- Email: [email protected]
Low-Intensity Pulsed Ultrasound Inhibits Messenger RNA Expression of Matrix Metalloproteinase-13 Induced by Interleukin-1β in Chondrocytes in an Intensity-Dependent Manner
Ultrasound in Med. & Biol., Vol. 38, No. 10, pp. 1726–1733, 2012 Copyright Ó 2012 World Federation for Ultrasound in Medicine & Biology Printed in the USA. All rights reserved 0301-5629/$ - see front matter
http://dx.doi.org/10.1016/j.ultrasmedbio.2012.06.005
Original Contribution
d
LOW-INTENSITY PULSED ULTRASOUND INHIBITS MESSENGER RNA EXPRESSION OF MATRIX METALLOPROTEINASE-13 INDUCED BY INTERLEUKIN-1b IN CHONDROCYTES IN AN INTENSITY-DEPENDENT MANNER AKIRA ITO,* TOMOKI AOYAMA,y SHOKI YAMAGUCHI,* XIANGKAI ZHANG,* HARUHIKO AKIYAMA,z and HIROSHI KUROKI* y
* Motor Function Analysis, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan; Development and Rehabilitation of Motor Function, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan; and z Department of Orthopaedic Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan (Received 20 January 2012; revised 12 April 2012; in final form 13 June 2012)
Abstract—The effect of low-intensity pulsed ultrasound (LIPUS) on articular cartilage metabolism has been characterized. However, the effect of LIPUS intensity on articular cartilage degradation factors remains unknown. This study aimed to investigate the immediate effect of LIPUS at several intensities on cultured chondrocytes treated with interleukin-1b (IL-1b) to induce an inflammatory response and on articular cartilage explants. Cultured chondrocytes and articular cartilage explants were treated by LIPUS at intensities of 0, 7.5, 30 and 120 mW/cm2 or 0, 27 and 67 mW/cm2, respectively. mRNA analysis revealed that LIPUS inhibited induction of MMP13 mRNA expression by 100 pg/mL IL-1b in cultured chondrocytes in an intensity-dependent manner. LIPUS also inhibited MMP13 and MMP1 mRNA expression in articular cartilage explants. Our results indicate that LIPUS may potentially protect articular cartilage by inhibiting MMP mRNA expression in an intensity-dependent manner and should thus be considered a useful candidate for daily treatment of OA. (E-mail: [email protected]. kyoto-u.ac.jp) Ó 2012 World Federation for Ultrasound in Medicine & Biology. Key Words: Low-intensity pulsed ultrasound, Chondrocyte, Gene expression, Matrix metalloproteinases.
of ECM metabolism is thought to collapse due to excessive mechanical stress or aging changes, resulting in increasing articular cartilage degeneration (Goldring and Goldring 2007). Mechanical stimulus is thought to be one of the important factors regulating chondrocyte metabolism (Sun 2010). Excessive mechanical stimulus has been reported to destroy articular cartilage directly and also induce other destructive factors (Fujisawa et al. 1999). Conversely, insufficient mechanical stimulus, such as that due to joint immobilization, has also been associated with cartilage destruction (Leong et al. 2010). On the other hand, moderate (physiological) mechanical stimulus has been confirmed not only to promote articular cartilage anabolism (Smith et al. 2011) but also to inhibit catabolism (Sun and Yokota 2002; Torzilli et al. 2010; Trindade et al. 2004; Yokota et al. 2003). These effects have been confirmed in fibrochondrocytes (Agarwal et al. 2001), tenocytes (Sun et al. 2008), synovial cells (Sun and Yokota 2001), menisci (McNulty et al. 2010)
INTRODUCTION Osteoarthritis (OA) is a highly prevalent degenerative disease characterized by progressive joint destruction. Although many treatment approaches for various aspects of OA have been studied (Hunziker 2002), there remains no established effective treatment. Therefore, further elucidation of the precise pathologic mechanism of OA and determination of the most effective treatment approach are still needed. Although the precise pathologic mechanism of OA has not yet been defined, changes in chondrocyte function, particularly in the balance between the anabolism and the catabolism of the extracellular matrix (ECM) produced by the chondrocytes, are thought to be the main cause of pathology. The balance
Address correspondence to: Hiroshi Kuroki, Motor Function Analysis, Human Health Sciences, Graduate School of Medicine, Kyoto University, 53 Shogoin-Kawahara-cho, Sakyo-ku, Kyoto 606-8507, Japan. E-mail: [email protected] 1726
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al.
and others, as well as in chondrocytes, in in vitro studies, indicating that appropriate mechanical stimuli are essential for living tissues. While various mechanical stimuli can be readily applied to cultured chondrocytes, it can be difficult to replicate these mechanical inputs in human or animal joints, complicating their clinical use. Low-intensity pulsed ultrasound (LIPUS) is one promising approach to overcome these difficulties. LIPUS promotes tissue healing by very low-intensity (,0.1 W/cm2) ultrasound stimulation (Khanna et al. 2009) and has been used clinically to facilitate fracture repair (Heckman et al. 1994; Watanabe et al. 2010). Although its precise mechanism of action has not yet been elucidated, the acoustic pressure waves produced by LIPUS can be considered to be high-frequency micromechanical perturbations that may have a direct mechanical effect on exposed cells (Vaughan et al. 2010). While the effects of LIPUS on articular cartilage have been studied, these reports were mainly concerned with anabolic processes such as synthesis of type 2 collagen and aggrecan (Korstjens et al. 2008; Min et al. 2006; Mukai et al. 2005; Naito et al. 2010; Parvizi et al. 1999; Zhang et al. 2003). The effects of LIPUS on catabolic processes have not been described. Secretion of proteolytic enzymes by the cartilage has been confirmed to contribute to the loss of extracellular matrix in OA. Matrix metalloproteinases (MMPs), which are capable of degrading the macromolecules of connective tissue matrices, have been considered the major proteases responsible for the pathologic destruction of tissue (Blain 2007; Mott and Werb 2004). Moreover, an imbalance between MMPs and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs), is responsible for the pathogenic sequence of cartilage degradation (Dean et al. 1989; Kafienah et al. 2003). Therefore, treatment modalities targeting MMPs are thought to be potentially effective for OA treatment. Choi et al. (2006) reported that LIPUS stimulation of normal human chondrocytes for 10 min per day over 7 days showed no effect on the expression of TIMP1 but inhibited expression of MMP1. However, Millward-Sadler et al. (2000) indicated that moderate mechanical stimulus had no inhibitory effect on the expression of MMP3 by chondrocytes derived from OA articular cartilage and concluded that abnormalities in mechanotransduction leading to aberrant chondrocyte activity in diseased articular cartilage may be important in the progression of OA. The effect of LIPUS on MMP expression in disease model cells or tissues is, therefore, thought to be of interest. Park et al. (2007) reported that LIPUS inhibited the expression of MMP1 in chondrocytes cultured with the addition of interleukin-1b (IL-1b) to induce an inflammatory response. Furthermore, Gurkan et al.
1727
(2010) confirmed that LIPUS exhibited an inhibitory effect on MMP13 expression and attenuated the progression of cartilage degeneration in a guinea pig model of idiopathic human OA. These results suggested that the mechanical stimulus induced by LIPUS may inhibit articular cartilage degradation. However, the immediate inhibitory effect of LIPUS on articular cartilage degradation factors, the most effective intensity of LIPUS, and the effect of LIPUS on other levels of inflammatory symptoms remain unknown. The purpose of this study was to investigate the immediate effect of LIPUS used at several intensities on chondrocytes treated with IL-1b to induce an inflammatory response and to reveal the effect of LIPUS on articular cartilage explants. MATERIALS AND METHODS Chondrocyte isolation Rat chondrocytes were isolated for study in vitro. All procedures were approved by the Institutional Animal Care and Use Committee of Kyoto University. Articular cartilage was aseptically harvested from the left and right knee joints of 12-week-old Wistar rats. Chondrocytes were isolated by digestion with 4 mg/mL collagenase (Wako Pure Chemical Industries, Osaka, Japan) in Dulbecco’s modified eagle medium/Ham’s F12 (DMEM/Ham’s F12; Nacalai Tesque, Inc., Kyoto, Japan) for 16 h at 37 C. The cells were passed through a Cell Strainer (BD Biosciences, Bedford, MA, USA) to remove any undigested extracellular matrix, pelleted by centrifugation at 250 3 g for 3 min, resuspended in fresh medium (DMEM/Ham’s F12 with 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA), 50 U/mL penicillin (Nacalai Tesque, Inc.) and 50 mg/mL streptomycin (Nacalai Tesque, Inc.) and seeded in tissue culture dishes. The chondrocytes were expanded in culture in a CO2 incubator (5% CO2, 37 C, 95% humidity) to obtain sufficient numbers of cells (3–4 passages) and then subcultured into 6-well culture dishes at 4 3 105 cells/well and grown to 80%–90% confluence before use. To investigate the effect of LIPUS on chondrocytes under inflammatory conditions, we analyzed the effect of LIPUS on chondrocytes treated with or without recombinant human IL-1b (PeproTech, Rocky Hill, NJ, USA), a proinflammatory cytokine. Furthermore, to clarify the effect of inflammatory intensity, two different concentrations of IL-1b (100 pg/mL and 1 ng/mL) were used. To eliminate the influence of the IL-1b from the serum in the culture medium, the medium was replaced with serum-free culture medium 20 h before LIPUS stimulation. Finally, the culture medium was replaced with fresh serum-free medium or serum-free medium containing IL-1b (100 pg/mL or 1 ng/mL) just before LIPUS stimulation.
