-nAChRs/HO-1 pathway in NMCMs. 3.5. Low-dose nicotine rescues the inhibition of autophagy and the enhancement of apoptosis caused by PA through upregulating HO-1 in NMCMs Previous reports have suggested that PA inhibits autophagy and promotes apoptosis of cardiomyocytes. To investigate the effects of nicotine on PA-induced NMCMs injury, NMCMs were treated with
5
low-dose nicotine in the presence of PA. The results showed that the harmful effect of PA on autophagy and apoptosis could be rescued by low-dose nicotine in NMCMs. Compared with the PA group, LAMP2 expression was upregulated, while LC3II and P62 expressions were downregulated in the PA þ nicotine group (Fig. 4AeB). The results of mRFP-GFP-LC3 transfection indicated that the proportion of autolysosomes was decreased and the proportion of autophagosomes was increased after PA stimulation (Fig. 4C). In addition, after NMCMs were treated with PA corresponding nicotine, the proportion of autolysosomes was upregulated, and the proportion of autophagosomes was decreased compared to the PA group (Fig. 4C), indicating that low-dose nicotine could reverse the inhibition of autophagic flux induced by PA. Moreover, PA induced the increase of cleaved-caspase3 expression and the proportion of apoptotic cells, and the increased apoptosis was distinctly reversed by low-dose nicotine (Fig. 4AeB and D). Simultaneously, HO-1 expression in NMCMs was significantly decreased by PA and restored after nicotine treatment (Fig. 4AeB). Knocking down HO-1 eliminated the protective effects of nicotine on PA-induced autophagic disorder and apoptotic enhancement (Fig. 4AeD). In summary, low dose nicotine rescues the inhibition of autophagy and the enhancement of apoptosis caused by PA through upregulating HO-1. 4. Discussion Smoking is an independent risk factor for cardiovascular disease [19]. There are more than 9000 chemicals in cigarette smoke, including carbon monoxide, oxidizing chemicals, volatiles, particulates, organic compounds, heavy metals, and nicotine [20]. However, studies have found that the main components of cigarettes that cause cancer and cardiovascular disease are oxidizing chemicals and toxic organic chemicals. Oxidizing chemicals contain free radicals, reactive nitrogen species, and reactive oxygen species, which are the main contributors to thrombogenesis and atherogenesis; toxic organic chemicals such as polycyclic hydrocarbons
Fig. 3. a7-nAChRs mediated the regulation of nicotine on HO-1 expression and the effects of nicotine on autophagy and apoptosis in NMCMs. (AeB) Protein expression levels of HO-1, LAMP2, LC3, P62 and cleaved-caspase3 in the MLA and nicotine þ MLA groups were measured by western blotting. (C) HO-1 expression in the MLA and nicotine þ MLA groups was measured by immunofluorescence analysis. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. Nicotine group.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
6
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. Effects of nicotine on the autophagy and apoptosis of NMCMs under PA stimulation. (AeB) Protein expression levels of HO-1, LAMP2, LC3, P62 and cleaved-caspase3 in the PA, nicotine þ PA, and PA þ nicotine þ sieHOe1 groups were measured by western blotting. (C) Autophagic flux in the PA, nicotine þ PA, and PA þ nicotine þ sieHOe1 groups was measured by mRFP-GFP-LC3 transfection. (D) Cell apoptosis in the PA, nicotine þ PA, and PA þ nicotine þ sieHOe1 groups was measured by TUNEL staining. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. PA group, & p < 0.05 vs. PA þ Nicotine group.
and reactive aldehydes are closely related to atherosclerosis, endothelial damage, and thrombogenesis, and can cause coronary vasospasm [21,22]. Nicotine is the main addictive substance in cigarettes. Nicotine acts on nicotinic cholinergic receptors (nAChRs) throughout the nervous system such as brain, autonomic nervous system, and skeletal muscle, as well as at some non-neuronal sites such as endothelial cells and cardiomyocytes [12]. The short-term use of nicotine, such as using nicotine medication to aid in smoking cessation, has little cardiovascular risk, even in patients with known cardiovascular diseases [23]. Only chronic and high-dose nicotine stimulation contributes to myocardial remodeling and heart failure via sympathetic activation [24,25]. Moreover, medicinal nicotine has not been confirmed to be carcinogenic [26]. Many
recent studies have determined that, nicotine could be involved in many diseases as a protective agent. Nicotine not only improves obesity and hepatic steatosis but also promotes muscle regeneration in obese mice [11,27]. In the cardiovascular system, activation of the a-7 nicotinic acetylcholine receptor reduces ischemic injury in rat heart and nicotinic agonist inhibits cardiomyocyte apoptosis in CVB3-induced myocarditis [12,13]. In addition, nicotine inhibits cardiac apoptosis induced by lipopolysaccharide in rats [28]. In our study, we found that low-dose nicotine not only inhibited apoptosis but also promoted protective autophagy in NMCMs. Moreover, lowdose nicotine also improved PA-induced cardiomyocyte injury. Therefore, the protective effects of nicotine would be a promising area to study.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
