Low Molecular Mass Polypeptide-2 in Human Trophoblast: Over-Expression in Hydatidiform Moles and Possible Role in Trophoblast Cell Invasion

Placenta 30 (2009) 305–312

Contents lists available at ScienceDirect

Placenta journal homepage: www.elsevier.com/locate/placenta

Low Molecular Mass Polypeptide-2 in Human Trophoblast: Over-Expression in Hydatidiform Moles and Possible Role in Trophoblast Cell Invasion J.-J. Fu a, b, P. Lin c, X.-Y. Lv a, b, X.-J. Yan d, H.-X. Wang a, C. Zhu a, B.K. Tsang e, X.-G. Yu c, **, H. Wang a, * a

State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China Graduate School of the Chinese Academy of Sciences, Beijing 100039, China c Department of Biochemistry and Molecular Biology, College of Basic Medical Science, Harbin Medical University, Harbin 150081, China d Department of Obstetrics and Gynecology, The Third Hospital of Hebei Medical University, Hebei 050051, China e Department of Obstetrics & Gynecology and Cellular & Molecular Medicine University of Ottawa; Chronic Disease Program, Ottawa Health Research Institute, Ottawa, ON K1Y 4E9, Canada b

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 7 January 2009

Embryo implantation involves invasion of placental extravillous trophoblast cell (EVTs) into the uterus. Hyperactive EVT invasion occurs in hydatidiform moles and choriocarcinomas. We have previously demonstrated that the 20S proteasome is involved in mouse embryo implantation and its action is mediated via regulating the expression and activities of matrix metalloproteinase (MMP)-2 and MMP-9 in the EVTs. Our objective was to investigate whether low molecular mass polypeptide-2 (LMP2), a beta subunit of the 20S proteasome, is involved in the regulation of human trophoblast invasion. Normal human placentas or placentas from hydatidiform mole patients were collected and the expression of LMP2 in different cell types including trophoblastic column (TC), cytotrophoblast cells (CTB) and syncytiotrophoblast (STB) under different pathological states were studied by immunohistochemical analysis. Furthermore, the effect of LMP2 or proteasome on cell invasion was measured by using RNAi and inhibitors in a Matrigel invasion assay system in HTR-8/SVneo cells, a human invasive extravillous trophoblast cell line. Changes in the invasion-related molecules including MMP-2 and MMP-9 were also examined by using real time PCR and gelatin zymography. We demonstrated that the expression of LMP2 in TC of partial hydatidiform mole and complete hydatidiform mole, is higher than that in TC of normal human placentas. Besides, LMP2 knockdown significantly attenuated IL-1b-induced cell invasion in vitro, a response readily induced by proteasome inhibitors. In summary, over-expression of the 20S proteasome b-subunit LMP2 in trophoblast cells of hydatidiform moles may contribute to its highly invasive phenotype. Ó 2009 Elsevier Ltd. All rights reserved.

Keywords: LMP2 Hydatidiform mole Trophoblast invasion Proteasome

1. Introduction Trophoblast is an extra-embryonic tissue that plays a crucial role during embryo implantation and placentation [1,2]. The specialized villous cell types include cytotrophoblast (CTB), syncytiotrophoblast (STB) and extravillous trophoblast (EVTs). Villi CTBs are a monolayer of mononuclear cells lining the villi, while STB forms an external layer of non-proliferative cells of multi-nuclei. STB,

* Corresponding author. Institute of Zoology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China. Tel./fax: þ86 10 64807187. ** Corresponding author. Department of Biochemistry and Molecular Biology, College of Basic Medical Science, Harbin Medical University, Harbin 150081, China. Tel./fax: þ86 0451 86671684. E-mail addresses: [email protected] (X.-G. Yu), [email protected] (H. Wang). 0143-4004/$ – see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.placenta.2009.01.005

which is derived from CTBs, plays a key role in feto-maternal exchanges and the maintenance of successful pregnancy by releasing hormones including chorionic gonadotropin and placental lactogen. EVTs, derived from CTB when the latter break through the STB layer, are responsible for invading the uterine stroma [3,4]. Trophoblast invasion shares many similarities with invasion of tumor cells into host tissues. However, unlike the uncontrolled tumor invasion, invasion of trophoblast cells is strictly regulated by many endocrine and paracrine factors, which either promote or inhibit invasion of these cells [2,5–7]. Balanced expression of these factors ensures that invasion of human trophoblast cells is restricted spatially to the endometrium and the upper third of the myometrium. IL-1b is a pro-inflammatory cytokine, playing an important role in embryo implantation [8,9]. Several studies have shown that IL-1b stimulates trophoblast cells invasion [10,11].