1728
Ultrasound in Medicine and Biology
Articular cartilage explant isolation To mimic the in vivo conditions as closely as possible, an ex vivo explant model, in which the chondrocytes reside within their natural environment surrounded by their own matrix, was employed. Five legs from 6-mo-old pigs were purchased from a meat processor (Aotachikusan, Kyoto, Japan). Twelve 6-mm articular cartilage plugs with subchondral bone were taken from five femoral lateral condyles each by biopsy punch. The viability of the cells obtained from these articular cartilage plugs by the collagenase treatment described above was confirmed to be .95% by trypan blue exclusion. Once obtained, the explants were cultured in culture medium (DMEM/Ham’s F12, 10% FBS, 50 U/mL penicillin, 50 mg/mL streptomycin) in the CO2 incubator (5% CO2, 37 C, 95% humidity) for 1 d to ensure that they remained sterile after harvest. LIPUS stimulation The sonic accelerated fracture healing system device (SAFHS; Teijin Institute for Biomedical Engineering, Tokyo, Japan) was used for ultrasonic stimulation of the cultured chondrocytes with the following technical specifications: 20 min stimulation at a frequency of 1.5 MHz with 200-ms-burst sine waves repeated at 1.0 kHz, based on the setup used clinically. To analyze the effect of varying LIPUS intensity, intensities of 0 (sham stimulation), 7.5, 30 and 120 mW/cm2 (spatial- and temporalaverage, SATA) (n 5 6 each) were used. The LIPUS probe was placed in a water tank thermostatically controlled at 37 C and fixed the culture dish on the special rack. The culture dish was dipped to the culture dish bottom with sterile water and the LIPUS stimulus was performed from the bottom of the culture dish through sterile water. Moreover, to eliminate multiple reflections from the air-media interface, the ultrasoundabsorbing material made with silicon was attached onto the surface of the culture media. First, to investigate the duration of the LIPUS effect, messenger RNA (mRNA) expression analysis was performed after incubation for 1 h or 3 h after LIPUS stimulation for 20 min at 30 mW/cm2 intensity. Based on the results of this assay, the mRNA analysis was performed after incubation for 1 h in subsequent experiments. The OSTEOTRON3 (Ito Physiotherapy & Rehabilitation, Tokyo, Japan) was used for ultrasonic stimulation of the explants with the following technical specifications: 1 h stimulation at a frequency of 1.0 MHz with 200-ms-burst sine waves repeated at 1.0 kHz. This device was used intensities of 0 (sham stimulation), 27 (minimum intensity of this device) and 67 (maximum intensity of this device) mW/cm2. The 12 explant plugs obtained from five pigs of each were divided into three groups, which consisted of every
Volume 38, Number 10, 2012
four plugs per group. The explant plugs were placed on 35-mm diameter culture dishes containing 2 mL of culture medium, with the articular surface toward the dish bottom and LIPUS stimulation was performed at each intensity via coupling gel. After stimulation for 1 h, total RNA was extracted and mRNA expression analysis performed. Total RNA extraction and real-time RT-PCR Total RNA was extracted from cultured chondrocytes using the RNeasy Mini Kit according to the manufacturer’s protocol (Qiagen Inc., Valencia, CA, USA) and purified by RNase-free DNase on-column incubation. Total RNA was extracted from the articular cartilage explants using the RiboPure Kit according to the manufacturer’s protocol (Ambion Inc., Austin, TX, USA). Extracted total RNA was dissolved in diethylpyrocarbonate (DEPC)-treated water, tested for purity using the NanoDrop2000 (Thermo Scientific, Wilmington, DE, USA), and then stored at 280 C until use. Reverse transcription-polymerase chain reaction (RT-PCR) was performed using the ReverTra Ace qPCR RT Kit according to the manufacturer’s protocol (Toyobo CO., LTD., Osaka, Japan). Total RNA (1 mg) was reverse-transcribed for 15 min at 37 C to synthesize complementary DNA (cDNA), followed by incubation at 98 C for 5 min to deactivate the enzymes. The RT-PCR products were stored at 230 C. For quantitative analysis of the effects of LIPUS on chondrocytes at the mRNA level, real-time PCR was performed using the Applied Biosystems7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). cDNA templates (1 mL) were amplified with PowerSYBR Green PCR Master Mix (Applied Biosystems) in 25-mL reactions containing 13 PowerSYBR Green PCR Master Mix, 0.2 mM each genespecific primer (Table 1) and de-ionized water. The mixture was initially heated to 95 C for 10 min, followed by 40 cycles of denaturation at 95 C for 15 s and annealing and extension at 60 C for 60 s. Following amplification, melt curve protocols were performed to ensure that any primer-dimers or non-specific products had been eliminated or minimized. The following target genes were examined: matrix metalloproteinase-13 (MMP13) and matrix metalloproteinase-1 (MMP1), which are cartilage-destroying factors, and tissue inhibitor of metalloproteinase-1 (TIMP1) and tissue inhibitor of metalloproteinase-2 (TIMP2), which are MMPinhibitory factors. Beta-actin was used as a housekeeping gene control. The data obtained by real-time PCR were analyzed by the comparative threshold cycle method. Briefly, the amount of target was normalized to that of beta-actin, the value of a calibration sample (LIPUS intensity
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al.
1729
Table 1. Primer sequences for real-time RT-PCR Sense (50 –30 ) Rat MMP13 Beta-actin Pig MMP13 MMP1 TIMP1 TIMP2 Beta-actin
Antisense (50 –30 )
Length (bp)
CTGACCTGGGATTTCCAAAA TTGCTGACAGGATGCAGAAG
ACACGTGGTTCCCTGAGAAG ACATCTGCTGGAAGGTGGAC
96 141
NM_133530 NM_031144
CACCCGTGACCTTATCTTCATC GCCAAATGGACTTCAAGCTG ACCACCTGCAGTTTTGTGG GAACGACATCTACGGCAACC AAGCCAACCGTGAGAAGATG
GCTGCGCTTATCCTTTTAACC AGCCAAAGGATCTGTGGATG AGTTTGCAGGGGATGGATG TTCTTTCCTCCGATGTCCAG TCCATCACGATGCCAGTG
132 137 134 150 124
XM_003129808 NM_001166229 NM_213857 NM_001145985 DQ452569
Accession no.
MMP 5 matrix metalloproteinase; TIMP 5 tissue inhibitor of metalloproteinase.
0 mW/cm2, without IL-1b) was set to 1 and the values for each of the other conditions were shown relative to that of the calibration sample. Statistical analysis All data were expressed as means 6 standard deviation (SD). Statistical significance was determined using one-way analysis of variance (ANOVA) with the post hoc multiple comparison Tukey’s test. The differences observed were considered to be significant when the p value was lower than 0.05. RESULTS Attenuation of IL-1b-induced MMP13 expression is observed 1 h after LIPUS treatment First, the mRNA expression of MMP13 in cultured chondrocytes after LIPUS stimulation for 20 min at an intensity of 30 mW/cm2 was analyzed over time. MMP13 mRNA expression induced by IL-1b (100 pg/mL) was significantly inhibited by LIPUS stimulation relative to sham stimulation (0 mW/cm2) 1 h (p , 0.01) but not 3 h after stimulation (Fig. 1a and b). Based on this result, mRNA expression was analyzed
a
1 h after LIPUS stimulation in subsequent experiments. The upregulation of MMP13 mRNA expression itself was not observed when 10 pg/mL IL-1b was added to the same experimental system (data not shown). LIPUS inhibits IL-1b-induced MMP13 mRNA expression in cultured chondrocytes in an intensitydependent manner In the absence of IL-1b, LIPUS treatment at 7.5 mW/cm2 slightly inhibited (p , 0.05) and treatment at 120 mW/cm2 strongly inhibited (p , 0.01) MMP13 mRNA expression compared with stimulation at other intensities (Fig. 2a). TIMP1 mRNA expression was upregulated only by stimulation at an intensity of 30 mW/cm2 compared with sham stimulation (p , 0.05) and TIMP2 mRNA expression was not changed significantly by treatment at any intensity (Fig. 3a and c). When the chondrocytes were treated with IL-1b at a concentration of 100 pg/mL, LIPUS stimulation inhibited MMP13 mRNA expression in an intensity-dependent manner (p , 0.01) (Fig. 2b) but TIMP1 and TIMP2 mRNA expression levels were not significantly affected (Fig. 3b and d). However, when the chondrocytes were treated with IL-1b at
b
Fig. 1. Matrix metalloproteinase (MMP)13 mRNA expression in rat chondrocytes (a) 1 h and (b) 3 h after low-intensity pulsed ultrasound (LIPUS) stimulation at an intensity of 30 mW/cm2 for 20 min. The induction of MMP13 mRNA expression by 100 pg/mL interleukin-1b (IL-1b) was attenuated 1 h after LIPUS stimulation. Values are the means and standard deviations (SD) of assays performed in triplicate. The experiment was performed twice and 1 representative experiment is shown. **Significantly (p , 0.01) different from sham stimulation of IL-1b-treated chondrocytes.