HO-1 catalyzes heme to biliverdin and ferrous iron (Fe2þ). Biliverdin is converted to bilirubin, and Fe2þ stimulates the synthesis of ferritin. These end-products have cytoprotective functions [29]. The effects of HO-1 in protecting against various cellular stresses involve autophagy and apoptosis modulation. HO-1 is able to mediate autophagy to prevent pulmonary endothelial cells from death, protect the liver from ischemia-reperfusion injury in Cdexposed mice and prevent emphysema [30,31]. In podocytes, upregulation of HO-1 by hemin induces autophagy and prevents apoptosis [32]. Moreover, HO-1 also plays an essential role in cardioprotection. Activation of Nrf2/HO-1 signaling protects cardiomyocytes against hypoxia/reoxygenation injury [16]. Our study found that nicotine could significantly upregulate HO-1 and mediated the protective effect of nicotine in PA-induced cardiomyocytes injury. To the best of our knowledge, most studies have focused on the harmful effects of chronic nicotine exposure on the cardiovascular system [22], but the protective role of nicotine in cardiovascular disease has not been investigated. In addition, few studies have reported the effects of low-dose nicotine not only in vivo but also in vitro. In our present study, we found that nicotine promoted autophagy and prevented apoptosis of NMCMs at low doses. Conversely, when the concentration increased to 5 mM, autophagy was inhibited and apoptosis was increased, when the concentration increased to 10 mM, cells viability was significantly decreased, indicating that nicotine presented toxic effects at high concentrations. Although our results demonstrated the protective effects of lowdose nicotine in PA-induced cardiomyocytes injury, the most effective dose and duration are unclear. Moreover, animal experiments in vivo and the side effects of nicotine treatment to other organs should be further studied. In this regard, we should conduct more research to elucidate the protective effect of nicotine in cardiovascular diseases. In conclusion, low-dose nicotine promotes autophagy and inhibits apoptosis of cardiomyocytes by upregulating HO-1. The promising findings provide us with a novel understanding of nicotine and the opportunity to find new therapeutic or preventive strategies for obesity-related heart disease. Sources of funding This work was supported by the National Natural Science Foundation of China (81570265, 81670276 and 81770303), the Natural Science Foundation of Liaoning Province (20180550368), the Shenyang Science and Technology Project (19-112-4-056), and the Military Science and Technology Youth Talents Entrustment Project (17-JCJQ-QT-028). Declaration of competing interest We declare that there are no conflicts of interest in this study. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.086. References [1] P. Ravanan, I.F. Srikumar, P. Talwar, Autophagy: the spotlight for cellular stress responses, Life Sci. 188 (2017) 53e67.
7
[2] L.R. Gomes, C.F. Menck, A.M. Cuervo, Chaperone-mediated autophagy prevents cellular transformation by regulating MYC proteasomal degradation, Autophagy 13 (2017) 928e940. [3] Y. Feng, D. He, Z. Yao, et al., The machinery of macroautophagy, Cell Res. 24 (2014) 24e41. [4] K.R. Parzych, D.J. Klionsky, An overview of autophagy: morphology, mechanism, and regulation, Antioxidants Redox Signal. 20 (2014) 460e473. [5] H. Lim, Y.M. Lim, K.H. Kim, et al., A novel autophagy enhancer as a therapeutic agent against metabolic syndrome and diabetes, Nat. Commun. 9 (2018) 1438. [6] C. Diana, G. Mohanad, C.S. Kyoung, et al., Mapara6, targeting autophagy in obesity-associated heart disease, Obesity 27 (2019) 1050e1058. [7] K.J. Jung, C. Jeon, S.H. Jee, The effect of smoking on lung cancer: ethnic differences and the smoking paradox, Epidemiol Health 38 (2016) 60. [8] N.L. Benowitz, A.D. Burbank, Cardiovascular toxicity of nicotine: implications for electronic cigarette use, Trends Cardiovasc. Med. 26 (2016) 515e523. [9] P.N. Lee, Tar level of cigarettes smoked and risk of smoking-related diseases, Inhal. Toxicol. 30 (2018) 5e18. [10] T. Higenbottam, M.J. Shipley, G. Rose, Cigarettes, lung cancer, and coronary heart disease: the effects of inhalation and tar yield, J. Epidemiol. Community Health 36 (1982) 113e117. [11] P.S. Collazo, P.B. Morentin, J. Ferno, et al., Nicotine improves obesity and hepatic steatosis and ER stress in diet-induced obese male rats, Endocrinology 155 (2014) 1679e1689. [12] A. Spyros, Mavropoulos, S. Nayaab, et al., Nicotinic acetylcholine receptormediated protection of the heart exposed to ischemia reperfusion, Mol. Med. 23 (2017) 120e133. [13] P. Li, Y.Y. Yan, Y.Y. Shi, et al., Nicotinic agonist inhibits cardiomyocyte apoptosis in CVB3-induced myocarditis via a3b4-nAChR/PI3K/Akt dependent survivin upregulation, Oxid. Med. Cell Longev. (2019) 9496419. [14] D.R. Davis, E. Kizana, J. Terrovitis, et al., Isolation and expansion of functionally-competent cardiac progenitor cells directly from heart biopsies, J. Mol. Cell. Cardiol. 49 (2010) 312e321. [15] S. Du, Q.P. Yao, Protective effect of tanshinone IIA against radiation-induced ototoxicity in HEI-OC1 cells, Oncol. Lett. 6 (2013) 901e906. [16] H. Nirmala, Z. Peiyong, J. Sadoshima, Oxidative stress stimulates autophagic flux during ischemia reperfusion, antioxid redox signal 14 (2011) 2179e2190. [17] Q.H. Li, X. Yin, C. Yu, et al., Ginsenoside Rg1 protects cardiomyocytes against hypoxia/reoxygenation injury via activation of Nrf2/HO-1 signaling and inhibition of JNK, Cell. Physiol. Biochem. 