306

J.-J. Fu et al. / Placenta 30 (2009) 305–312

Inadequate or excessive trophoblast invasion leads to gestational trophoblast diseases including choriocarcinoma, hydatidiform mole (HM), pre-eclampsia and intrauterine growth restriction (IUGR) [1,12]. Hydatidiform mole refers to a gestational trophoblastic disease and includes partial hydatidiform mole (PM) and complete hydatidiform mole (CM), occurring in about three and one per 1000 pregnancies, respectively [13,14]. Both PM and CM can transform into the malignant invasive mole, choriocarcinoma, with CM exhibiting a more invasive behavior than PM and being considered as higher risk of developing choriocarcinoma [13–15]. The 26S proteasome is a highly conserved multi-subunit protease complex and plays a major role in cell cycle progression, apoptosis, presentation of the major histocompatibility complex (MHC)-I antigen, signal transduction and transcriptional regulation [16–18] through selective degradation of ubiquitinated intracellular proteins. We have demonstrated that 26S proteasome plays a key role during mouse embryo implantation by regulating proteolytic activities of MMP-2 and -9 [19]. The proteasome have also been shown to be involved in regulating embryonic angiogenesis [20] and fetal fibronectin secretion in human placenta [21]. It has also been reported that proteasomal activity was reduced by about 30 percent in pre-eclamptic placenta, when compared to normal placenta [22]. Our previous study have shown that LMP2, a beta subunit of 20S proteasome [23] is strongly expressed in the placental villi, trophoblastic column, and arterial endothelial cells close to the implantation site in the endometrium and placenta of rhesus monkey (Macaca mulatta) during early pregnancy [8]. Furthermore, down-regulation of LMP2, in HTR-8/SVneo cells markedly reduced expression and activities of MMP-2 and MMP-9, two important gelatinolytic enzymes involved in the degradation of extracellular matrix. Although these findings suggest that LMP2 and proteasome activity may play a role in trophoblast invasion [23], whether LMP2, or proteasome activity is involved in human trophoblast invasion has not been reported. In this study, we have investigated possible role of LMP2 in trophoblast cell invasion by combining shRNA knockdown and in vitro Matrigel invasion assays. Our data demonstrate that LMP2 and proteasomal activity are required for IL-1b-induced trophoblast cell invasion. Furthermore, we also show that LMP2 is markedly overexpressed in TC derived from hydatidiform mole patients, when compared to TC of normal placenta. 2. Materials and methods

and Cellular & Molecular Medicine, University of Ottawa; Chronic Disease Program, Ottawa Health Research Institute, Ottawa, ON K1Y 4E9, Canada). Cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/ streptomycin (Invitrogen Corp., Gaithersburg, MD) and cultured in 95% air and 5% CO2 at 37  C. Construction of plasmids and stable transfection were performed according to the methods as described previously [23]. Briefly, the pSilencerÔ (2.1-U6 hygro) shRNA expression vector was purchased from Ambion (Ambion Inc., Austin, TX). The specific sequences of the LMP2 hairpin shRNA inserts are as follows: TTGTCTTTCAAGAGAAGACAAGTCCTCTCGATATTTTTTT 50 -GATCCATATCGAGAGGAC GGAAA-30 (forward); 50 -AGCTTTTCCAAAAAAATATCGAGAGGACTTGTCTTCTCTTG AAAGACAAGTCCTCTCGATATG-30 (reverse). LMP2 shRNA and negative control shRNA which exhibits no significant homology to mouse, rat, or human gene sequences were transfected with Effectene Transfection Reagent (QIAGEN, Inc., Valencia, CA) according to manufacturer’s instructions. To select hygromycinresistant cells transfected with LMP2 hairpin shRNA or negative control shRNA plasmid, cells were incubated in medium with 200 mg/ml hygromycin B (Sangon, Corp., Shanghai, China) for 3–4 days. Hygromycin-resistant cells were cultured and split until sample collection. The culture regimen for different endpoints are as follows: (1) to examine the effect of IL-1b on invasion of HTR-8/SVneo cells, IL-1b at a concentration of 10 ng/ml was used to treat HTR-8/SVneo cells for 12 h. (2) To investigate the function of LMP2 in IL-1b-induced invasion of HTR-8/SVneo cells, HTR-8/SVneo cells, stably transfected with LMP2 hairpin shRNA or negative control shRNA plasmids, were treated with IL-1b (10 ng/ml) for 12 h. (3) To investigate the function of proteasome activities on invasion of HTR-8/SVneo cells, proteasome inhibitors MG-132 and lactacystin (Calbiochem Inc., La Jolla, CA) at concentrations of 0.1, 0.5, 1, and 3 mM (MG-132) or 0.1, 0.5, and 1, 5 mM (lactacystin) were used to treat HTR-8/SVneo cells for different time durations ranging from 6, 12, 15 to 18 h. (4) To investigate the function of proteasome activity in IL-1b-induced invasion of HTR-8/ SVneo cells, HTR-8/SVneo cells were treated with proteasome inhibitors (0.5 mM MG-132 or lactacystin) for 12 h in the presence or absence of IL-1b (10 ng/ml). 2.3. Matrigel invasion assay Matrigel invasion assay was prepared in this study with modifications as described in detail by other studies [28–31]. Cells were: (1) stably transfected with control (CTL) shRNA or LMP2 shRNA followed by treatment with IL-1b (10 ng/ml), or (2) stimulated by IL-1b (10 ng/ml) in the presence or absence of MG-132 (0.5 mM) or lactacystin (0.5 mM) for 12 h at 37  C before being performed for invasion assay. Invasion of HTR-8/SVneo cells was measured in Matrigel (Becton Dickinson, NJ)coated transwell inserts (6.5 mm, Costar, Co., Cambridge) containing polycarbonate filters with 8 mm pores. The transwell inserts were coated with 50 ml of 1 mg/ml Matrigel matrix according to the manufacturer’s recommendations. After incubation at 37  C, 4 h for gelling, 2  105 cells in 200 ml RPMI 1640 medium without fetal bovine serum were plated in the upper chamber on top of the Matrigel, whereas 600 ml of medium with 10% fetal bovine serum were added to the lower well. After incubation in 95% air and 5% CO2 at 37  C for 22 h, non-invaded cells on top of the transwell were scraped off with a cotton swab. The filters attached with invaded cells were washed with PBS, fixed in methanol for 10 min and stained with haematoxylin and eosin. The amount of invaded cells in the lower well was counted under a light microscope (Olympus IX51, Japan) in 10 random fields at a magnification of 200. Results are expressed as percentage of CTL shRNA. Each experiment was performed in triplicates. Data are expressed as the mean invasion (% invasion  SEM), where the level of invasion was normalized to the control (EVTs stably tansfected with control vectors) within each experiment.