1730
Ultrasound in Medicine and Biology
a
b
Fig. 2. Matrix metalloproteinase (MMP)13 mRNA expression in rat chondrocytes cultured (a) without IL-1b and (b) with IL-1b (100 pg/mL) 1 h after low-intensity pulsed ultrasound (LIPUS) stimulation at several intensities. MMP13 mRNA expression was inhibited by LIPUS stimulation in an intensity-dependent manner. Values are the means and standard deviations (SD) of six independent experiments. *p , 0.05; **p , 0.01.
a concentration of 1 ng/mL, no significant differences the expression levels of these genes were observed after LIPUS stimulation at any intensity (data not shown). LIPUS inhibits MMP mRNA expression in articular cartilage explants MMP13 mRNA expression was inhibited by LIPUS stimulation at intensities of both 27 mW/cm2 and 67 mW/cm2 compared with sham stimulation (p , 0.01) (Fig. 4a). MMP1 mRNA expression was also inhibited by stimulation at 67 mW/cm2 (p , 0.01) but not 27 mW/cm2 compared with sham stimulation (Fig. 4b). TIMP1 mRNA expression was inhibited by stimulation at 67 mW/cm2 (p , 0.01) but not 27 mW/cm2 (Fig. 4c), while TIMP2 mRNA expression was not affected by LIPUS stimulation (Fig. 4d). DISCUSSION To elucidate whether mechanical stimulation by LIPUS is chondrocyte-protective, we studied the effect of LIPUS at several intensities on mRNA expression of MMPs and TIMPs. The effects of mechanical stimulus by hydro-
Volume 38, Number 10, 2012
static pressure or shearing force on chondrocyte metabolism have been frequently studied. Fujisawa et al. (1999) reported that a cyclic mechanical load induced expression of the MMP2 and MMP9 genes in primary rabbit costal chondrocytes and Honda et al. (2000) reported that high-magnitude cyclic tensile load increased the mRNA levels of MMP1, MMP3, MMP9, and TIMP1 in cultured rabbit knee articular cartilage chondrocytes. Moderate mechanical stimulation has been shown to have the potential to inhibit induction of MMP expression by the inflammatory response. Leong et al. (2011) reported that moderate (2.5-MPa) intermittent hydrostatic pressure suppressed basal MMP1 expression, whereas high (10-MPa) intermittent hydrostatic pressure increased MMP1 expression. The upregulation of MMPs caused by joint immobilization has also been reported to be suppressed by continuous passive motion (Ferretti et al. 2006). Therefore, moderate mechanical stimulation maintains the integrity of articular cartilage, while both disuse and overuse can result in cartilage degradation. However, it has been unclear whether LIPUS stimulation has the same ability as these moderate mechanical stimuli to protect cartilage. Our results suggested that LIPUS stimulation inhibits mRNA expression of MMP13 and MMP1. Furthermore, the inhibitory effect increased with increasing intensity of LIPUS stimulation. In the current study, it appears possible that MMP expression could be inhibited more strongly by a LIPUS intensity higher than the maximum of 120 mW/cm2 used. To determine the optimal intensity of LIPUS for OA treatment, more precise studies using stronger intensities should be performed. Vaughan et al. (2010), however, reported that LIPUS at intensities greater than 200 mW/cm2 resulted in cell death, although stimulation at 100 mW/cm2 intensity did not cause cell death in vitro. In the current study, .95% cell viability was confirmed in the chondrocytes stimulated by LIPUS at 120 mW/cm2 (data not shown). Although modeling studies suggest that the exposure of knee joints to ultrasound at an intensity of 30 mW/cm2 is likely to result in a tissue level intensity of only 10 mW/cm2 (White et al. 2007), 120 mW/cm2 may be the maximum intensity that can be considered safe. For clinical applications, the duration for which a mechanical stimulus inhibits MMP activity is an important matter. Deschner et al. (2006) reported that the inhibitory effects on MMP13 mRNA expression in fibrocartilage subjected to 20% dynamic tensile stress for 8 h were recognizable until 36 h post-treatment. The inhibitory effects of LIPUS stimulation on MMP13 mRNA expression in our preliminary experiment were no longer detectable after 1 h. However, in that experiment we studied only the duration of effect of LIPUS stimulation at 30 mW/cm2 for 20 min. To determine how long the inhibitory effect of LIPUS on MMP expression can last, it will be necessary to test the effects of stimulation at much higher intensities and/or for longer durations.
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al.
a
b
c
d
1731
Fig. 3. Tissue inhibitor of metalloproteinase (TIMP)1 mRNA expression in rat chondrocytes cultured (a) without IL-1b and (b) with IL-1b (100 pg/mL) and TIMP2 mRNA expression in rat chondrocytes cultured (c) without IL-1b and (d) with IL-1b (100 pg/mL) 1 h after LIPUS stimulation at several intensities. In the absence of IL-1b, TIMP1 mRNA expression was upregulated by low-intensity pulsed ultrasound (LIPUS) stimulation only at an intensity of 30 mW/cm2. TIMP2 mRNA expression was not significantly affected by LIPUS stimulation. Values are the means and standard deviations (SD) of six independent experiments. *p , 0.05.
The inhibitory effect of LIPUS on MMP13 expression in our experiments was more obvious when IL-1b was used to induce an inflammatory response. This finding is consistent with the fact that LIPUS was effective in the treatment of fracture non-unions (Azuma et al. 2001) but has been shown to have no capability to increase bone mass in osteoporosis in the absence of an injury response (Leung et al. 2004). Therefore, mechanical stimulation by LIPUS is thought to be effective possibly only in the context of injury or inflammation, although the precise mechanism of this restriction is unclear. The inhibitory effect of LIPUS on MMP expression in the articular cartilage explants shown in this study may be due to the response to the injury caused by the articular cartilage plug processing. The mechanism of the effect of the LIPUS stimulation on gene expression is yet to be elucidated. Studies showed that the LIPUS signal might be mediated via canonical mechanoreceptors of stretch-activated channels (SACs) and integrins and subsequently through c-Jun N-terminal kinase (JNK) and extracellular signalregulated kinase (ERK) pathways (Choi et al. 2007) or integrin/phosphatidylinositol 3-OH kinase (PI3K)/Akt pathway rather than the integrin/MAPK pathway (Takeuchi et al. 2008). Recently, Li et al. (2011) reported that LIPUS could delay the articular cartilage degenera-
tion, at least in part, by decreasing the expression of MMP13 and suppression of ERK1/2, p38 signaling. It was speculated that MMP13 mRNA inhibition by intensity-dependent LIPUS stimulation observed in our experiment might be also related to the suppression of ERK1/2 and p38 signaling, although we did not confirm that in the current study. The effect of LIPUS on TIMP1 expression differed between the experiments in cultured chondrocytes and articular cartilage plugs. TIMP1 mRNA expression was inhibited significantly by LIPUS stimulation of articular cartilage explants at 67 mW/cm2 (Fig. 4c) but upregulated by stimulation of cultured chondrocytes at 30 mW/cm2 (Fig. 3a). We assume that the discrepancy between the in vitro and ex vivo results was due to the presence of the extracellular matrix in the explants, and the different sources of cells may have had some influence as well. There is also disagreement in the field about the influences of various mechanical stimuli on TIMP expression. Therefore, more detailed investigation is required. The concentration of IL-1b in the knee joints of human OA patients has been reported to range from several pg/ml to tens of pg/ml, and the exact concentration remains uncertain (Rutgers et al. 2010). Regardless, all of these previous studies found lower concentrations of IL-1b than used in our experiments. LIPUS should
1732
Ultrasound in Medicine and Biology
Volume 38, Number 10, 2012
a
b
c
d
Fig. 4. mRNA expression levels in pig articular cartilage explants of (a) matrix metalloproteinase (MMP)13, (b) MMP1, (c) tissue inhibitor of metalloproteinase (TIMP)1 and (d) TIMP2 1 h after low-intensity pulsed ultrasound (LIPUS) stimulation at several intensities. MMP13 mRNA expression was inhibited by LIPUS at 27 or 67 mW/cm2 compared with sham stimulation. Expression of MMP1 and TIMP1 mRNA was inhibited only at an intensity of 67 mW/cm2. TIMP2 mRNA expression was not significantly affected by LIPUS stimulation. Values are the means and SD (n 5 5 pigs/group). *p , 0.05; **p , 0.01.
be applicable for OA patients, as it had a significant inhibitory effect on MMP expression in the presence of 100 pg/ml although not 1 ng/ml IL-1b. To date, cryotherapy and steroid administration have been used as anti-inflammatory therapies for OA but these treatments have been suggested possibly to cause chondrocyte deterioration (Kocaoglu et al. 2011). In contrast, LIPUS is noninvasive, evidently safe and very easy to use; it can, therefore, be used to treat patients anywhere at any time. There are limitations in our study. First, using two different species in the monolayer culture and explant studies made direct comparison of effects in two- dimensional (2-D) and three-dimensional (3-D) systems difficult. However, it is remarkable that MMP13 mRNA expression was inhibited in both systems. Second, we could not specify the optimum LIPUS intensity and irradiation time, although we suggested the existence of the LIPUS intensitydependence on the MMP13 mRNA inhibition in our study. We need to clarify the threshold value of the LIPUS effect. CONCLUSIONS In conclusion, our results suggest that LIPUS inhibits the induction of MMP13 mRNA expression induced by IL-1b in chondrocytes in an intensity-
dependent manner. LIPUS has already been used clinically for bone fracture treatment and, given its safety and simplicity, should be considered an important candidate for daily treatment of OA. Acknowledgments—This study was supported in part from the grant of TEIJIN PHARMA LIMITED, FURUNO ELECTRIC CO., LTD and Grant-in-Aid for Scientific Research in Japan. The authors appreciate the valuable advice given by Tetsuya Takakuwa, Makoto Ishibashi, Michiko Ueda (Kyoto University, Kyoto), Mikiko Kobayashi-Miura (Shimane University, Shimane) and Hiroto Mitsui (Nagoya City University, Nagoya). The authors also wish to thank Rune Fujioka and Ryota Takaishi (Kyoto University, Kyoto) for their continuous support.
REFERENCES Agarwal S, Long P, Gassner R, Piesco NP, Buckley MJ. Cyclic tensile strain suppresses catabolic effects of interleukin-1 beta in fibrochondrocytes from the temporomandibular joint. Arthritis Rheum 2001; 44:608–617. Azuma Y, Ito M, Harada Y, Takagi H, Ohta T, Jingushi S. Low-intensity pulsed ultrasound accelerates rat femoral fracture healing by acting on the various cellular reactions in the fracture callus. J Bone Miner Res 2001;16:671–680. Blain EJ. Mechanical regulation of matrix metalloproteinases. Front Biosci 2007;12:507–527. Choi BH, Woo JI, Min BH, Park SR. Low-intensity ultrasound stimulates the viability and matrix gene expression of human articular chondrocytes in alginate bead culture. J Biomed Mater Res Part A 2006;79A:858–864.