44 (2017) 21e37. [18] M.W. Abdalla, M. Sahar, El-Gowilly, et al., Nicotine improves survivability, hypotension, and impaired adenosinergic renal vasodilations in endotoxic rats: role of a7-nAChRs/HO-1 pathway, Shock 10 (2019) 1097. [19] P.B. Morris, B.A. Ference, E. Jahangir, et al., Cardiovascular effects of exposure to cigarette smoke and electronic cigarettes: clinical perspectives from the prevention of cardiovascular disease section leadership council and early career councils of the american college of cardiology, J. Am. Coll. Cardiol. 66 (2016) 1378e1391. [20] U.S. Department of Health and Human Services, How Tobacco Smoke Causes Disease: the Biology and Behavioral Basis for Smoking-Attributable Disease, 2010. [21] A. Csordas, D. Bernhard, The biology behind the atherothrombotic effects of cigarette smoke, Nat. Rev. Cardiol. 10 (2013) 219e230. [22] R.S. Barua, J.A. Ambrose, Mechanisms of coronary thrombosis in cigarette smoke exposure, Arterioscler Thromb. Vasc. Biol. 33 (2013) 1460e1467. [23] L. Neal, D. Andrea Benowitz, et al., Cardiovascular toxicity of nicotine: implications for electronic cigarette use, Science Direct 26 (2016) 515e523. [24] K. Jensen, D. Nizamutdinov, M. Guerrier, et al., General mechanisms of nicotine-induced fibrogenesis, FASEB J. 26 (2016) 4778e4787. [25] J.H. Berlo, M. Maillet, J.D. Molkentin, Signaling effectors underlying pathologic growth and remodeling of the heart, J. Clin. Investig. 123 (2013) 37e45. [26] Nicotine and health, Drug Ther. Bull. 52 (2014) 78e81. [27] L.Q. He, X.X. Tian, C.H. Yan, et al., Nicotine promotes the differentiation of C2C12 myoblasts and improves skeletal muscle regeneration in obese mice, Biochem. Biophys. Res. Commun. 511 (2019) 731e745. [28] J. Suzuki, E. Bayna, E.D. Molle, et al., Nicotine inhibits cardiac apoptosis induced by lipopolysaccharide in rats, J. Am. Coll. Cardiol. 41 (2003) 735e1097. [29] A. Agarwal, H.S. Nick, Renal response to tissue injury: lessons from heme oxygenase-1 GeneAblation and expression, J. Am. Soc. Nephrol. 11 (2000) 965e973. [30] R. Surolia, S. Karki, H. Kim, et al., Heme oxygenase-1- mediated autophagy protects against pulmonary endothelial cell death and development of emphysema in cadmium-treated mice, Am. J. Physiol. Lung Cell Mol. Physiol. 309 (2015) 280e292. [31] D. Xu, L. Chen, X. Chen, et al., The triterpenoid CDDO-imidazolide ameliorates mouse liver ischemia-reperfusion injury through activating the Nrf2/HO-1 pathway enhanced autophagy, Cell Death Dis. 8 (2017) 2983. [32] C. Dong, H. Zheng, S. Huang, et al., Heme oxygenase-1 enhances autophagy in podocytes as a protective mechanism against high glucose-induced apoptosis, Exp. Cell Res. 337 (2015) 146e159.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression Ruinan Xing a, Xiaoli Cheng b, Yanping Qi b, Xiaoxiang Tian b, Chenghui Yan b, Dan Liu b, **, Yaling Han a, * a
Second Clinical College of Dalian Medical University, Dalian, Liaoning Province, 116044, China Department of Cardiology and Cardiovascular Research Institute of PLA, General Hospital of Northern Theater Command, Shenyang, Liaoning Province, 110016, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 2 November 2019 Accepted 14 November 2019 Available online xxx
Nicotine as a major component of addiction in cigarettes has been reported to play protective roles in some pathological processes. It is reported that activation of the nicotinic acetylcholine receptor also has a cardioprotective effect. Thus, in our study, we investigated the effect and mechanism of nicotine on the autophagy of cardiomyocytes, and whether nicotine protects cardiomyocytes against palmitic acid (PA) injury. The results indicated that low-dose nicotine promoted neonatal mouse cardiac myocytes (NMCMs) autophagy and accelerated autophagic flux while inhibiting NMCMs apoptosis, but high-dose nicotine inhibited autophagy and promoted apoptosis. Moreover, low-dose nicotine upregulated heme oxygenase-1 (HO-1) expression and knocking down HO-1 abolished the effects of nicotine on the autophagy and apoptosis of NMCMs. Methyllycaconitine citrate (a7-nAChR blocker, MLA) inhibited HO-1 expression and the effects of nicotine on autophagy and apoptosis of NMCMs. Furthermore, low-dose nicotine improved the inhibited autophagy and increased apoptosis induced by palmitic acid (PA) in NMCMs and these effects were reversed by knocking down HO-1. In conclusion, our data suggested that low-dose nicotine promoted autophagy and inhibited apoptosis of cardiomyocytes by upregulating HO-1. © 2019 Elsevier Inc. All rights reserved.
Keywords: Nicotine Autophagy Apoptosis HO-1
1. Introduction Autophagy is a highly conservative process of lysosomemediated long-lived protein and impaired organelle degradation to maintain cellular homeostasis and metabolism [1]. The major form of autophagy involves the formation of autophagosomes and the fusion of autophagosomes with lysosomes, after which cellular contents and targeted proteins are degraded in the resulting autolysosome by lysosomal proteases [2,3]. Autophagy plays an important role in many mechanisms of human disease pathogenesis, including those in cardiovascular disease and metabolic disease [4]. Recent findings show that the inhibition of autophagy
* Corresponding author. Second Clinical College of Dalian Medical University, Dalian, Liaoning Province, 116044, China. ** Corresponding author. Department of Cardiology and Cardiovascular Research Institute of PLA, General Hospital of Northern Theater Command, Shenyang, Liaoning Province, 110016, China E-mail addresses: [email protected] (D. Liu), [email protected] (Y. Han).