2.1. Patients and tissue collection 2.4. Gelatin zymography Placental tissue collection was approved by the Ethic Committee of the Third Hospital of Hebei Medical University. Informed consent was obtained from each woman donating her placenta. Cases with HM (n ¼ 27) in the first trimester were collected from the files of the Department of Pathology, the Third Hospital of Hebei Medical University, Hebei, China. CM and PM were confirmed according to their histological criteria and DNA ploidy results [13]. Histologic evaluation of all cases was performed on sections stained with haematoxylin and eosin [14]. The slides were evaluated by a pathologist whose expertise is in trophoblastic diseases. Ten cases were defined as PM, and 17 cases as CM. At the same time when the hydatidiform mole tissues were collected, 17 normal human placentas (NP) of similar gestational stages (all in the first trimester) were collected from women undergoing legal abortions from the same hospital as controls. All sample tissues were washed with ice-cold phosphate buffered saline (PBS) and fixed in 4% paraformaldehyde for 24 h at 4  C and processed for paraffin embedding.

To detect gelatinolytic activity in conditioned medium of HTR-8/SVneo cells after 12 h of MG-132 or lactacystin treatments, gelatin zymography on gels containing gelatin as the substrate was performed as described previously [23]. Briefly, conditioned medium were diluted in four-strength sample buffer [8% SDS (w:v), 0.04% bromophenol blue (w:v), 0.25 M Tris], and incubated at 37  C for 30 min. Five micrograms of total protein was electrophoresed through a 10% polyacrylamide gels containing 0.5 mg/ml gelatin (Difco Laboratories, Detroit, MI). After electrophoresis, gels were washed twice in 2.5% Triton X-100 and 50 mM Tris–HCl (pH 7.5) for 15 min at room temperature to remove SDS, incubated for 24 h at 37  C in calcium assay buffer (50 mM Tris, 10 mM CaCl2, 1 mM ZnCl2, 1%Triton X-100, pH 7.5), and then stained with Coomassie Brilliant Blue R-250 in 50% methanol and 10% acetic acid for 1 h at room temperature. Destaining was carried out in 10% acetic acid. Areas where gelatin was degraded were seen as an absence of staining. Identification of each gelatinase band was based on their molecular weights as shown in the figure legends.

2.2. Cell culture 2.5. Real time polymerase chain reaction HTR-8/SVneo cell line was originally established by introducing the gene encoding simian virus 40 large T antigen into first trimester human trophoblast HTR8 cells [24]. This cell line represent the invasive extravillous trophoblast since it expresses all markers of EVT in situ [25,26] and it has been widely used as a model for human first trimester EVT migration [26–28]. HTR-8/SVneo cells used in this study was from Professor Benjamin K Tsang (Department of Obstetrics & Gynecology

Total RNA was extracted using TriZol reagent as advised by the manufacturer (Invitrogen, Paisley, UK), and RNA quantities were determined spectrophotometrically at 260 nm. Two micrograms of RNA was reverse transcribed by using Superscript II reverse transcriptase (Invitrogen) with oligo (dT) as primers. Real time polymerase chain reaction was performed with SYBR Premix Ex Taq PCR Kit (Takara

J.-J. Fu et al. / Placenta 30 (2009) 305–312 Bio, Shiga, Japan) using an ABI 7000 PCR machine (Applied Biosystems, Foster City, CA). Specific PCR primers used in this study were as follows: GAPDH: (forward) 50 GCA CCG TCA AGG CTG AGA AC30 and (reverse) 50 TGG TGA AGA CGC CAG TGG A30 ; MMP-2: (forward) 50 GAT AAC CTG GAT GCC GTC GTG30 and (reverse) 50 CAG CCT AGC CAG TCG GAT TTG30 ; MMP-9: (forward) 50 ACC TCG AAC TTT GAC AGC GAC A30 and (reverse) 50 GAT GCC ATT CAC GTC GTC CTT A30 . Data are presented as relative quantification to GAPDH, using comparative CT method (2DDCT). 2.6. Western blotting Whole cell proteins were extracted with TriZol reagent according to the manufacturer’s instructions. Proteins were quantified by UV spectrophotometry (Beckman DU530, Fullerton, CA) and 50 mg of proteins were subjected to SDS-PAGE. Separated proteins were transferred electrophoretically onto a pure nitrocellulose blotting membrane (Pall Corporation, Pensacola, FL) and incubated with blocking buffer (3% BSA in TBST) for 1 h at room temperature. The membrane was then sequentially incubated with the primary antibody (LMP2: 0.2 mg/ml, Abcam Ltd., Cambridge, UK) overnight at 4  C, washed with TBST for 3  15 min at room temperature, incubated for 1 h at room temperature with TBST containing horseradish peroxidase-conjugated secondary antibodies, washed three times with TBST and once with TBS. Signals were developed using the Enhanced Chemiluminescence System (Pierce, Rockford, IL). 2.7. BrdU incorporation HTR-8/SVneo cells, stably transfected with LMP2 hairpin shRNA or negative control shRNA (CTL shRNA) plasmids, were treated with IL-1b (10 ng/ml) for 12 h. Cells were then harvested and fixed in methanol/acetone (1:1) for 10 min and

307

incubated in 2 M HCl for 45 min to denature DNA. After washing three times in PBS, cells were neutralized with 0.1 M Na2B4O7 (pH 8.5) for 30 min and incubated with 3% BSA followed by an overnight incubation at 4  C with mouse monoclonal antiBrdU antibody (1 mg/ml, Zhongshan Corp, Beijing, China). Cells were rinsed three times in PBS and incubated at 37  C for 1 h with a FITC-conjugated goat anti-mouse secondary antibody (Zhongshan Corp) and rinsed. Nuclei were stained with 5 mg/ml propidium iodide (PI). Cells were mounted with a mounting solution (Glycerol: PBS ¼ 9:1) with DABCO (Zhongshan Corp) and viewed under a fluorescence microscope (Olympus IX51, Japan) (n ¼ 3).