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al. Choi BH, Choi MH, Kwak MG, Min BH, Woo AH, Park SR. Mechanotransduction pathways of low-intensity ultrasound in C-28/I2 human chondrocyte cell line. Proc Inst Mech Eng H 2007;221:527–535. Dean DD, Martelpelletier J, Pelletier JP, Howell DS, Woessner JF. Evidence for metalloproteinase and metalloproteinase inhibitor imbalance in human osteoarthritic cartilage. J Clin Invest 1989;84: 678–685. Deschner J, Rath-Deschner B, Agarwal S. Regulation of matrix metalloproteinase expression by dynamic tensile strain in rat fibrochondrocytes. Osteoarthritis Cartilage 2006;14:264–272. Ferretti M, Gassner R, Wang Z, Perera P, Deschner J, Sowa G, Salter RB, Agarwal S. Biomechanical signals suppress proinflammatory responses in cartilage: Early events in experimental antigeninduced arthritis. J Immunol 2006;177:8757–8766. Fujisawa T, Hattori T, Takahashi K, Kuboki T, Yamashita A, Takigawa M. Cyclic mechanical stress induces extracellular matrix degradation in cultured chondrocytes via gene expression of matrix metalloproteinases and interleukin-1. J Biochem 1999;125:966–975. Goldring MB, Goldring SR. Osteoarthritis. J Cell Physiol 2007;213: 626–634. Gurkan I, Ranganathan A, Yang X, Horton WE, Todman M, Huckle J, Pleshko N, Spencer RG. Modification of osteoarthritis in the guinea pig with pulsed low-intensity ultrasound treatment. Osteoarthritis Cartilage 2010;18:724–733. Heckman JD, Ryaby JP, McCabe J, Frey JJ, Kilcoyne RF. Acceleration of tibial fracture-healing by noninvasive, low-intensity pulsed ultrasound. J Bone Joint Surg Am 1994;76:26–34. Honda K, Ohno S, Tanimoto K, Ijuin C, Tanaka N, Doi T, Kato Y, Tanne K. The effects of high magnitude cyclic tensile load on cartilage matrix metabolism in cultured chondrocytes. Eur J Cell Biol 2000;79:601–609. Hunziker EB. Articular cartilage repair: Basic science and clinical progress. A review of the current status and prospects. Osteoarthritis Cartilage 2002;10:432–463. Kafienah W, Al-Fayez F, Hollander AP, Barker MD. Inhibition of cartilage degradation - A combined tissue engineering and gene therapy approach. Arthritis Rheum 2003;48:709–718. Khanna A, Nelmes RTC, Gougoulias N, Maffulli N, Gray J. The effects of LIPUS on soft-tissue healing: A review of literature. Brit Med Bull 2009;89:169–182. Kocaoglu B, Martin J, Wolf B, Karahan M, Amendola A. The effect of irrigation solution at different temperatures on articular cartilage metabolism. Arthroscopy 2011;27:526–531. Korstjens CM, van der Rijt RHH, Albers GHR, Semeins CM, Klein-Nulend J. Low-intensity pulsed ultrasound affects human articular chondrocytes in vitro. Med Biol Eng Comput 2008;46:1263–1270. Leong DJ, Gu XI, Li YH, Lee JY, Laudier DM, Majeska RJ, Schaffler MB, Cardoso L, Sun HB. Matrix metalloproteinase-3 in articular cartilage is upregulated by joint immobilization and suppressed by passive joint motion. Matrix Biol 2010;29:420–426. Leong DJ, Li YH, Gu XI, Sun L, Zhou ZP, Nasser P, Laudier DM, Iqbal J, Majeska RJ, Schaffler MB, Goldring MB, Cardoso L, Zaidi M, Sun HB. Physiological loading of joints prevents cartilage degradation through CITED2. FASEB J 2011;25:182–191. Leung KS, Lee WS, Cheung WH, Qin L. Lack of efficacy of lowintensity pulsed ultrasound on prevention of postmenopausal bone loss evaluated at the distal radius in older Chinese women. Clin Orthop Relat Res 2004;427:234–240. Li X, Li J, Cheng K, Lin Q, Wang D, Zhang H, An H, Gao M, Chen A. Effect of low-intensity pulsed ultrasound on MMP-13 and MAPKs signaling pathway in rabbit knee osteoarthritis. Cell Biochem Biophys 2011;61:427–434. McNulty AL, Estes BT, Wilusz RE, Weinberg JB, Guilak F. Dynamic loading enhances integrative meniscal repair in the presence of interleukin-1. Osteoarthritis Cartilage 2010;18:830–838. Millward-Sadler SJ, Wright MO, Davies LW, Nuki G, Salter DM. Mechanotransduction via integrins and interleukin-4 results in altered aggrecan and matrix metalloproteinase 3 gene expression in normal, but not osteoarthritic, human articular chondrocytes. Arthritis Rheum 2000;43:2091–2099.
1733
Min BH, Woo JI, Cho HS, Choi BH, Park SJ, Choi MJ, Park SR. Effects of low-intensity ultrasound (LIUS) stimulation on human cartilage explants. Scand J Rheumatol 2006;35:305–311. Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases. Curr Opin Cell Biol 2004;16:558–564. Mukai S, Ito H, Nakagawa Y, Akiyama H, Miyamoto M, Nakamura T. Transforming growth factor-b (1) mediates the effects of lowintensity pulsed ultrasound in chondrocytes. Ultrasound Med Biol 2005;31:1713–1721. Naito K, Watari T, Muta T, Furuhata A, Iwase H, Igarashi M, Kurosawa H, Nagaoka I, Kaneko K. Low-intensity pulsed ultrasound (LIPUS) increases the articular cartilage type II collagen in a rat osteoarthritis model. J Orthop Res 2010;28:361–369. Park K, Hoffmeister B, Han DK, Hasty K. Therapeutic ultrasound effects on interleukin-1 beta stimulated cartilage construct in vitro. Ultrasound Med Biol 2007;33:286–295. Parvizi J, Wu CC, Lewallen DG, Greenleaf JF, Bolander ME. Lowintensity ultrasound stimulates proteoglycan synthesis in rat chondrocytes by increasing aggrecan gene expression. J Orthop Res 1999;17:488–494. Rutgers M, Saris DBF, Dhert WJA, Creemers LB. Cytokine profile of autologous conditioned serum for treatment of osteoarthritis, in vitro effects on cartilage metabolism and intra-articular levels after injection. Arthritis Res Ther 2010;12:R114. Smith RL, Lindsey DP, Dhulipala L, Harris AHS, Goodman SB, Maloney WJ. Effects of intermittent hydrostatic pressure and BMP-2 on osteoarthritic human chondrocyte metabolism in vitro. J Orthop Res 2011;29:361–368. Sun HB. Mechanical loading, cartilage degradation, and arthritis. Ann N Y Acad Sci 2010;1211:37–50. Sun HB, Li YH, Fung DT, Majeska RJ, Schaffler MB, Flatow EL. Coordinate regulation of IL-1 beta and MMP-13 in rat tendons following subrupture fatigue damage. Clin Orthop Relat Res 2008; 466:1555–1561. Sun HB, Yokota H. Altered mRNA level of matrix metalloproteinase-13 in MH7A synovial cells under mechanical loading and unloading. Bone 2001;28:399–403. Sun HB, Yokota H. Reduction of cytokine-induced expression and activity of MMP-1 and MMP-13 by mechanical strain in MH7A rheumatoid synovial cells. Matrix Biol 2002;21: 263–270. Takeuchi R, Ryo A, Komitsu N, Mikuni-Takagaki Y, Fukui A, Takagi Y, Shiraishi T, Morishita S, Yamazaki Y, Kumagai K, Aoki I, Saito T. Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: A basic science study. Arthritis Res Ther 2008;10:R77. Torzilli PA, Bhargava M, Park S, Chen CTC. Mechanical load inhibits IL-1 induced matrix degradation in articular cartilage. Osteoarthritis Cartilage 2010;18:97–105. Trindade MCD, Shida J, Ikenoue T, Lee MS, Lin EY, Yaszay B, Yerby S, Goodman SB, Schurman DJ, Smith RL. Intermittent hydrostatic pressure inhibits matrix metalloproteinase and pro-inflammatory mediator release from human osteoarthritic chondrocytes in vitro. Osteoarthritis Cartilage 2004;12:729–735. Vaughan NM, Grainger J, Bader DL, Knight MM. The potential of pulsed low intensity ultrasound to stimulate chondrocytes matrix synthesis in agarose and monolayer cultures. Med Biol Eng Comput 2010;48:1215–1222. Watanabe Y, Matsushita T, Bhandari M, Zdero R, Schemitsch EH. Ultrasound for fracture healing: Current evidence. J Orthop Trauma 2010; 24:S56–S61. White D, Evans JA, Truscott JG, Chivers RA. Can ultrasound propagate in the joint space of a human knee? Ultrasound Med Biol 2007;33: 1104–1111. Yokota H, Goldring MB, Sun HB. CITED2-mediated regulation of MMP-1 and MMP-13 in human chondrocytes under flow shear. J Biol Chem 2003;278:47275–47280. Zhang ZJ, Huckle J, Francomano CA, Spencer RGS. The effects of pulsed low-intensity ultrasound on chondrocyte viability, proliferation, gene expression and matrix production. Ultrasound Med Biol 2003;29:1645–1651.