leads to myocardial damage caused by lipotoxicity. In addition, autophagic flux restoration of cardiomyocytes mitigates lipid toxicity and improves cardiac hypertrophy [5,6]. Therefore, autophagy plays a significant role in lipid-induced myocardial damage. Nicotine is a major addictive component in cigarettes. There is no doubt that smoking is a major risk factor for many diseases, especially cancer and cardiovascular diseases [7,8]. However, studies have found that the main components of cigarettes that causes cancer and cardiovascular disease are oxidizing chemicals and toxic organic chemicals [9,10]. In recent research, nicotine improves obesity and hepatic steatosis and exerts beneficial effects on the peripheral metabolism [11]. In the cardiovascular system, activation of the a-7 nicotinic acetylcholine receptor reduces ischemic injury in rat heart [12]. Moreover, nicotinic agonist inhibits cardiomyocyte apoptosis in CVB3-induced myocarditis [13]. However, the effects of nicotine on cardiac autophagy and PAinduced cardiac injury have not been reported. The aim of our study is to investigate the effect of nicotine on autophagy of cardiomyocytes and its role in PA-induced autophagy dysfunction.
https://doi.org/10.1016/j.bbrc.2019.11.086 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
2
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
2. Method
Germany). The levels of autophagic flux were analyzed as previously described [16].
2.1. Cell culture and nicotine treatment in vitro Neonatal mouse cardiac myocytes (NMCMs) were isolated from 1 to 3-day-old C57BL/6J neonatal mice using the primary cardiomyocyte isolation kit (Thermo, USA), as described previously [14]. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 20% fetal bovine serum (FBS) and 1% penicillin/ streptomycin, and the cells suspension was then plated in multiwell™ Primaria™ 6-well plates (Becton Dickinson, USA) at 37 C in a 5% CO2 incubator. After 24 h, the NMCMs were exposed to different concentrations of nicotine (0, 0.5, 1, 5, 10 and 15 mM, Sigma, USA), either alone or in combination with a silencer of heme oxygenase-1 (HO-1) (sieHOe1, Santa, USA), 20 mM methyllycaconitine citrate (MLA, Sigma, USA), 10 mM chloroquine (CQ, Sigma, USA) or 400 mM palmitic acid (PA, Sigma, USA) for 24 h. 2.2. Cell viability assay Cell viability was measured by MTT assay. Briefly, when the NMCMs reached 90% confluence, the cells were treated with different concentrations of nicotine for 24 h. Then, the cells were incubated in MTT reagent in an incubator at 37 C for 4 h. The absorbance was then measured by an Infinite M Plex Fully Loaded Multimode Plate Reader (Tecan, Switzerland) at a wavelength of 540 nm. 2.3. Cell transfection For cell transfection, HO-1 siRNA (Santa, USA) was transfected into NMCMs using lipofectamine™ RNAiMAX transfection reagent (Thermo, USA). For 6-well plate transfection, 10 MOI of HO-1 siRNA was added to NMCMs. Cells were harvested at 24 h posttransfection.
2.7. TUNEL staining NMCMs were cultured on coverslips and stimulated with nicotine, CQ, or PA, or transfected with HO-1 siRNA. NMCMs were harvested and fixed with 4% paraformaldehyde. The TUNEL staining kit (Abcam, USA) was used for analyzing the proportion of cell apoptosis in heart tissue and NMCM. All fluorescent images were examined by a 20 magnification fluorescence microscope (Zeiss, Germany). 2.8. Immunofluorescence analysis An immunofluorescence assay was used to ascertain the expression of cellular HO-1. NMCMs were cultured on coverslips and stimulated with nicotine or MLA. NMCMs were harvested and fixed with 4% paraformaldehyde. Then, NMCMs were washed three times with PBS and incubated with 0.5% Triton X-100 for 10 min and then with blocking buffer for 30 min at room temperature. After that, NMCMs were incubated with antibodies to HO-1 at a 1:100 dilution at 4 C overnight. Subsequently, the cells were washed and incubated for 1 h at room temperature with Cy3conjugated anti-rabbit IgG at a 1:500 dilution. Cell nuclei were stained with 6-diamidino-2-phenylindole (DAPI, Sigma, USA). All fluorescent images were examined by a 20 magnification fluorescence microscope (Zeiss, Germany). Data were shown as the means ± SEM. All data were analyzed by SPSS 19.0 statistical software (USA). Differences between the two groups were calculated by unpaired Student’s t-test. Differences among three or more groups were assessed by using one-way analysis of variance. P < 0.05 was considered statistically significant.