2.8. Annexin V staining and cell apoptosis assay Cells were washed with cold PBS and incubated in the dark for 30 min on ice with FITC-conjugated Annexin V (Baosai Corp). Incubation was ceased by adding double volumes of binding buffer. PI was added 5 min before detection on flow cytometer (FACS Calibur; BD Biosciences, San Jose, CA). Annexin V-positive and PI-negative cells were considered apoptotic cells (n ¼ 3). 2.9. Immunohistochemistry Immunohistochemical study was performed on 17 normal placentas, 10 and 17 placentas from partial hydatidiform moles and complete hydatidiform moles, respectively, using the Histostain-Plus Kit and diaminobenzidine (DAB, Zhongshan Corp, Beijing, China), as recommended by the manufacturers. Briefly, sections (5 mm) were deparaffinized and rehydrated in xylene and a graded series of ethyl alcohol, and rinsed in PBS. Antigen retrieval was performed by placing the slides in boiling citric acid buffer (10 mM citrate sodium and 10 mM citric acid) for 15 min. Sections were then sequentially incubated at room temperature with 3% H2O2 in methanol

Fig. 1. Immunostaining of human normal placentas and placentas of hydatidiform moles. (A) Shown here are representatives of 16 sections derived from 17 normal human placentas, 7 and 12 sections derived from 10 partial hydatidiform moles (PM) and 17 from complete hydatidiform moles (CM). Sections of normal human placentas (a), placentas from PM (b) and CM (c) were immunostained with anti-LMP2 antibodies. d, sections of normal human placentas were immunostained with anti-cytokeratin (CK)7, a marker for cytotrophoblast cells (CTB) and trophoblastic column (TC); e, sections of normal human placenta were immunostained with anti-b-human choriogonadotropin (hCG), a marker for syncytiotrophoblast (STB); f, g and h are negative controls on sections from PM, CM and normal human placentas, respectively, in which normal serum was used in place of specific primary antibodies. Bar represents 50 mm. (B) Statistical analyses of densitometric density.

308

J.-J. Fu et al. / Placenta 30 (2009) 305–312

for 15 min to quench endogenous peroxidase, normal goat serum for 30 min for blocking, primary antibodies LMP2 (10 mg/ml, cat. no. ab3328, Abcam Ltd., Cambridge, UK); CK7 or hCG (10 mg/ml, Santa. Cruz, CA) at 4  C overnight, and biotinylated secondary antibody for 30 min. Intervening PBS washing was necessary between each two steps. Diluted DAB was used as chromogen. Sections were rinsed with distilled water, counterstained with haematoxylin and mounted with histomount (Zymed Lab Inc., San Francisco, CA). To avoid artificial difference, sections of normal placenta and hydatidiform moles were placed on the same slide, and all the procedures for different sections were the same. For the above procedures, controls were performed by replacing the primary antibody with normal IgG. Further controls omitting the secondary antibody were performed. The controls always exhibited no positive staining. Densitometric readings for the immunohistochemical results have been performed by using ImageJ Basics (version 1.38) before counterstaining. Briefly, in each specific location on a slide, at least 40 spots were randomly selected. The gray level of intercellular substance was considered as background.

2.10. Statistical analysis Quantification of the bands from RT-PCR, Western blotting, and gelatin zymography were determined by MetaView Image Analyzing System (Version 4.50; Universal Imaging Corp., Downingtown, PA). Real time PCR data are presented as relative quantification to GAPDH, using comparative CT method (2DDCT). Results are expressed as mean  SEM. Statistical analyses were performed using the Statistical Package for Social Science (SPSS for Windows package release 10.0; SPSS Inc.,

Chicago, IL) and include One-way ANOVA (post hoc Tests LSD), Two-way ANOVA and general linear model-univariant as indicated in Results and Figure legends. *P < 0.05 and **P < 0.01.

3. Results 3.1. Over-expression of LMP2 in trophoblastic column (TC) of hydatidiform moles In order to characterize different types of cells of placenta villi, immunolocalization studies were performed and positive cytokeratin (CK)-7 staining in CTB and TC (Fig. 1d), and b-human choriogonadotropin (hCG) in STB (Fig. 1e) were observed. To compare the localization of LMP2 in different cell types of the human placenta and determine the difference in expression levels of LMP2 between normal human placenta and placentas from partial moles or complete moles, immunohistochemical study was performed. As shown in Fig. 1a, LMP2 protein expression was detectable in CTB, STB and TC in the normal placenta. However, LMP2 protein signals were significantly higher in CTB, TC and STB of partial moles