http://dx.doi.org/10.1016/j.ultrasmedbio.2012.06.005
Original Contribution
d
LOW-INTENSITY PULSED ULTRASOUND INHIBITS MESSENGER RNA EXPRESSION OF MATRIX METALLOPROTEINASE-13 INDUCED BY INTERLEUKIN-1b IN CHONDROCYTES IN AN INTENSITY-DEPENDENT MANNER AKIRA ITO,* TOMOKI AOYAMA,y SHOKI YAMAGUCHI,* XIANGKAI ZHANG,* HARUHIKO AKIYAMA,z and HIROSHI KUROKI* y
* Motor Function Analysis, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan; Development and Rehabilitation of Motor Function, Human Health Sciences, Graduate School of Medicine, Kyoto University, Kyoto, Japan; and z Department of Orthopaedic Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan (Received 20 January 2012; revised 12 April 2012; in final form 13 June 2012)
Abstract—The effect of low-intensity pulsed ultrasound (LIPUS) on articular cartilage metabolism has been characterized. However, the effect of LIPUS intensity on articular cartilage degradation factors remains unknown. This study aimed to investigate the immediate effect of LIPUS at several intensities on cultured chondrocytes treated with interleukin-1b (IL-1b) to induce an inflammatory response and on articular cartilage explants. Cultured chondrocytes and articular cartilage explants were treated by LIPUS at intensities of 0, 7.5, 30 and 120 mW/cm2 or 0, 27 and 67 mW/cm2, respectively. mRNA analysis revealed that LIPUS inhibited induction of MMP13 mRNA expression by 100 pg/mL IL-1b in cultured chondrocytes in an intensity-dependent manner. LIPUS also inhibited MMP13 and MMP1 mRNA expression in articular cartilage explants. Our results indicate that LIPUS may potentially protect articular cartilage by inhibiting MMP mRNA expression in an intensity-dependent manner and should thus be considered a useful candidate for daily treatment of OA. (E-mail: [email protected]. kyoto-u.ac.jp) Ó 2012 World Federation for Ultrasound in Medicine & Biology. Key Words: Low-intensity pulsed ultrasound, Chondrocyte, Gene expression, Matrix metalloproteinases.
of ECM metabolism is thought to collapse due to excessive mechanical stress or aging changes, resulting in increasing articular cartilage degeneration (Goldring and Goldring 2007). Mechanical stimulus is thought to be one of the important factors regulating chondrocyte metabolism (Sun 2010). Excessive mechanical stimulus has been reported to destroy articular cartilage directly and also induce other destructive factors (Fujisawa et al. 1999). Conversely, insufficient mechanical stimulus, such as that due to joint immobilization, has also been associated with cartilage destruction (Leong et al. 2010). On the other hand, moderate (physiological) mechanical stimulus has been confirmed not only to promote articular cartilage anabolism (Smith et al. 2011) but also to inhibit catabolism (Sun and Yokota 2002; Torzilli et al. 2010; Trindade et al. 2004; Yokota et al. 2003). These effects have been confirmed in fibrochondrocytes (Agarwal et al. 2001), tenocytes (Sun et al. 2008), synovial cells (Sun and Yokota 2001), menisci (McNulty et al. 2010)
INTRODUCTION Osteoarthritis (OA) is a highly prevalent degenerative disease characterized by progressive joint destruction. Although many treatment approaches for various aspects of OA have been studied (Hunziker 2002), there remains no established effective treatment. Therefore, further elucidation of the precise pathologic mechanism of OA and determination of the most effective treatment approach are still needed. Although the precise pathologic mechanism of OA has not yet been defined, changes in chondrocyte function, particularly in the balance between the anabolism and the catabolism of the extracellular matrix (ECM) produced by the chondrocytes, are thought to be the main cause of pathology. The balance
Address correspondence to: Hiroshi Kuroki, Motor Function Analysis, Human Health Sciences, Graduate School of Medicine, Kyoto University, 53 Shogoin-Kawahara-cho, Sakyo-ku, Kyoto 606-8507, Japan. E-mail: [email protected] 1726
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al.
and others, as well as in chondrocytes, in in vitro studies, indicating that appropriate mechanical stimuli are essential for living tissues. While various mechanical stimuli can be readily applied to cultured chondrocytes, it can be difficult to replicate these mechanical inputs in human or animal joints, complicating their clinical use. Low-intensity pulsed ultrasound (LIPUS) is one promising approach to overcome these difficulties. LIPUS promotes tissue healing by very low-intensity (,0.1 W/cm2) ultrasound stimulation (Khanna et al. 2009) and has been used clinically to facilitate fracture repair (Heckman et al. 1994; Watanabe et al. 2010). Although its precise mechanism of action has not yet been elucidated, the acoustic pressure waves produced by LIPUS can be considered to be high-frequency micromechanical perturbations that may have a direct mechanical effect on exposed cells (Vaughan et al. 2010). While the effects of LIPUS on articular cartilage have been studied, these reports were mainly concerned with anabolic processes such as synthesis of type 2 collagen and aggrecan (Korstjens et al. 2008; Min et al. 2006; Mukai et al. 2005; Naito et al. 2010; Parvizi et al. 1999; Zhang et al. 2003). The effects of LIPUS on catabolic processes have not been described. Secretion of proteolytic enzymes by the cartilage has been confirmed to contribute to the loss of extracellular matrix in OA. Matrix metalloproteinases (MMPs), which are capable of degrading the macromolecules of connective tissue matrices, have been considered the major proteases responsible for the pathologic destruction of tissue (Blain 2007; Mott and Werb 2004). Moreover, an imbalance between MMPs and their inhibitors, tissue inhibitors of metalloproteinases (TIMPs), is responsible for the pathogenic sequence of cartilage degradation (Dean et al. 1989; Kafienah et al. 2003). Therefore, treatment modalities targeting MMPs are thought to be potentially effective for OA treatment. Choi et al. (2006) reported that LIPUS stimulation of normal human chondrocytes for 10 min per day over 7 days showed no effect on the expression of TIMP1 but inhibited expression of MMP1. However, Millward-Sadler et al. (2000) indicated that moderate mechanical stimulus had no inhibitory effect on the expression of MMP3 by chondrocytes derived from OA articular cartilage and concluded that abnormalities in mechanotransduction leading to aberrant chondrocyte activity in diseased articular cartilage may be important in the progression of OA. The effect of LIPUS on MMP expression in disease model cells or tissues is, therefore, thought to be of interest. Park et al. (2007) reported that LIPUS inhibited the expression of MMP1 in chondrocytes cultured with the addition of interleukin-1b (IL-1b) to induce an inflammatory response. Furthermore, Gurkan et al.
1727
(2010) confirmed that LIPUS exhibited an inhibitory effect on MMP13 expression and attenuated the progression of cartilage degeneration in a guinea pig model of idiopathic human OA. These results suggested that the mechanical stimulus induced by LIPUS may inhibit articular cartilage degradation. However, the immediate inhibitory effect of LIPUS on articular cartilage degradation factors, the most effective intensity of LIPUS, and the effect of LIPUS on other levels of inflammatory symptoms remain unknown. The purpose of this study was to investigate the immediate effect of LIPUS used at several intensities on chondrocytes treated with IL-1b to induce an inflammatory response and to reveal the effect of LIPUS on articular cartilage explants. MATERIALS AND METHODS Chondrocyte isolation Rat chondrocytes were isolated for study in vitro. All procedures were approved by the Institutional Animal Care and Use Committee of Kyoto University. Articular cartilage was aseptically harvested from the left and right knee joints of 12-week-old Wistar rats. Chondrocytes were isolated by digestion with 4 mg/mL collagenase (Wako Pure Chemical Industries, Osaka, Japan) in Dulbecco’s modified eagle medium/Ham’s F12 (DMEM/Ham’s F12; Nacalai Tesque, Inc., Kyoto, Japan) for 16 h at 37 C. The cells were passed through a Cell Strainer (BD Biosciences, Bedford, MA, USA) to remove any undigested extracellular matrix, pelleted by centrifugation at 250 3 g for 3 min, resuspended in fresh medium (DMEM/Ham’s F12 with 10% fetal bovine serum (FBS; Hyclone, Logan, UT, USA), 50 U/mL penicillin (Nacalai Tesque, Inc.) and 50 mg/mL streptomycin (Nacalai Tesque, Inc.) and seeded in tissue culture dishes. The chondrocytes were expanded in culture in a CO2 incubator (5% CO2, 37 C, 95% humidity) to obtain sufficient numbers of cells (3–4 passages) and then subcultured into 6-well culture dishes at 4 3 105 cells/well and grown to 80%–90% confluence before use. To investigate the effect of LIPUS on chondrocytes under inflammatory conditions, we analyzed the effect of LIPUS on chondrocytes treated with or without recombinant human IL-1b (PeproTech, Rocky Hill, NJ, USA), a proinflammatory cytokine. Furthermore, to clarify the effect of inflammatory intensity, two different concentrations of IL-1b (100 pg/mL and 1 ng/mL) were used. To eliminate the influence of the IL-1b from the serum in the culture medium, the medium was replaced with serum-free culture medium 20 h before LIPUS stimulation. Finally, the culture medium was replaced with fresh serum-free medium or serum-free medium containing IL-1b (100 pg/mL or 1 ng/mL) just before LIPUS stimulation.
