Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella)

Fish and Shellfish Immunology 78 (2018) 202–221

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella)

T

Xiao-Zhong Wanga,1, Wei-Dan Jianga,b,c,1, Lin Fenga,b,c, Pei Wua,b,c, Yang Liua,b,c, Yun-Yun Zenga, Jun Jianga, Sheng-Yao Kuangd, Ling Tangd, Wu-Neng Tangd, Xiao-Qiu Zhoua,b,c,∗ a

Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, China Fish Nutrition and Safety Production University Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130, China Key Laboratory for Animal Disease-Resistance Nutrition of China Ministry of Education, Sichuan Agricultural University, Chengdu 611130, China d Animal Nutrition Institute, Sichuan Academy of Animal Science, Chengdu 610066, China b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Cholesterol Immune organs Immunity Inflammation response NF-κB and TOR signalling Grass carp (Ctenopharyngodon idella)

The present study explored the effect of cholesterol on the immunity and inflammation response in the immune organs (head kidney, spleen and skin) of young grass carp (Ctenopharyngodon idella) fed graded levels of dietary cholesterol (0.041–1.526%) for 60 days and then infected with Aeromonas hydrophila for 14 days. The results showed that low levels of cholesterol (1) depressed the innate immune components [lysozyme (LZ), acid phosphatase (ACP), complements and antimicrobial peptides] and adaptive immune component [immunoglobulin M (IgM)], (2) up-regulated the mRNA levels of pro-inflammatory cytokines [interleukin 1β (IL1β), IL-6, IL-8, IL-12p35, IL-12p40, IL-15, IL-17D, tumor necrosis factor α (TNF-α) and interferon γ2 (IFN-γ2)], partly due to the activated nuclear factor kappa B (NF-κB) signalling, and (3) down-regulated the mRNA levels of anti-inflammatory cytokines [IL-4/13B, IL-10, IL-11, transforming growth factor (TGF)-β1 and TGF-β2], partly due to the suppression of target of rapamycin (TOR) signalling in the immune organs of young grass carp. Interestingly, dietary cholesterol had no influences on the IκB kinase α (IKKα) and IL-4/13A mRNA levels in the head kidney, spleen and skin, the IL-1β and IL-12p40 mRNA levels in the spleen and skin, or the β-defensin-1 mRNA level in the skin of young grass carp. Additionally, low levels of cholesterol increased the skin haemorrhage and lesion morbidity. In summary, low levels of cholesterol impaired immunity by depressing the innate and adaptive immune components, and low levels of cholesterol aggravated the inflammation response via up-regulating the expression of pro-inflammatory cytokines as well as down-regulating the expression of anti-inflammatory cytokines partly through the modulation of NF-κB and TOR signalling in the immune organs of fish. Similar to the low level of cholesterol, the excess level of dietary cholesterol impaired immunity and aggravated inflammation response in the immune organs of fish. Finally, based on the percent weight gain (PWG), the ability against skin haemorrhage and lesions as well as the LZ activity in the head kidney and the ACP activity in the spleen, the optimal dietary cholesterol levels for young grass carp were estimated as 0.721, 0.826, 0.802 and 0.772% diet, respectively.

1. Introduction With the increasing aquaculture industry, high levels of plant protein ingredients are currently used to replace fishmeal in aquafeeds [1], which have negative effect on non-specific immunity and growth in fishes [2,3]. These negative effect are partly related to the lack of some steroids, essential amino acids and vitamins in plant protein ingredients [4–7]. Cholesterol is a key sterol serving as a precursor to ∗

1

physiologically active compounds in animals [8]. Study have shown that low levels of dietary cholesterol decreased disease resistance in yellowtail (Seriola quinqueradiata) [9]. To our knowledge, disease resistance can be impacted by immunity, which relies on the immune response of immune organs (such as head kidney and spleen) in fish [10]. To date, there have only been fragmentary reports concerning the effect of cholesterol on the immune response of immune organs in fish. Only one study observed that low levels of cholesterol decreased the