Fig. 2. Knockdown LMP2 expression inhibits IL-1b-induced HTR-8/SVneo cell invasion. A, RNAi-mediated knockdown of LMP2 expression significantly decreased LMP2 expression at both mRNA and protein levels in HTR-8/SVneo cells. The relative level of LMP2 was determined as the ratio of LMP2 mRNA or protein to its corresponding GAPDH, as measured by densitometry. **P < 0.01 as compared to control shRNA (CTL shRNA) group. CTL shRNA and LMP2 shRNA represent transfection with scrambled shRNA and LMP2 shRNA constructs, respectively. B and C, knockdown of LMP2 expression inhibited IL-1b-induced cell invasion. Representative images of cell invasion and average numbers of invaded cells by using Matrigel invasion assay were shown in B (images shown are invaded cells on the other side of the filter). Bar represents 50 mm. Stably transfected HTR-8/SVneo cells (CTL shRNA and LMP2 shRNA) treated with or without IL-1b (10 ng/ml) were subjected to the invasion assay as detailed in the ‘‘Materials and Methods’’. Cell invasion was quantified by the invasion index as indicated as the ratio to the control (CTL shRNA group). Results from three independent experiments were analyzed by Two-way ANOVA. P < 0.05 was considered as significant difference as shown in C. D and E. Knockdown of LMP2 expression had no significant effect on apoptosis and cell proliferation. The four groups of cells as detailed in B and C were immunostained with: (D), FITC-conjugated Annexin V followed by flow cytometric detection, or (E), anti-BrdU antibody. Annexin V-positive or BrdU-positive cells were considered apoptotic cells or cells under proliferation, respectively. Results from three independent experiments were analyzed by Two-way ANOVA. P < 0.05 was considered as significant difference.

J.-J. Fu et al. / Placenta 30 (2009) 305–312

(Fig. 1b) and complete moles (Fig 1c) as compared to normal placentas. Blank control group, with specific antibodies being replaced with normal sera, exhibited no specific staining (Fig. 1f,g and h). 3.2. LMP2 knockdown in HTR-8/SVneo cells inhibited IL-1b-induced cell invasion To determine whether LMP2 plays a role in trophoblast invasion, we generated and stably expressed a shRNA construct targeting LMP2 in HTR-8/SVneo cells. A similar shRNA expression vector with the specific LMP2–shRNA sequence scrambled (scrambled shRNA, CTL shRNA or control shRNA) was also constructed. Stable expression of LMP2 shRNA, but not CTL shRNA, dramatically reduced LMP2 mRNA and protein levels, so much so that LMP2 protein was often undetectable in LMP2–shRNA-transfected cells (Fig. 2A). To determine the effect of LMP2 knockdown on trophoblast cell invasion, in vitro invasion assays were carried out. As shown in Fig. 2B and C, IL-1b stimulated invasion of HTR-8/SVneo cells. In contrast, LMP2–shRNA-transfected cells failed to respond to IL-1b in Matrigel invasion assays. The effect of LMP2 knockdown on

309

IL-1b-induced cell invasion appeared specific, since as compared to the CTL shRNA group, the knockdown did not affect: (a) basal cell invasion (Fig. 2B and C), (b) basal or IL-1b-stimulated apoptosis (Fig. 2D), and (c) cell proliferation, in the presence or absence of IL-1b (Fig. 2E). 3.3. Proteasome inhibitors attenuated IL-1b-induced invasion of HTR-8/SVneo cells Our data suggest that LMP2 knockdown inhibits IL-1b-induced cell invasion through down-regulation of proteasome activity. To determine whether pharmacological inhibition of proteasome can mimic LMP2 knockdown in cell invasion, we examined the influence of the two proteasome inhibitors, lactacystin and MG-132 on the invasion of pure HTR-8/SVneo cells. High concentrations of lactacystin or MG-132 are known to induce significant apoptosis. Indeed, these inhibitors also significantly increased apoptosis of HTR-8/SVneo cells when used at concentrations higher than 0.5 mM or treated for longer than 12 h (at 0.5 mM) (Fig. 3A, B, C and D). Therefore, 0.5 mM and 12 h of treatment were employed to study the effect of proteasome inhibitors on invasion of HTR-8/SVneo

Fig. 3. Proteasome inhibitors MG-132 and lactacystin significantly attenuated IL-1b-induced invasion of HTR-8/SVneo cells. A–D, concentration and time-dependent studies of the effect of MG-132 or lactacystin on apoptosis of HTR-8/SVneo cells. HTR-8/SVneo cells were either treated with increasing concentrations of MG-132 (0.1, 0.5, 1, 3 mM) or lactacystin (0.1, 0.5, 1, 5 mM) for 12 h (A and C), or treated with 0.5 mM MG-132 (B) or lactacystin (D) for 6, 12, 15 and 18 h. Apoptosis was measured by Annexin V immunostaining followed by flow cytometric detection. Up to 12 h incubation with 0.5 mM MG-132 or lactacystin did not significantly change apoptosis of HTR-8/SVneo cells. Each bar graph represents mean  SEM of samples from three independent experiments. Difference is considered to be significant at **P < 0.01 (One-way ANOVA). E and F: treatment of HTR-8/SVneo cells with 0.5 mM MG-132 (E) or lactacystin (F) resulted in significant suppression of IL-1b (10 ng/ml)-induced cell invasion in a Matrigel invasion assay. Data are expressed as mean  SEM (n ¼ 3) (P < 0.01; Two-way ANOVA).

310

J.-J. Fu et al. / Placenta 30 (2009) 305–312

cells in the Matrigel invasion assay, to avoid complication caused by cell apoptosis. As shown in Fig. 3E and F, MG-132 and lactacystin significantly attenuated IL-1b-induced invasion of HTR-8/SVneo cells, but did not affect basal cell invasion. 3.4. Proteasome inhibitors attenuated IL-1b-induced MMP-9 activation MMP-2 and -9 are two major gelatinases that play important roles in cell invasion [32]. We, therefore, examined the expression and gelatinolytic activities of MMP-2 and MMP-9 after IL-1b and/or proteasome inhibitor treatments. As shown in Fig. 4A and B, the MMP-9 mRNA abundance and activities markedly increased in IL-1b-treated HTR-8/SVneo cells. In contrast, no changes of MMP-2 expression or activity were observed. Significantly, MG-132 or lactacystin significantly attenuated IL-1b-induced MMP-9 expression (Fig. 4A) and MMP-9 activity (Fig. 4B and C). 4. Discussion Successful embryo implantation and placentation requires a highly coordinated control of proliferation, migration and invasion of extravillous trophoblast cells [33]. Incomplete trophoblast invasion and spiral artery remodeling are associated with spontaneous abortion, fetal growth restriction and pre-eclampsia [34–36]. Ubiquitin-mediated proteolysis of regulatory proteins may play an important role in embryo implantation and early placentation [37]. Dysregulation of ubiquitination and proteasome-mediated protein