1728
Ultrasound in Medicine and Biology
Articular cartilage explant isolation To mimic the in vivo conditions as closely as possible, an ex vivo explant model, in which the chondrocytes reside within their natural environment surrounded by their own matrix, was employed. Five legs from 6-mo-old pigs were purchased from a meat processor (Aotachikusan, Kyoto, Japan). Twelve 6-mm articular cartilage plugs with subchondral bone were taken from five femoral lateral condyles each by biopsy punch. The viability of the cells obtained from these articular cartilage plugs by the collagenase treatment described above was confirmed to be .95% by trypan blue exclusion. Once obtained, the explants were cultured in culture medium (DMEM/Ham’s F12, 10% FBS, 50 U/mL penicillin, 50 mg/mL streptomycin) in the CO2 incubator (5% CO2, 37 C, 95% humidity) for 1 d to ensure that they remained sterile after harvest. LIPUS stimulation The sonic accelerated fracture healing system device (SAFHS; Teijin Institute for Biomedical Engineering, Tokyo, Japan) was used for ultrasonic stimulation of the cultured chondrocytes with the following technical specifications: 20 min stimulation at a frequency of 1.5 MHz with 200-ms-burst sine waves repeated at 1.0 kHz, based on the setup used clinically. To analyze the effect of varying LIPUS intensity, intensities of 0 (sham stimulation), 7.5, 30 and 120 mW/cm2 (spatial- and temporalaverage, SATA) (n 5 6 each) were used. The LIPUS probe was placed in a water tank thermostatically controlled at 37 C and fixed the culture dish on the special rack. The culture dish was dipped to the culture dish bottom with sterile water and the LIPUS stimulus was performed from the bottom of the culture dish through sterile water. Moreover, to eliminate multiple reflections from the air-media interface, the ultrasoundabsorbing material made with silicon was attached onto the surface of the culture media. First, to investigate the duration of the LIPUS effect, messenger RNA (mRNA) expression analysis was performed after incubation for 1 h or 3 h after LIPUS stimulation for 20 min at 30 mW/cm2 intensity. Based on the results of this assay, the mRNA analysis was performed after incubation for 1 h in subsequent experiments. The OSTEOTRON3 (Ito Physiotherapy & Rehabilitation, Tokyo, Japan) was used for ultrasonic stimulation of the explants with the following technical specifications: 1 h stimulation at a frequency of 1.0 MHz with 200-ms-burst sine waves repeated at 1.0 kHz. This device was used intensities of 0 (sham stimulation), 27 (minimum intensity of this device) and 67 (maximum intensity of this device) mW/cm2. The 12 explant plugs obtained from five pigs of each were divided into three groups, which consisted of every
Volume 38, Number 10, 2012
four plugs per group. The explant plugs were placed on 35-mm diameter culture dishes containing 2 mL of culture medium, with the articular surface toward the dish bottom and LIPUS stimulation was performed at each intensity via coupling gel. After stimulation for 1 h, total RNA was extracted and mRNA expression analysis performed. Total RNA extraction and real-time RT-PCR Total RNA was extracted from cultured chondrocytes using the RNeasy Mini Kit according to the manufacturer’s protocol (Qiagen Inc., Valencia, CA, USA) and purified by RNase-free DNase on-column incubation. Total RNA was extracted from the articular cartilage explants using the RiboPure Kit according to the manufacturer’s protocol (Ambion Inc., Austin, TX, USA). Extracted total RNA was dissolved in diethylpyrocarbonate (DEPC)-treated water, tested for purity using the NanoDrop2000 (Thermo Scientific, Wilmington, DE, USA), and then stored at 280 C until use. Reverse transcription-polymerase chain reaction (RT-PCR) was performed using the ReverTra Ace qPCR RT Kit according to the manufacturer’s protocol (Toyobo CO., LTD., Osaka, Japan). Total RNA (1 mg) was reverse-transcribed for 15 min at 37 C to synthesize complementary DNA (cDNA), followed by incubation at 98 C for 5 min to deactivate the enzymes. The RT-PCR products were stored at 230 C. For quantitative analysis of the effects of LIPUS on chondrocytes at the mRNA level, real-time PCR was performed using the Applied Biosystems7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). cDNA templates (1 mL) were amplified with PowerSYBR Green PCR Master Mix (Applied Biosystems) in 25-mL reactions containing 13 PowerSYBR Green PCR Master Mix, 0.2 mM each genespecific primer (Table 1) and de-ionized water. The mixture was initially heated to 95 C for 10 min, followed by 40 cycles of denaturation at 95 C for 15 s and annealing and extension at 60 C for 60 s. Following amplification, melt curve protocols were performed to ensure that any primer-dimers or non-specific products had been eliminated or minimized. The following target genes were examined: matrix metalloproteinase-13 (MMP13) and matrix metalloproteinase-1 (MMP1), which are cartilage-destroying factors, and tissue inhibitor of metalloproteinase-1 (TIMP1) and tissue inhibitor of metalloproteinase-2 (TIMP2), which are MMPinhibitory factors. Beta-actin was used as a housekeeping gene control. The data obtained by real-time PCR were analyzed by the comparative threshold cycle method. Briefly, the amount of target was normalized to that of beta-actin, the value of a calibration sample (LIPUS intensity
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al.
1729
Table 1. Primer sequences for real-time RT-PCR Sense (50 –30 ) Rat MMP13 Beta-actin Pig MMP13 MMP1 TIMP1 TIMP2 Beta-actin
Antisense (50 –30 )
Length (bp)
CTGACCTGGGATTTCCAAAA TTGCTGACAGGATGCAGAAG
ACACGTGGTTCCCTGAGAAG ACATCTGCTGGAAGGTGGAC
96 141
NM_133530 NM_031144
CACCCGTGACCTTATCTTCATC GCCAAATGGACTTCAAGCTG ACCACCTGCAGTTTTGTGG GAACGACATCTACGGCAACC AAGCCAACCGTGAGAAGATG
GCTGCGCTTATCCTTTTAACC AGCCAAAGGATCTGTGGATG AGTTTGCAGGGGATGGATG TTCTTTCCTCCGATGTCCAG TCCATCACGATGCCAGTG
132 137 134 150 124
XM_003129808 NM_001166229 NM_213857 NM_001145985 DQ452569
Accession no.
MMP 5 matrix metalloproteinase; TIMP 5 tissue inhibitor of metalloproteinase.
0 mW/cm2, without IL-1b) was set to 1 and the values for each of the other conditions were shown relative to that of the calibration sample. Statistical analysis All data were expressed as means 6 standard deviation (SD). Statistical significance was determined using one-way analysis of variance (ANOVA) with the post hoc multiple comparison Tukey’s test. The differences observed were considered to be significant when the p value was lower than 0.05. RESULTS Attenuation of IL-1b-induced MMP13 expression is observed 1 h after LIPUS treatment First, the mRNA expression of MMP13 in cultured chondrocytes after LIPUS stimulation for 20 min at an intensity of 30 mW/cm2 was analyzed over time. MMP13 mRNA expression induced by IL-1b (100 pg/mL) was significantly inhibited by LIPUS stimulation relative to sham stimulation (0 mW/cm2) 1 h (p , 0.01) but not 3 h after stimulation (Fig. 1a and b). Based on this result, mRNA expression was analyzed
a
1 h after LIPUS stimulation in subsequent experiments. The upregulation of MMP13 mRNA expression itself was not observed when 10 pg/mL IL-1b was added to the same experimental system (data not shown). LIPUS inhibits IL-1b-induced MMP13 mRNA expression in cultured chondrocytes in an intensitydependent manner In the absence of IL-1b, LIPUS treatment at 7.5 mW/cm2 slightly inhibited (p , 0.05) and treatment at 120 mW/cm2 strongly inhibited (p , 0.01) MMP13 mRNA expression compared with stimulation at other intensities (Fig. 2a). TIMP1 mRNA expression was upregulated only by stimulation at an intensity of 30 mW/cm2 compared with sham stimulation (p , 0.05) and TIMP2 mRNA expression was not changed significantly by treatment at any intensity (Fig. 3a and c). When the chondrocytes were treated with IL-1b at a concentration of 100 pg/mL, LIPUS stimulation inhibited MMP13 mRNA expression in an intensity-dependent manner (p , 0.01) (Fig. 2b) but TIMP1 and TIMP2 mRNA expression levels were not significantly affected (Fig. 3b and d). However, when the chondrocytes were treated with IL-1b at
b
Fig. 1. Matrix metalloproteinase (MMP)13 mRNA expression in rat chondrocytes (a) 1 h and (b) 3 h after low-intensity pulsed ultrasound (LIPUS) stimulation at an intensity of 30 mW/cm2 for 20 min. The induction of MMP13 mRNA expression by 100 pg/mL interleukin-1b (IL-1b) was attenuated 1 h after LIPUS stimulation. Values are the means and standard deviations (SD) of assays performed in triplicate. The experiment was performed twice and 1 representative experiment is shown. **Significantly (p , 0.01) different from sham stimulation of IL-1b-treated chondrocytes.