2.4. RNA isolation and quantitative real-time PCR 3. Results Total cell RNA was extracted using the TRIzol method (Invitrogen, USA). HO-1 mRNA expression was measured by quantitative RT-PCR (qRT-PCR). The following primers was used for qRT-PCR. HO-1 gene (Forward, 50 -30 ) TGCACATCCGTGCAGAGAAT and (Reverse, 50 -30 ) CTGGGTTCTGCTTGTTTCGC; GAPDH gene (Forward, 50 -30 ) AGGTCGGTGTGAACGGATTTG and (Reverse, 50 -30 ) GGGGTCGTTGATGGCAACA. The primers were purchased from Sangon (China). GAPDH was used as the loading controls. The relative gene expression levels were calculated using the 2 DDCT method. 2.5. Western blotting Cells and tissue lysates for western blotting analyses were prepared as previously described [15]. GAPDH was applied as an internal control. The antibodies used for western blotting included anti-LAMP2, anti-P62, anti-LC3, anti-cleaved-caspase3, antieHOe1, and anti-GAPDH (Abcam, USA). 2.6. Determination of autophagic flux NRCMs cultured on coverslips were stimulated with nicotine, CQ, or PA, or were transfected with HO-1 siRNA. Simultaneously, cells were transfected with autophagy double-labeled adenovirus (mRFP-GFP-LC3, Sangon Biotech, China) at 20 MOI. Cells were harvested and fixed with 4% paraformaldehyde and then viewed under a 40 magnification fluorescence microscope (Zeiss,
3.1. Different doses of nicotine have different effects on autophagy and apoptosis of cardiomyocytes To investigate the role of nicotine in NMCMs autophagy and apoptosis, NMCMs were treated with different concentrations of nicotine (0, 0.5, 1, 5, 10 and 15 mM) for 24 h. The results showed that different doses of nicotine had opposite effects on the autophagy and apoptosis of NMCMs. At the low concentrations of 0.5 and 1 mM, nicotine increased the expression of lysosome-related protein LAMP2, decreased the expressions of autophagy-related protein P62 and LC3II, and significantly decreased the expression of apoptosis-related protein cleaved-caspase3 (Fig. 1AeB). In contrast, at the high concentrations of 5, 10 and 15 mM, nicotine decreased the expression of LAMP2, increased the expressions of P62 and LC3II (Fig. 1AeB). In addition, at the high concentrations of 5, 10 and 15 mM, nicotine increased the expression of cleavedcaspase3 (Fig. 1AeB). Therefore, the low-dose nicotine promoted autophagy and inhibited apoptosis of NMCMs, with a concentration of 1 mM showing the most significant effect. Conversely, the highdose nicotine significantly inhibited autophagy and increased apoptosis of NMCMs. There was no difference in cell viability between control group and nicotine (0.5,1 and 5 mM),showing that nicotine (0.5,1 and 5 mM) could not affect cell viability and didn’t have cell toxicity (Fig. 1C). However, high-dose nicotine group (10 and 15 mM) could significantly decrease cell viability due to cytotoxic effects (Fig. 1C).
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
3
Fig. 1. Effects of nicotine on the autophagy and apoptosis of NMCMs. (AeB) Effects of nicotine (0, 0.5, 1, 5, 10, 15 mM) on the protein levels of LAMP2, LC3, P62 and cleavedcaspase3 were measured by western blotting. (C) Effects of nicotine (0, 0.5, 1, 5, 10, 15 mM) on cell viability were assessed by MTT assay. (D) Effects of nicotine (1 mM) on autophagic flux were measured by mRFP-GFP-LC3 transfection. (E) Effects of nicotine (1 mM) on cell apoptosis were measured by TUNEL staining. (FeG) Protein expression levels of LAMP2, LC3, P62 and cleaved-caspase3 in CQ, nicotine (1 mM) or nicotine (1 mM) þ CQ treated NMCMs were measured by western blotting. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. Nicotine group.
3.2. Low-dose nicotine promotes autophagy and inhibits apoptosis in NMCMs To further examine the effects of low-dose nicotine on autophagic flux and apoptosis, 1 mM nicotine was employed to treat NMCMs. NMCMs were transfected with mRFP-GFP-LC3, and treated with 1 mM nicotine for 24 h. Compared with the control, nicotine
increased the proportion of autolysosomes and decreased the proportion of autophagosomes, indicating that nicotine promoted autophagic flux in NMCMs (Fig. 1D). TUNEL staining indicated that the proportion of apoptotic cells in the nicotine group was significantly decreased compared with the control group (Fig. 1E). Then 1 mM nicotine was used to treat NMCMs in the absence or presence of CQ, an autophagy inhibitor. The results of western blotting
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
4
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
showed that the autophagy inhibitor CQ inhibited autophagy and enhanced apoptosis of NMCMs (Fig. 1FeG). In addition, 1 mM nicotine enhanced autophagy and inhibited apoptosis in NMCMs, and the effects of CQ were reversed by nicotine (Fig. 1FeG). These above results demonstrated that low-dose nicotine was able to promote protective autophagy in NMCMs.