degradation are correlated with gestational trophoblast diseases. For example, mutations in CUL7, an scaffold protein for E3 ligase complex, is closely related to 3-M syndrome, an autosomal recessive condition characterized by severe pre- and postnatal growth retardation, suggesting that impaired ubiquitination have a role to play in the pathogenesis of fetal growth restriction in human [38]. Furthermore, the amount of oxidatively damaged proteins increases about 30 percent in pre-eclamptic placenta, which may be related to a significantly reduced proteasome function in preeclamptic placenta [22]. More and more evidence illustrate that dysregulation of ubiquitin–proteasome pathway is involved in gestational trophoblast diseases. We have demonstrated here that LMP2, an important catalytic subunit of 26S proteasome, has an important role to play in IL-1binduced cell invasion. Several lines of evidence support this conclusive observation. First, a scrambled shRNA with the same nucleotide composition did not affect LMP2 expression, nor did it affect IL-1b-induced cell invasion as measured by in vitro Matrigel cell invasion assays. Second, down-regulation of LMP2 proteins levels by shRNA significantly attenuated IL-1b-induced cell invasion. And third, LMP2 shRNA-transfected cells exhibited cell proliferation rate and apoptosis rate comparable to those of control cells, underscoring the specificity of this knockdown on cell invasion. Interestingly, LMP2 shRNA did not significantly alter (basal) cell invasion in the absence of IL-1b (data not shown), suggesting that perhaps the residual LMP2 or other 20S proteasome b subunit in these cells were sufficient to support the basal levels of cell invasion.

Fig. 4. Proteasome inhibitors significantly attenuated IL-1b-induced MMP-9 expression and activation. A and B, real time PCR analysis of the expression of MMP-2 and MMP-9 mRNAs (A) and gelatin zymography analysis of the activities of MMP-2 and MMP-9 (B) in HTR-8/SVneo cells treated with MG-132 (0.5 mM) or lactacystin (0.5 mM), with the presence or absence of IL-1b (10 ng/ml) (n ¼ 3, ANOVA). The molecular weights of pro-MMP-9 and pro-MMP-2 are 92 kDa and 72 kDa, respectively. C, lactacystin suppressed the increase of MMP-9 activities induced by IL-1b in a dose-dependent manner. HTR-8/SVneo cells were treated with increasing concentrations of lactacystin in the presence of IL-1b (10 ng/ml). Gelatin zymography was used to detect activities of MMP-2 and -9. Data are expressed as mean  SEM (n ¼ 3) (Two-way ANOVA).

J.-J. Fu et al. / Placenta 30 (2009) 305–312

The physiological role of IL-1b in trophoblast cell invasion in normal or choriocarcinoma human placenta remains unclear. However, IL-1 receptor antagonist significantly reduces the number of implanted mouse embryos, suggesting a role of IL-1 in mammalian embryo implantation [8]. IL-1b protein expression has been shown in multinucleated STB and in invasive EVTs, but not in the villus CTB cells [39]. Furthermore, several studies have shown that IL-1b stimulated secretion and activity of MMP-9 and invasion of human primary cytotrophoblast and human choriocarcinoma cell line JEG-3 into Matrigel [10,11]. We have extended these previous studies by demonstrating that IL-1b also significantly enhanced cell invasion of another human trophoblast cell line HTR-8/SVneo and, more importantly, by demonstrating that IL-1binduced cell invasion required elevated levels of LMP2 protein. LMP2 may function as a b subunit of 20S proteasome as others have demonstrated [40], we further demonstrated by Matrigel invasion assay that proteasome inhibitors MG-132 and lactacystin markedly suppressed IL-1b-induced MMP-9 activation and cell invasion. It has been reported that expression of IL-1b increased which is associated with invasion in complete hydatidiform moles [29]. Moreover, IL-1b is a typical cytokine that affects the implantation process [8]. IL-1b upregulates MMP-9 expression and promotes cell invasion in various trophoblast cells [10,11,30]. Our work demonstrates that LMP2 knockdown or repressing proteasome activity by proteasome inhibitors inhibits IL-1b-induced cell invasion, but has little effect on unstimulated cells. The underlying reason for these observations is currently unknown. However, previous results from the relevant literature do suggest that inhibition of the NF-kB signaling pathway may be one operative mechanism. IL-1b has been linked to the NF-kB signaling pathway and the ubiquitin-proteasome pathway plays a crucial role in NF-kB activation [31,41–43]. In unstimulated cells, the NF-kB proteins are predominantly localized in the cytoplasm and are associated with a family of inhibitory proteins known as IkB. It is well established that phosphorylation is a prerequisite for the ubiquitination of IkB and the NF-kB precursors p100 and p105. [43–45] Moreover, LMP2 is critical for proteasome activity and plays an important role in NF-kB activation and IkBa degradation induced by cytokines [46,47]. Furthermore, we have previously shown that LMP2 is essential for regulating MMP-9 via the NF-kB pathway in HTR-8/SVneo cells [23]. We demonstrated in this study that proteasome activity was essential in the regulation of trophoblast cell invasion and this may be mainly through the NF-kB pathway, which needs further investigation. Consistent with a possible role of high levels of LMP2 in the aggressive invasion of trophoblast cells in hydatidiform moles and choriocarcinomas, we have demonstrated for the first time that LMP2 is over-expressed in placenta of women with partial hydatidiform mole and complete hydatidiform mole, when compared to placenta of healthy women. The over-expression appeared to be in syncytiotrophoblast, extravillous and also in cytotrophoblast cells of the diseased placenta. The differential expression of LMP2 in trophoblast cells is clearly consistent with their cell-invading roles in embryo implantation and in hydatidiform moles, whereas LMP2 over-expression in CTB and STB implies a different role of LMP2 in early human placentation, such as trophoblast cell differentiation, hormone secretion of STB or the maintenance of pregnancy, which need to be further investigated. In conclusion, we reported that the 20S proteasome b subunit LMP2 was highly over-expressed in trophoblast cells of hydatidiform moles and that RNAi-mediated knockdown of LMP2 in aggressive EVT cells attenuated cell invasion. 5. Disclosure statement The authors have nothing to disclose.