1730
Ultrasound in Medicine and Biology
a
b
Fig. 2. Matrix metalloproteinase (MMP)13 mRNA expression in rat chondrocytes cultured (a) without IL-1b and (b) with IL-1b (100 pg/mL) 1 h after low-intensity pulsed ultrasound (LIPUS) stimulation at several intensities. MMP13 mRNA expression was inhibited by LIPUS stimulation in an intensity-dependent manner. Values are the means and standard deviations (SD) of six independent experiments. *p , 0.05; **p , 0.01.
a concentration of 1 ng/mL, no significant differences the expression levels of these genes were observed after LIPUS stimulation at any intensity (data not shown). LIPUS inhibits MMP mRNA expression in articular cartilage explants MMP13 mRNA expression was inhibited by LIPUS stimulation at intensities of both 27 mW/cm2 and 67 mW/cm2 compared with sham stimulation (p , 0.01) (Fig. 4a). MMP1 mRNA expression was also inhibited by stimulation at 67 mW/cm2 (p , 0.01) but not 27 mW/cm2 compared with sham stimulation (Fig. 4b). TIMP1 mRNA expression was inhibited by stimulation at 67 mW/cm2 (p , 0.01) but not 27 mW/cm2 (Fig. 4c), while TIMP2 mRNA expression was not affected by LIPUS stimulation (Fig. 4d). DISCUSSION To elucidate whether mechanical stimulation by LIPUS is chondrocyte-protective, we studied the effect of LIPUS at several intensities on mRNA expression of MMPs and TIMPs. The effects of mechanical stimulus by hydro-
Volume 38, Number 10, 2012
static pressure or shearing force on chondrocyte metabolism have been frequently studied. Fujisawa et al. (1999) reported that a cyclic mechanical load induced expression of the MMP2 and MMP9 genes in primary rabbit costal chondrocytes and Honda et al. (2000) reported that high-magnitude cyclic tensile load increased the mRNA levels of MMP1, MMP3, MMP9, and TIMP1 in cultured rabbit knee articular cartilage chondrocytes. Moderate mechanical stimulation has been shown to have the potential to inhibit induction of MMP expression by the inflammatory response. Leong et al. (2011) reported that moderate (2.5-MPa) intermittent hydrostatic pressure suppressed basal MMP1 expression, whereas high (10-MPa) intermittent hydrostatic pressure increased MMP1 expression. The upregulation of MMPs caused by joint immobilization has also been reported to be suppressed by continuous passive motion (Ferretti et al. 2006). Therefore, moderate mechanical stimulation maintains the integrity of articular cartilage, while both disuse and overuse can result in cartilage degradation. However, it has been unclear whether LIPUS stimulation has the same ability as these moderate mechanical stimuli to protect cartilage. Our results suggested that LIPUS stimulation inhibits mRNA expression of MMP13 and MMP1. Furthermore, the inhibitory effect increased with increasing intensity of LIPUS stimulation. In the current study, it appears possible that MMP expression could be inhibited more strongly by a LIPUS intensity higher than the maximum of 120 mW/cm2 used. To determine the optimal intensity of LIPUS for OA treatment, more precise studies using stronger intensities should be performed. Vaughan et al. (2010), however, reported that LIPUS at intensities greater than 200 mW/cm2 resulted in cell death, although stimulation at 100 mW/cm2 intensity did not cause cell death in vitro. In the current study, .95% cell viability was confirmed in the chondrocytes stimulated by LIPUS at 120 mW/cm2 (data not shown). Although modeling studies suggest that the exposure of knee joints to ultrasound at an intensity of 30 mW/cm2 is likely to result in a tissue level intensity of only 10 mW/cm2 (White et al. 2007), 120 mW/cm2 may be the maximum intensity that can be considered safe. For clinical applications, the duration for which a mechanical stimulus inhibits MMP activity is an important matter. Deschner et al. (2006) reported that the inhibitory effects on MMP13 mRNA expression in fibrocartilage subjected to 20% dynamic tensile stress for 8 h were recognizable until 36 h post-treatment. The inhibitory effects of LIPUS stimulation on MMP13 mRNA expression in our preliminary experiment were no longer detectable after 1 h. However, in that experiment we studied only the duration of effect of LIPUS stimulation at 30 mW/cm2 for 20 min. To determine how long the inhibitory effect of LIPUS on MMP expression can last, it will be necessary to test the effects of stimulation at much higher intensities and/or for longer durations.
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al.
a
b
c
d
1731
Fig. 3. Tissue inhibitor of metalloproteinase (TIMP)1 mRNA expression in rat chondrocytes cultured (a) without IL-1b and (b) with IL-1b (100 pg/mL) and TIMP2 mRNA expression in rat chondrocytes cultured (c) without IL-1b and (d) with IL-1b (100 pg/mL) 1 h after LIPUS stimulation at several intensities. In the absence of IL-1b, TIMP1 mRNA expression was upregulated by low-intensity pulsed ultrasound (LIPUS) stimulation only at an intensity of 30 mW/cm2. TIMP2 mRNA expression was not significantly affected by LIPUS stimulation. Values are the means and standard deviations (SD) of six independent experiments. *p , 0.05.
The inhibitory effect of LIPUS on MMP13 expression in our experiments was more obvious when IL-1b was used to induce an inflammatory response. This finding is consistent with the fact that LIPUS was effective in the treatment of fracture non-unions (Azuma et al. 2001) but has been shown to have no capability to increase bone mass in osteoporosis in the absence of an injury response (Leung et al. 2004). Therefore, mechanical stimulation by LIPUS is thought to be effective possibly only in the context of injury or inflammation, although the precise mechanism of this restriction is unclear. The inhibitory effect of LIPUS on MMP expression in the articular cartilage explants shown in this study may be due to the response to the injury caused by the articular cartilage plug processing. The mechanism of the effect of the LIPUS stimulation on gene expression is yet to be elucidated. Studies showed that the LIPUS signal might be mediated via canonical mechanoreceptors of stretch-activated channels (SACs) and integrins and subsequently through c-Jun N-terminal kinase (JNK) and extracellular signalregulated kinase (ERK) pathways (Choi et al. 2007) or integrin/phosphatidylinositol 3-OH kinase (PI3K)/Akt pathway rather than the integrin/MAPK pathway (Takeuchi et al. 2008). Recently, Li et al. (2011) reported that LIPUS could delay the articular cartilage degenera-
tion, at least in part, by decreasing the expression of MMP13 and suppression of ERK1/2, p38 signaling. It was speculated that MMP13 mRNA inhibition by intensity-dependent LIPUS stimulation observed in our experiment might be also related to the suppression of ERK1/2 and p38 signaling, although we did not confirm that in the current study. The effect of LIPUS on TIMP1 expression differed between the experiments in cultured chondrocytes and articular cartilage plugs. TIMP1 mRNA expression was inhibited significantly by LIPUS stimulation of articular cartilage explants at 67 mW/cm2 (Fig. 4c) but upregulated by stimulation of cultured chondrocytes at 30 mW/cm2 (Fig. 3a). We assume that the discrepancy between the in vitro and ex vivo results was due to the presence of the extracellular matrix in the explants, and the different sources of cells may have had some influence as well. There is also disagreement in the field about the influences of various mechanical stimuli on TIMP expression. Therefore, more detailed investigation is required. The concentration of IL-1b in the knee joints of human OA patients has been reported to range from several pg/ml to tens of pg/ml, and the exact concentration remains uncertain (Rutgers et al. 2010). Regardless, all of these previous studies found lower concentrations of IL-1b than used in our experiments. LIPUS should
1732
Ultrasound in Medicine and Biology
Volume 38, Number 10, 2012
a
b
c
d
Fig. 4. mRNA expression levels in pig articular cartilage explants of (a) matrix metalloproteinase (MMP)13, (b) MMP1, (c) tissue inhibitor of metalloproteinase (TIMP)1 and (d) TIMP2 1 h after low-intensity pulsed ultrasound (LIPUS) stimulation at several intensities. MMP13 mRNA expression was inhibited by LIPUS at 27 or 67 mW/cm2 compared with sham stimulation. Expression of MMP1 and TIMP1 mRNA was inhibited only at an intensity of 67 mW/cm2. TIMP2 mRNA expression was not significantly affected by LIPUS stimulation. Values are the means and SD (n 5 5 pigs/group). *p , 0.05; **p , 0.01.
be applicable for OA patients, as it had a significant inhibitory effect on MMP expression in the presence of 100 pg/ml although not 1 ng/ml IL-1b. To date, cryotherapy and steroid administration have been used as anti-inflammatory therapies for OA but these treatments have been suggested possibly to cause chondrocyte deterioration (Kocaoglu et al. 2011). In contrast, LIPUS is noninvasive, evidently safe and very easy to use; it can, therefore, be used to treat patients anywhere at any time. There are limitations in our study. First, using two different species in the monolayer culture and explant studies made direct comparison of effects in two- dimensional (2-D) and three-dimensional (3-D) systems difficult. However, it is remarkable that MMP13 mRNA expression was inhibited in both systems. Second, we could not specify the optimum LIPUS intensity and irradiation time, although we suggested the existence of the LIPUS intensitydependence on the MMP13 mRNA inhibition in our study. We need to clarify the threshold value of the LIPUS effect. CONCLUSIONS In conclusion, our results suggest that LIPUS inhibits the induction of MMP13 mRNA expression induced by IL-1b in chondrocytes in an intensity-
dependent manner. LIPUS has already been used clinically for bone fracture treatment and, given its safety and simplicity, should be considered an important candidate for daily treatment of OA. Acknowledgments—This study was supported in part from the grant of TEIJIN PHARMA LIMITED, FURUNO ELECTRIC CO., LTD and Grant-in-Aid for Scientific Research in Japan. The authors appreciate the valuable advice given by Tetsuya Takakuwa, Makoto Ishibashi, Michiko Ueda (Kyoto University, Kyoto), Mikiko Kobayashi-Miura (Shimane University, Shimane) and Hiroto Mitsui (Nagoya City University, Nagoya). The authors also wish to thank Rune Fujioka and Ryota Takaishi (Kyoto University, Kyoto) for their continuous support.
REFERENCES Agarwal S, Long P, Gassner R, Piesco NP, Buckley MJ. Cyclic tensile strain suppresses catabolic effects of interleukin-1 beta in fibrochondrocytes from the temporomandibular joint. Arthritis Rheum 2001; 44:608–617. Azuma Y, Ito M, Harada Y, Takagi H, Ohta T, Jingushi S. Low-intensity pulsed ultrasound accelerates rat femoral fracture healing by acting on the various cellular reactions in the fracture callus. J Bone Miner Res 2001;16:671–680. Blain EJ. Mechanical regulation of matrix metalloproteinases. Front Biosci 2007;12:507–527. Choi BH, Woo JI, Min BH, Park SR. Low-intensity ultrasound stimulates the viability and matrix gene expression of human articular chondrocytes in alginate bead culture. J Biomed Mater Res Part A 2006;79A:858–864.