Corresponding author. Animal Nutrition Institute, Sichuan Agricultural University, Chengdu 611130, Sichuan, China. E-mail addresses: [email protected], [email protected] (X.-Q. Zhou). These two authors contributed to this work equally.

https://doi.org/10.1016/j.fsi.2018.04.030 Received 8 February 2018; Received in revised form 12 April 2018; Accepted 16 April 2018 Available online 20 April 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

respiratory burst activity of macrophages and phagocytic activity of leucocytes in the head kidney of rainbow trout (Oncorhynchus mykiss) [11]. Therefore, in-depth studies should be performed to investigate the effect of cholesterol on the immune response of immune organs in fish. The fish immune response is tightly correlated with innate immune components, such as lysozyme (LZ), acid phosphatase (ACP), complements (such as C3) and antimicrobial peptides (such as β-defensin) [12], as well as adaptive immune components, such as immunoglobulin M (IgM) [13]. However, there is no report investigating the effect of dietary cholesterol on innate and adaptive immune components in the immune organs of fish. Previous studies have confirmed that low-cholesterol diets decreased the plasma vitamin E level in rabbit [14]. In a previous study, we observed that vitamin E deficiency decreased the LZ and ACP activities as well as complement 3 (C3) contents in the head kidney and spleen of grass carp [15]. In addition, inadequate dietary cholesterol could decrease whole body lipid levels in juvenile turbot (Scophthalmus maximus L.) [16]. This previous study demonstrated that the low level of lipids reduced the IgM contents in the head kidney and spleen of grass carp [17]. Moreover, insufficient dietary cholesterol could decrease plasma calcium levels in rainbow trout [18]. In humans, calcium deficiency could down-regulate β-defensin-2 gene expression in oral epithelial cells [19]. The above observations indicate that cholesterol might influence the immune response of immune organs associated with innate and adaptive immune components in fish, which is worthy of further investigation. Additionally, a cascade of cytokines is released as part of the innate immune components, which play a role in the immune response of fish [20]. Cytokines include pro-inflammatory cytokines (such as IL-6 and IL-8), which could be regulated by nuclear factor kappa B (NF-κB) in humans [21], and anti-inflammatory cytokines (such as IL-10), which could be modulated by mammalian target of rapamycin (mTOR) in mammals [22]. However, there are no studies investigating the effect and potential mechanisms of cholesterol on pro-/anti-inflammatory cytokines in fish. Cholesterol serves as a precursor of cortisol in animals [8]. Castro et al. (2011) demonstrated that cortisol caused the downregulation of IL-6 and IL-8 gene expression and the up-regulation of IL10 expression in rainbow trout [23]. In addition, high dietary cholesterol could cause vitamin C deficiency in guinea pigs [24]. In a previous study, we demonstrated that vitamin C deficiency activated NF-κB signalling in the head kidney of grass carp [25]. Moreover, in humans, evidence suggests that cholesterol depletion inhibited Akt phosphorylation in prostate epithelial cells [26], and the inhibition of Akt phosphorylation could suppress mTOR signalling in HEK293 cells [27]. Hence, these data suggest a potential relationship between dietary cholesterol and pro-/anti-inflammatory cytokines as well as its potential regulation mechanisms in fish, which awaits investigation. The present study, is the first to investigate the effect of dietary cholesterol on the innate and adaptive immune components in the immune organs of fish. Additionally, we further investigated the influences of dietary cholesterol on the relevant signalling pathways, namely, NF-κB and TOR, which might reveal partial theoretical evidence for the mechanisms of the immune response in fish. Moreover, grass carp is a typical herbivorous finfish [28] and is one of the most important commercial freshwater fish species worldwide [29]. Thus, the optimal dietary cholesterol levels for young grass carp were also evaluated, which may provide a reference for formulating the commercial feeds of grass carp.