3.3. Low-dose nicotine regulates autophagy and apoptosis by increasing HO-1 expression in NMCMs Previous studies have shown that HO-1 promotes protective autophagy and inhibits apoptosis in cardiomyocytes [17]. Therefore, we further examined whether low-dose nicotine enhanced autophagy and inhibited apoptosis through regulating HO-1. We further used HO-1 siRNA to knock down HO-1. NMCMs were treated with nicotine in the absence or presence of the HO-1 silencer. RT-PCR and western blotting analysis showed that HO-1 siRNA considerably reduced the HO-1 expression. As expected, nicotine increased
HO-1 mRNA and protein expression levels regardless of HO-1 siRNA (Fig. 2AeC). Compared with the control group, knocking down HO-1 significantly inhibited autophagy following decreased LAMP2 protein and increased P62 and LC3II protein expression (Fig. 2BeC). Moreover, nicotine reversed the inhibited autophagy induced by knocking down HO-1. Compared to the si-HO-1 group, LAMP2 protein expression was significantly increased, and P62 and LC3II proteins were decreased in the nicotine þ si-HO-1 group, (Fig. 2BeC). The autophagic flux levels were also inhibited by knocking down HO-1 and were reversed by nicotine (Fig. 2D). Western blotting and TUNEL staining revealed that knocking down HO-1 promoted NMCMs apoptosis. In the si-HO-1 group, the expression of cleaved-capase3 and the proportion of apoptotic cells were significantly increased compared with the control group (Fig. 2BeC and E). Furthermore, nicotine alleviated NMCMs apoptosis induced by si-HO-1. Compared with the si-HO-1 group, the expression of cleaved-caspase3 protein and the proportion of
Fig. 2. HO-1 mediated the effects of nicotine on the autophagy and apoptosis of NMCMs. (A) MRNA levels of HO-1 in the sieHOe1, nicotine, and nicotine þ sieHOe1 groups. (BeC) Protein expression levels of HO-1, LAMP2, LC3, P62 and cleaved-caspase3 in the sieHOe1 and nicotine þ sieHOe1 groups were measured by western blotting. (D) Autophagic flux in the sieHOe1 and nicotine þ sieHOe1 groups was measured by mRFP-GFP-LC3 transfection. (E) Cell apoptosis in the sieHOe1 and nicotine þ sieHOe1 groups was measured by TUNEL staining. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. SieHO-1 group.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
apoptotic cells were decreased in the si-HO-1 þ nicotine group (Fig. 2BeC and E). Meanwhile, compared with nicotine group, autophagy was inhibited and apoptosis was enhanced in the si-HO1 þ nicotine group (Fig. 2BeE). Taken together, these results demonstrated that low-dose nicotine enhanced autophagy and inhibited apoptosis of NMCMs by regulating HO-1 expression. 3.4. Low-dose nicotine regulates autophagy and apoptosis through the a7-nAChRs/HO-1 pathway in NMCMs Nicotine improves renal vasodilation in endotoxic rats through the a7-nAChRs/HO-1 pathway [18]. To investigate whether nicotine regulates autophagy and apoptosis through a7-nAChRs/HO-1 pathway in NMCMs, NMCMs were treated with nicotine in the absence or presence of the a7-nAChR blocker MLA. The results showed that only inhibiting a7-nAChR did not change the HO-1 expression and had no effects on autophagy and apoptosis in the absence of nicotine (Fig. 3AeB). However, MLA inhibited the expression of HO-1, and reversed the increased autophagy and decreased apoptosis induced by nicotine. Western blotting showed that compared with the nicotine group, HO-1 and LAMP2 expression levels were downregulated, LC3II, P62, and cleaved-caspase3 expressions were upregulated in the nicotine þ MLA group (Fig. 3AeB). Immunofluorescence staining revealed that the blockade of a7-nAChR in the presence of nicotine significantly inhibited upregulated HO-1 expression, which was induced by nicotine (Fig. 3C). These findings indicated that low-dose nicotine regulated autophagy and apoptosis through the a7-nAChRs/HO-1 pathway in NMCMs. 3.5. Low-dose nicotine rescues the inhibition of autophagy and the enhancement of apoptosis caused by PA through upregulating HO-1 in NMCMs Previous reports have suggested that PA inhibits autophagy and promotes apoptosis of cardiomyocytes. To investigate the effects of nicotine on PA-induced NMCMs injury, NMCMs were treated with
5
low-dose nicotine in the presence of PA. The results showed that the harmful effect of PA on autophagy and apoptosis could be rescued by low-dose nicotine in NMCMs. Compared with the PA group, LAMP2 expression was upregulated, while LC3II and P62 expressions were downregulated in the PA þ nicotine group (Fig. 4AeB). The results of mRFP-GFP-LC3 transfection indicated that the proportion of autolysosomes was decreased and the proportion of autophagosomes was increased after PA stimulation (Fig. 4C). In addition, after NMCMs were treated with PA corresponding nicotine, the proportion of autolysosomes was upregulated, and the proportion of autophagosomes was decreased compared to the PA group (Fig. 4C), indicating that low-dose nicotine could reverse the inhibition of autophagic flux induced by PA. Moreover, PA induced the increase of cleaved-caspase3 expression and the proportion of apoptotic cells, and the increased apoptosis was distinctly reversed by low-dose nicotine (Fig. 4AeB and D). Simultaneously, HO-1 expression in NMCMs was significantly decreased by PA and restored after nicotine treatment (Fig. 4AeB). Knocking down HO-1 eliminated the protective effects of nicotine on PA-induced autophagic disorder and apoptotic enhancement (Fig. 4AeD). In summary, low dose nicotine rescues the inhibition of autophagy and the enhancement of apoptosis caused by PA through upregulating HO-1. 4. Discussion Smoking is an independent risk factor for cardiovascular disease [19]. There are more than 9000 chemicals in cigarette smoke, including carbon monoxide, oxidizing chemicals, volatiles, particulates, organic compounds, heavy metals, and nicotine [20]. However, studies have found that the main components of cigarettes that cause cancer and cardiovascular disease are oxidizing chemicals and toxic organic chemicals. Oxidizing chemicals contain free radicals, reactive nitrogen species, and reactive oxygen species, which are the main contributors to thrombogenesis and atherogenesis; toxic organic chemicals such as polycyclic hydrocarbons
Fig. 3. a7-nAChRs mediated the regulation of nicotine on HO-1 expression and the effects of nicotine on autophagy and apoptosis in NMCMs. (AeB) Protein expression levels of HO-1, LAMP2, LC3, P62 and cleaved-caspase3 in the MLA and nicotine þ MLA groups were measured by western blotting. (C) HO-1 expression in the MLA and nicotine þ MLA groups was measured by immunofluorescence analysis. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. Nicotine group.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
6
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 4. Effects of nicotine on the autophagy and apoptosis of NMCMs under PA stimulation. (AeB) Protein expression levels of HO-1, LAMP2, LC3, P62 and cleaved-caspase3 in the PA, nicotine þ PA, and PA þ nicotine þ sieHOe1 groups were measured by western blotting. (C) Autophagic flux in the PA, nicotine þ PA, and PA þ nicotine þ sieHOe1 groups was measured by mRFP-GFP-LC3 transfection. (D) Cell apoptosis in the PA, nicotine þ PA, and PA þ nicotine þ sieHOe1 groups was measured by TUNEL staining. n ¼ 3 per group. *p < 0.05 vs. Control group, #p < 0.05 vs. PA group, & p < 0.05 vs. PA þ Nicotine group.