LIPUS inhibits the induction of MMP13 mRNA expression d A. ITO et al. Choi BH, Choi MH, Kwak MG, Min BH, Woo AH, Park SR. Mechanotransduction pathways of low-intensity ultrasound in C-28/I2 human chondrocyte cell line. Proc Inst Mech Eng H 2007;221:527–535. Dean DD, Martelpelletier J, Pelletier JP, Howell DS, Woessner JF. Evidence for metalloproteinase and metalloproteinase inhibitor imbalance in human osteoarthritic cartilage. J Clin Invest 1989;84: 678–685. Deschner J, Rath-Deschner B, Agarwal S. Regulation of matrix metalloproteinase expression by dynamic tensile strain in rat fibrochondrocytes. Osteoarthritis Cartilage 2006;14:264–272. Ferretti M, Gassner R, Wang Z, Perera P, Deschner J, Sowa G, Salter RB, Agarwal S. Biomechanical signals suppress proinflammatory responses in cartilage: Early events in experimental antigeninduced arthritis. J Immunol 2006;177:8757–8766. Fujisawa T, Hattori T, Takahashi K, Kuboki T, Yamashita A, Takigawa M. Cyclic mechanical stress induces extracellular matrix degradation in cultured chondrocytes via gene expression of matrix metalloproteinases and interleukin-1. J Biochem 1999;125:966–975. Goldring MB, Goldring SR. Osteoarthritis. J Cell Physiol 2007;213: 626–634. Gurkan I, Ranganathan A, Yang X, Horton WE, Todman M, Huckle J, Pleshko N, Spencer RG. Modification of osteoarthritis in the guinea pig with pulsed low-intensity ultrasound treatment. Osteoarthritis Cartilage 2010;18:724–733. Heckman JD, Ryaby JP, McCabe J, Frey JJ, Kilcoyne RF. Acceleration of tibial fracture-healing by noninvasive, low-intensity pulsed ultrasound. J Bone Joint Surg Am 1994;76:26–34. Honda K, Ohno S, Tanimoto K, Ijuin C, Tanaka N, Doi T, Kato Y, Tanne K. The effects of high magnitude cyclic tensile load on cartilage matrix metabolism in cultured chondrocytes. Eur J Cell Biol 2000;79:601–609. Hunziker EB. Articular cartilage repair: Basic science and clinical progress. A review of the current status and prospects. Osteoarthritis Cartilage 2002;10:432–463. Kafienah W, Al-Fayez F, Hollander AP, Barker MD. Inhibition of cartilage degradation - A combined tissue engineering and gene therapy approach. Arthritis Rheum 2003;48:709–718. Khanna A, Nelmes RTC, Gougoulias N, Maffulli N, Gray J. The effects of LIPUS on soft-tissue healing: A review of literature. Brit Med Bull 2009;89:169–182. Kocaoglu B, Martin J, Wolf B, Karahan M, Amendola A. The effect of irrigation solution at different temperatures on articular cartilage metabolism. Arthroscopy 2011;27:526–531. Korstjens CM, van der Rijt RHH, Albers GHR, Semeins CM, Klein-Nulend J. Low-intensity pulsed ultrasound affects human articular chondrocytes in vitro. Med Biol Eng Comput 2008;46:1263–1270. Leong DJ, Gu XI, Li YH, Lee JY, Laudier DM, Majeska RJ, Schaffler MB, Cardoso L, Sun HB. Matrix metalloproteinase-3 in articular cartilage is upregulated by joint immobilization and suppressed by passive joint motion. Matrix Biol 2010;29:420–426. Leong DJ, Li YH, Gu XI, Sun L, Zhou ZP, Nasser P, Laudier DM, Iqbal J, Majeska RJ, Schaffler MB, Goldring MB, Cardoso L, Zaidi M, Sun HB. Physiological loading of joints prevents cartilage degradation through CITED2. FASEB J 2011;25:182–191. Leung KS, Lee WS, Cheung WH, Qin L. Lack of efficacy of lowintensity pulsed ultrasound on prevention of postmenopausal bone loss evaluated at the distal radius in older Chinese women. Clin Orthop Relat Res 2004;427:234–240. Li X, Li J, Cheng K, Lin Q, Wang D, Zhang H, An H, Gao M, Chen A. Effect of low-intensity pulsed ultrasound on MMP-13 and MAPKs signaling pathway in rabbit knee osteoarthritis. Cell Biochem Biophys 2011;61:427–434. McNulty AL, Estes BT, Wilusz RE, Weinberg JB, Guilak F. Dynamic loading enhances integrative meniscal repair in the presence of interleukin-1. Osteoarthritis Cartilage 2010;18:830–838. Millward-Sadler SJ, Wright MO, Davies LW, Nuki G, Salter DM. Mechanotransduction via integrins and interleukin-4 results in altered aggrecan and matrix metalloproteinase 3 gene expression in normal, but not osteoarthritic, human articular chondrocytes. Arthritis Rheum 2000;43:2091–2099.
1733
Min BH, Woo JI, Cho HS, Choi BH, Park SJ, Choi MJ, Park SR. Effects of low-intensity ultrasound (LIUS) stimulation on human cartilage explants. Scand J Rheumatol 2006;35:305–311. Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases. Curr Opin Cell Biol 2004;16:558–564. Mukai S, Ito H, Nakagawa Y, Akiyama H, Miyamoto M, Nakamura T. Transforming growth factor-b (1) mediates the effects of lowintensity pulsed ultrasound in chondrocytes. Ultrasound Med Biol 2005;31:1713–1721. Naito K, Watari T, Muta T, Furuhata A, Iwase H, Igarashi M, Kurosawa H, Nagaoka I, Kaneko K. Low-intensity pulsed ultrasound (LIPUS) increases the articular cartilage type II collagen in a rat osteoarthritis model. J Orthop Res 2010;28:361–369. Park K, Hoffmeister B, Han DK, Hasty K. Therapeutic ultrasound effects on interleukin-1 beta stimulated cartilage construct in vitro. Ultrasound Med Biol 2007;33:286–295. Parvizi J, Wu CC, Lewallen DG, Greenleaf JF, Bolander ME. Lowintensity ultrasound stimulates proteoglycan synthesis in rat chondrocytes by increasing aggrecan gene expression. J Orthop Res 1999;17:488–494. Rutgers M, Saris DBF, Dhert WJA, Creemers LB. Cytokine profile of autologous conditioned serum for treatment of osteoarthritis, in vitro effects on cartilage metabolism and intra-articular levels after injection. Arthritis Res Ther 2010;12:R114. Smith RL, Lindsey DP, Dhulipala L, Harris AHS, Goodman SB, Maloney WJ. Effects of intermittent hydrostatic pressure and BMP-2 on osteoarthritic human chondrocyte metabolism in vitro. J Orthop Res 2011;29:361–368. Sun HB. Mechanical loading, cartilage degradation, and arthritis. Ann N Y Acad Sci 2010;1211:37–50. Sun HB, Li YH, Fung DT, Majeska RJ, Schaffler MB, Flatow EL. Coordinate regulation of IL-1 beta and MMP-13 in rat tendons following subrupture fatigue damage. Clin Orthop Relat Res 2008; 466:1555–1561. Sun HB, Yokota H. Altered mRNA level of matrix metalloproteinase-13 in MH7A synovial cells under mechanical loading and unloading. Bone 2001;28:399–403. Sun HB, Yokota H. Reduction of cytokine-induced expression and activity of MMP-1 and MMP-13 by mechanical strain in MH7A rheumatoid synovial cells. Matrix Biol 2002;21: 263–270. Takeuchi R, Ryo A, Komitsu N, Mikuni-Takagaki Y, Fukui A, Takagi Y, Shiraishi T, Morishita S, Yamazaki Y, Kumagai K, Aoki I, Saito T. Low-intensity pulsed ultrasound activates the phosphatidylinositol 3 kinase/Akt pathway and stimulates the growth of chondrocytes in three-dimensional cultures: A basic science study. Arthritis Res Ther 2008;10:R77. Torzilli PA, Bhargava M, Park S, Chen CTC. Mechanical load inhibits IL-1 induced matrix degradation in articular cartilage. Osteoarthritis Cartilage 2010;18:97–105. Trindade MCD, Shida J, Ikenoue T, Lee MS, Lin EY, Yaszay B, Yerby S, Goodman SB, Schurman DJ, Smith RL. Intermittent hydrostatic pressure inhibits matrix metalloproteinase and pro-inflammatory mediator release from human osteoarthritic chondrocytes in vitro. Osteoarthritis Cartilage 2004;12:729–735. Vaughan NM, Grainger J, Bader DL, Knight MM. The potential of pulsed low intensity ultrasound to stimulate chondrocytes matrix synthesis in agarose and monolayer cultures. Med Biol Eng Comput 2010;48:1215–1222. Watanabe Y, Matsushita T, Bhandari M, Zdero R, Schemitsch EH. Ultrasound for fracture healing: Current evidence. J Orthop Trauma 2010; 24:S56–S61. White D, Evans JA, Truscott JG, Chivers RA. Can ultrasound propagate in the joint space of a human knee? Ultrasound Med Biol 2007;33: 1104–1111. Yokota H, Goldring MB, Sun HB. CITED2-mediated regulation of MMP-1 and MMP-13 in human chondrocytes under flow shear. J Biol Chem 2003;278:47275–47280. Zhang ZJ, Huckle J, Francomano CA, Spencer RGS. The effects of pulsed low-intensity ultrasound on chondrocyte viability, proliferation, gene expression and matrix production. Ultrasound Med Biol 2003;29:1645–1651.