311

Acknowledgements We would like to thank Dr. Yanling Wang and Dr. Chunsheng Han for helpful discussion. This study was supported by 973 Program (2006CB504006 and 2006CB944008) from the Ministry of Science and Technology of the People’s Republic of China, a grant from CAS Knowledge Innovation Program (KSCX2-YW-R-080), and grants from National Natural Science Foundation of China (Nos. 30670262 and 30811120431) to Wang HM. References [1] Lunghi L, Ferretti ME, Medici S, Biondi C, Vesce F. Control of human trophoblast function. Reprod Biol Endocrinol 2007;5:6. [2] Staun-Ram E, Shalev E. Human trophoblast function during the implantation process. Reprod Biol Endocrinol 2005;3:56. [3] Red-Horse K, Zhou Y, Genbacev O, Prakobphol A, Foulk R, McMaster M, et al. Trophoblast differentiation during embryo implantation and formation of the maternal–fetal interface. J Clin Invest 2004;114:744–54. [4] Lash GE, Otun HA, Innes BA, Kirkley M, De Oliveira L, Searle RF, et al. Interferon-gamma inhibits extravillous trophoblast cell invasion by a mechanism that involves both changes in apoptosis and protease levels. FASEB J 2006;20:2512–8. [5] Strickland S, Richards WG. Invasion of the trophoblasts. Cell 1992;71:355–7. [6] Karmakar S, Dhar R, Das C. Inhibition of cytotrophoblastic (JEG-3) cell invasion by interleukin 12 involves an interferon gamma-mediated pathway. J Biol Chem 2004;279:55297–307. [7] Cohen M, Bischof P. Factors regulating trophoblast invasion. Gynecol Obstet Invest 2007;64:126–30. [8] Simon C, Frances A, Piquette GN, el Danasouri I, Zurawski G, Dang W, et al. Embryonic implantation in mice is blocked by interleukin-1 receptor antagonist. Endocrinology 1994;134:521–8. [9] van Mourik MS, Heijnen CJ, Macklon NS. Embryonic implantation: cytokines, adhesion molecules, and immune cells in establishing an implantation environment. J Leukoc Biol 2009;85:4–19. [10] Librach CL, Feigenbaum SL, Bass KE, Cui TY, Verastas N, Sadovsky Y, et al. Interleukin-1 beta regulates human cytotrophoblast metalloproteinase activity and invasion in vitro. J Biol Chem 1994;269:17125–31. [11] Karmakar S, Das C. Regulation of trophoblast invasion by IL-1beta and TGFbeta1. Am J Reprod Immunol 2002;48:210–9. [12] Kaufmann P, Black S, Huppertz B. Endovascular trophoblast invasion: implications for the pathogenesis of intrauterine growth retardation and preeclampsia. Biol Reprod 2003;69:1–7. [13] Seckl MJ, Fisher RA, Salerno G, Rees H, Paradinas FJ, Foskett M, et al. Choriocarcinoma and partial hydatidiform moles. Lancet 2000;356:36–9. [14] Petignat P, Laurini R, Goffin F, Bruchim I, Bischof P. Expression of matrix metalloproteinase-2 and mutant p53 is increased in hydatidiform mole as compared with normal placenta. Int J Gynecol Cancer 2006;16:1679–84. [15] Berkowitz RS, Goldstein DP. Chorionic tumors. N Engl J Med 1996;335:1740–8. [16] Baumeister W, Walz J, Zuhl F, Seemuller E. The proteasome: paradigm of a selfcompartmentalizing protease. Cell 1998;92:367–80. [17] Ciechanover A. The ubiquitin-proteasome pathway: on protein death and cell life. EMBO J 1998;17:7151–60. [18] Hershko A, Ciechanover A. The ubiquitin system. Annu Rev Biochem 1998;67:425–79. [19] Wang HM, Zhang X, Qian D, Lin HY, Li QL, Liu DL, et al. Effect of ubiquitin– proteasome pathway on mouse blastocyst implantation and expression of matrix metalloproteinases-2 and -9. Biol Reprod 2004;70:481–7. [20] Oikawa T, Sasaki T, Nakamura M, Shimamura M, Tanahashi N, Omura S, et al. The proteasome is involved in angiogenesis. Biochem Biophys Res Commun 1998;246:243–8. [21] Yuehong MA, D’Antona D, LaChapelle L, Ryu JS, Guller S. Role of the proteasome in the regulation of fetal fibronectin secretion in human placenta. Ann N Y Acad Sci 2001;943:340–51. [22] Hass R, Sohn C. Increased oxidative stress in pre-eclamptic placenta is associated with altered proteasome activity and protein patterns. Placenta 2003;24:979–84. [23] Wang HX, Wang HM, Lin HY, Yang Q, Zhang H, Tsang BK, et al. Proteasome subunit LMP2 is required for matrix metalloproteinase-2 and -9 expression and activities in human invasive extravillous trophoblast cell line. J Cell Physiol 2006;206:616–23. [24] Graham CH, Hawley TS, Hawley RG, MacDougall JR, Kerbel RS, Khoo N, et al. Establishment and characterization of first trimester human trophoblast cells with extended lifespan. Exp Cell Res 1993;206:204–11. [25] Irving J, Lysiak J, Graham CH, Hearn S, Han V, Lala PK. Characteristics of trophoblast cells migrating from first trimester chorionic villus explants and propagated in culture. Placenta 1995;16:413–33. [26] Nicola C, Timoshenko AV, Dixon SJ, Lala PK, Chakraborty C. EP1 receptormediated migration of the first trimester human extravillous trophoblast: the role of intracellular calcium and calpain. J Clin Endocrinol Metab 2005;90:4736–46.