and reactive aldehydes are closely related to atherosclerosis, endothelial damage, and thrombogenesis, and can cause coronary vasospasm [21,22]. Nicotine is the main addictive substance in cigarettes. Nicotine acts on nicotinic cholinergic receptors (nAChRs) throughout the nervous system such as brain, autonomic nervous system, and skeletal muscle, as well as at some non-neuronal sites such as endothelial cells and cardiomyocytes [12]. The short-term use of nicotine, such as using nicotine medication to aid in smoking cessation, has little cardiovascular risk, even in patients with known cardiovascular diseases [23]. Only chronic and high-dose nicotine stimulation contributes to myocardial remodeling and heart failure via sympathetic activation [24,25]. Moreover, medicinal nicotine has not been confirmed to be carcinogenic [26]. Many
recent studies have determined that, nicotine could be involved in many diseases as a protective agent. Nicotine not only improves obesity and hepatic steatosis but also promotes muscle regeneration in obese mice [11,27]. In the cardiovascular system, activation of the a-7 nicotinic acetylcholine receptor reduces ischemic injury in rat heart and nicotinic agonist inhibits cardiomyocyte apoptosis in CVB3-induced myocarditis [12,13]. In addition, nicotine inhibits cardiac apoptosis induced by lipopolysaccharide in rats [28]. In our study, we found that low-dose nicotine not only inhibited apoptosis but also promoted protective autophagy in NMCMs. Moreover, lowdose nicotine also improved PA-induced cardiomyocyte injury. Therefore, the protective effects of nicotine would be a promising area to study.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086
R. Xing et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
HO-1 catalyzes heme to biliverdin and ferrous iron (Fe2þ). Biliverdin is converted to bilirubin, and Fe2þ stimulates the synthesis of ferritin. These end-products have cytoprotective functions [29]. The effects of HO-1 in protecting against various cellular stresses involve autophagy and apoptosis modulation. HO-1 is able to mediate autophagy to prevent pulmonary endothelial cells from death, protect the liver from ischemia-reperfusion injury in Cdexposed mice and prevent emphysema [30,31]. In podocytes, upregulation of HO-1 by hemin induces autophagy and prevents apoptosis [32]. Moreover, HO-1 also plays an essential role in cardioprotection. Activation of Nrf2/HO-1 signaling protects cardiomyocytes against hypoxia/reoxygenation injury [16]. Our study found that nicotine could significantly upregulate HO-1 and mediated the protective effect of nicotine in PA-induced cardiomyocytes injury. To the best of our knowledge, most studies have focused on the harmful effects of chronic nicotine exposure on the cardiovascular system [22], but the protective role of nicotine in cardiovascular disease has not been investigated. In addition, few studies have reported the effects of low-dose nicotine not only in vivo but also in vitro. In our present study, we found that nicotine promoted autophagy and prevented apoptosis of NMCMs at low doses. Conversely, when the concentration increased to 5 mM, autophagy was inhibited and apoptosis was increased, when the concentration increased to 10 mM, cells viability was significantly decreased, indicating that nicotine presented toxic effects at high concentrations. Although our results demonstrated the protective effects of lowdose nicotine in PA-induced cardiomyocytes injury, the most effective dose and duration are unclear. Moreover, animal experiments in vivo and the side effects of nicotine treatment to other organs should be further studied. In this regard, we should conduct more research to elucidate the protective effect of nicotine in cardiovascular diseases. In conclusion, low-dose nicotine promotes autophagy and inhibits apoptosis of cardiomyocytes by upregulating HO-1. The promising findings provide us with a novel understanding of nicotine and the opportunity to find new therapeutic or preventive strategies for obesity-related heart disease. Sources of funding This work was supported by the National Natural Science Foundation of China (81570265, 81670276 and 81770303), the Natural Science Foundation of Liaoning Province (20180550368), the Shenyang Science and Technology Project (19-112-4-056), and the Military Science and Technology Youth Talents Entrustment Project (17-JCJQ-QT-028). Declaration of competing interest We declare that there are no conflicts of interest in this study. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.11.086. References [1] P. Ravanan, I.F. Srikumar, P. Talwar, Autophagy: the spotlight for cellular stress responses, Life Sci. 188 (2017) 53e67.
7
[2] L.R. Gomes, C.F. Menck, A.M. Cuervo, Chaperone-mediated autophagy prevents cellular transformation by regulating MYC proteasomal degradation, Autophagy 13 (2017) 928e940. [3] Y. Feng, D. He, Z. Yao, et al., The machinery of macroautophagy, Cell Res. 24 (2014) 24e41. [4] K.R. Parzych, D.J. Klionsky, An overview of autophagy: morphology, mechanism, and regulation, Antioxidants Redox Signal. 20 (2014) 460e473. [5] H. Lim, Y.M. Lim, K.H. Kim, et al., A novel autophagy enhancer as a therapeutic agent against metabolic syndrome and diabetes, Nat. Commun. 9 (2018) 1438. [6] C. Diana, G. Mohanad, C.S. Kyoung, et al., Mapara6, targeting autophagy in obesity-associated heart disease, Obesity 27 (2019) 1050e1058. [7] K.J. Jung, C. Jeon, S.H. Jee, The effect of smoking on lung cancer: ethnic differences and the smoking paradox, Epidemiol Health 38 (2016) 60. [8] N.L. Benowitz, A.D. Burbank, Cardiovascular toxicity of nicotine: implications for electronic cigarette use, Trends Cardiovasc. Med. 26 (2016) 515e523. [9] P.N. Lee, Tar level of cigarettes smoked and risk of smoking-related diseases, Inhal. Toxicol. 30 (2018) 5e18. [10] T. Higenbottam, M.J. Shipley, G. Rose, Cigarettes, lung cancer, and coronary heart disease: the effects of inhalation and tar yield, J. Epidemiol. Community Health 36 (1982) 113e117. [11] P.S. Collazo, P.B. Morentin, J. Ferno, et al., Nicotine improves obesity and hepatic steatosis and ER stress in diet-induced obese male rats, Endocrinology 155 (2014) 1679e1689. [12] A. Spyros, Mavropoulos, S. Nayaab, et al., Nicotinic acetylcholine receptormediated protection of the heart exposed to ischemia reperfusion, Mol. Med. 23 (2017) 120e133. [13] P. Li, Y.Y. Yan, Y.Y. Shi, et al., Nicotinic agonist inhibits cardiomyocyte apoptosis in CVB3-induced myocarditis via a3b4-nAChR/PI3K/Akt dependent survivin upregulation, Oxid. Med. Cell Longev. (2019) 9496419. [14] D.R. Davis, E. Kizana, J. Terrovitis, et al., Isolation and expansion of functionally-competent cardiac progenitor cells directly from heart biopsies, J. Mol. Cell. Cardiol. 49 (2010) 312e321. [15] S. Du, Q.P. Yao, Protective effect of tanshinone IIA against radiation-induced ototoxicity in HEI-OC1 cells, Oncol. Lett. 6 (2013) 901e906. [16] H. Nirmala, Z. Peiyong, J. Sadoshima, Oxidative stress stimulates autophagic flux during ischemia reperfusion, antioxid redox signal 14 (2011) 2179e2190. [17] Q.H. Li, X. Yin, C. Yu, et al., Ginsenoside Rg1 protects cardiomyocytes against hypoxia/reoxygenation injury via activation of Nrf2/HO-1 signaling and inhibition of JNK, Cell. Physiol. Biochem. 44 (2017) 21e37. [18] M.W. Abdalla, M. Sahar, El-Gowilly, et al., Nicotine improves survivability, hypotension, and impaired adenosinergic renal vasodilations in endotoxic rats: role of a7-nAChRs/HO-1 pathway, Shock 10 (2019) 1097. [19] P.B. Morris, B.A. Ference, E. Jahangir, et al., Cardiovascular effects of exposure to cigarette smoke and electronic cigarettes: clinical perspectives from the prevention of cardiovascular disease section leadership council and early career councils of the american college of cardiology, J. Am. Coll. Cardiol. 66 (2016) 1378e1391. [20] U.S. Department of Health and Human Services, How Tobacco Smoke Causes Disease: the Biology and Behavioral Basis for Smoking-Attributable Disease, 2010. [21] A. Csordas, D. Bernhard, The biology behind the atherothrombotic effects of cigarette smoke, Nat. Rev. Cardiol. 10 (2013) 219e230. [22] R.S. Barua, J.A. Ambrose, Mechanisms of coronary thrombosis in cigarette smoke exposure, Arterioscler Thromb. Vasc. Biol. 33 (2013) 1460e1467. [23] L. Neal, D. Andrea Benowitz, et al., Cardiovascular toxicity of nicotine: implications for electronic cigarette use, Science Direct 26 (2016) 515e523. [24] K. Jensen, D. Nizamutdinov, M. Guerrier, et al., General mechanisms of nicotine-induced fibrogenesis, FASEB J. 26 (2016) 4778e4787. [25] J.H. Berlo, M. Maillet, J.D. Molkentin, Signaling effectors underlying pathologic growth and remodeling of the heart, J. Clin. Investig. 123 (2013) 37e45. [26] Nicotine and health, Drug Ther. Bull. 52 (2014) 78e81. [27] L.Q. He, X.X. Tian, C.H. Yan, et al., Nicotine promotes the differentiation of C2C12 myoblasts and improves skeletal muscle regeneration in obese mice, Biochem. Biophys. Res. Commun. 511 (2019) 731e745. [28] J. Suzuki, E. Bayna, E.D. Molle, et al., Nicotine inhibits cardiac apoptosis induced by lipopolysaccharide in rats, J. Am. Coll. Cardiol. 41 (2003) 735e1097. [29] A. Agarwal, H.S. Nick, Renal response to tissue injury: lessons from heme oxygenase-1 GeneAblation and expression, J. Am. Soc. Nephrol. 11 (2000) 965e973. [30] R. Surolia, S. Karki, H. Kim, et al., Heme oxygenase-1- mediated autophagy protects against pulmonary endothelial cell death and development of emphysema in cadmium-treated mice, Am. J. Physiol. Lung Cell Mol. Physiol. 309 (2015) 280e292. [31] D. Xu, L. Chen, X. Chen, et al., The triterpenoid CDDO-imidazolide ameliorates mouse liver ischemia-reperfusion injury through activating the Nrf2/HO-1 pathway enhanced autophagy, Cell Death Dis. 8 (2017) 2983. [32] C. Dong, H. Zheng, S. Huang, et al., Heme oxygenase-1 enhances autophagy in podocytes as a protective mechanism against high glucose-induced apoptosis, Exp. Cell Res. 337 (2015) 146e159.
Please cite this article as: R. Xing et al., Low-dose nicotine promotes autophagy of cardiomyocytes by upregulating HO-1 expression, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.11.086