312

J.-J. Fu et al. / Placenta 30 (2009) 305–312

[27] Horita H, Kuroda E, Hachisuga T, Kashimura M, Yamashita U. Induction of prostaglandin E2 production by leukemia inhibitory factor promotes migration of first trimester extravillous trophoblast cell line, HTR-8/SVneo. Hum Reprod 2007;22:1801–9. [28] Qiu Q, Yang M, Tsang BK, Gruslin A. EGF-induced trophoblast secretion of MMP-9 and TIMP-1 involves activation of both PI3K and MAPK signalling pathways. Reproduction 2004;128:355–63. [29] Prabha B, Molykutty J, Swapna A, Rajalekshmi TN, Gangadharan VP. Increased expression of interleukin-1 beta is associated with persistence of the disease and invasion in complete hydatidiform moles (CHM). Eur J Gynaecol Oncol 2001;22:50–6. [30] Shimonovitz S, Hurwitz A, Barak V, Dushnik M, Adashi EY, Anteby E, et al. Cytokine-mediated regulation of type IV collagenase expression and production in human trophoblast cells. J Clin Endocrinol Metab 1996;81:3091–6. [31] Tsukihara S, Harada T, Deura I, Mitsunari M, Yoshida S, Iwabe T, et al. Interleukin-1beta-induced expression of IL-6 and production of human chorionic gonadotropin in human trophoblast cells via nuclear factor-kappaB activation. Am J Reprod Immunol 2004;52:218–23. [32] Nagase H, Woessner Jr JF. Matrix metalloproteinases. J Biol Chem 1999;274:21491–4. [33] Biondi C, Ferretti ME, Pavan B, Lunghi L, Gravina B, Nicoloso MS, et al. Prostaglandin E2 inhibits proliferation and migration of HTR-8/SVneo cells, a human trophoblast-derived cell line. Placenta 2006;27:592–601. [34] Khong TY, De Wolf F, Robertson WB, Brosens I. Inadequate maternal vascular response to placentation in pregnancies complicated by pre-eclampsia and by small-for-gestational age infants. Br J Obstet Gynaecol 1986;93:1049–59. [35] Ball E, Bulmer JN, Ayis S, Lyall F, Robson SC. Late sporadic miscarriage is associated with abnormalities in spiral artery transformation and trophoblast invasion. J Pathol 2006;208:535–42. [36] Kadyrov M, Kingdom JC, Huppertz B. Divergent trophoblast invasion and apoptosis in placental bed spiral arteries from pregnancies complicated by

[37] [38]

[39]

[40]

[41] [42] [43] [44] [45] [46]

[47]

maternal anemia and early-onset preeclampsia/intrauterine growth restriction. Am J Obstet Gynecol 2006;194:557–63. Ciechanover A, Schwartz AL. Ubiquitin-mediated degradation of cellular proteins in health and disease. Hepatology 2002;35:3–6. Huber C, Dias-Santagata D, Glaser A, O’Sullivan J, Brauner R, Wu K, et al. Identification of mutations in CUL7 in 3-M syndrome. Nat Genet 2005;37:1119–24. Paulesu L, King A, Loke YW, Cintorino M, Bellizzi E, Boraschi D. Immunohistochemical localization of IL-1 alpha and IL-1 beta in normal human placenta. Lymphokine Cytokine Res 1991;10:443–8. Ortiz-Navarrete V, Seelig A, Gernold M, Frentzel S, Kloetzel PM, Hammerling GJ. Subunit of the ‘20S’ proteasome (multicatalytic proteinase) encoded by the major histocompatibility complex. Nature 1991;353:662–4. Lappas M, Rice GE. The role and regulation of the nuclear factor kappa B signalling pathway in human labour. Placenta 2007;28:543–56. Lindstro¨m TM, Bennett PR. The role of nuclear factor kappa B in human labour. Reproduction 2005;130:569–81. Chen ZJ. Ubiquitin signalling in the NF-kappaB pathway. Nat Cell Biol 2005;7:758–65. Ben-Neriah Y. Regulatory functions of ubiquitination in the immune system. Nat Immunol 2002;3:20–6. Yamamoto Y, Gaynor RB. IkappaB kinases: key regulators of the NF-kappaB pathway. Trends Biochem Sci 2004;29:72–9. Hayashi T, Faustman D. Essential role of human leukocyte antigen-encoded proteasome subunits in NF-kappaB activation and prevention of tumor necrosis factor-alpha-induced apoptosis. J Biol Chem 2000;275:5238–47. Hayashi T, Faustman D. Development of spontaneous uterine tumors in low molecular mass polypeptide-2 knockout mice. Cancer Res 2002;62:24–7.