Table 1 Ingredients and proximate composition of the experimental diets for young grass carp (Ctenopharyngodon idella). Dietary treatmentsa

Ingredients (g kg−1) Casein Gelatin Soybean protein concentrate α-starch Corn starch Fish oil Soybean oil Cellulose Vitamin premixb Mineral premixc Cholesterol (95%) Ca(H2PO4)2 Choline chloride (50%) DL-Met (99%) L-Trp (99.2%) Ethoxyquin (30%) Proximate composition DM (%)d Crude protein (%)d Crude lipid (%)d (Omega-3 fatty acids) n-3 (%)e (Omega-6 fatty acids) n-6 (%)e Available phosphoruse Total energy (MJ kg−1 DM)d Cholesterol (%)d

C0

C0.3

C0.6

C0.9

C1.2

C1.5

160.00 56.00 150.00

160.00 56.00 150.00

160.00 56.00 150.00

160.00 56.00 150.00

160.00 56.00 150.00

160.00 56.00 150.00

230.00 246.00 29.40 18.10 50.00 10.00 20.00 0.00 15.30 10.00 4.10 0.60 0.50

230.00 243.00 29.40 18.10 50.00 10.00 20.00 3.00 15.30 10.00 4.10 0.60 0.50

230.00 240.00 29.40 18.10 50.00 10.00 20.00 6.00 15.30 10.00 4.10 0.60 0.50

230.00 237.00 29.40 18.10 50.00 10.00 20.00 9.00 15.30 10.00 4.10 0.60 0.50

230.00 234.00 29.40 18.10 50.00 10.00 20.00 12.00 15.30 10.00 4.10 0.60 0.50

230.00 231.00 29.40 18.10 50.00 10.00 20.00 15.00 15.30 10.00 4.10 0.60 0.50

88.31 28.71 4.50 1.04

88.43 29.01 4.62 1.04

88.61 29.11 4.46 1.04

88.25 28.78 4.54 1.04

88.98 28.80 4.58 1.04

88.22 28.97 4.67 1.04

0.96

0.96

0.96

0.96

0.96

0.96

0.40 19.77

0.40 19.93

0.40 20.05

0.40 19.99

0.40 20.20

0.40 20.30

0.041

0.334

0.636

0.932

1.243

1.526

a

Dietary treatments: C0, basal diet; C0.3, 0.3% cholesterol; C0.6, 0.6% cholesterol; C0.9, 0.9% cholesterol; C1.2, 1.2% cholesterol; C1.5, 1.5% cholesterol. b Per kilogram of vitamin premix (g kg−1): retinyl acetate (500,000 IU g−1), 0.39; cholecalciferol (500,000 IU g−1), 0.40; DL-α-tocopherol acetate (50%), 23.23; menadione (22.9%), 0.83; cyanocobalamin (1%), 0.94; D-biotin (2%), 0.75; folic acid (95%), 0.42; thiamine nitrate (98%), 0.09; ascorhyl acetate (95%), 9.77; niacin (99%), 4.04; meso-inositol (98%), 19.39; calcium-D-pantothenate (98%), 3.85; riboflavin (80%), 0.73; pyridoxine hydrochloride (98%), 0.62. All ingredients were diluted with maize starch to 1 kg. c Per kilogram of mineral premix (g kg−1): MnSO4.H2O (31.8% Mn), 2.6590; MgSO4.H2O (15.0% Mg), 200.0000; FeSO4.H2O (30.0% Fe), 12.2500; ZnSO4.H2O (34.5% Zn), 8.2460; CuSO4.5H2O (25.0% Cu), 0.9560; KI (76.9% I), 0.0650; Na2SeO3 (44.7% Se), 0.0168. All ingredients were diluted with maize starch to 1 kg. d Dry matter (DM), crude protein, crude lipid and cholesterol contents, as well as total energy were measured values. e n-3, n-6 and available phosphorus contents were calculated according to NRC (2011).

soybean protein concentrate as the primary protein sources; in addition, fish oil and soybean oil were used as the dominating lipid sources. The diet formulation was based on that reported in previous studies and was considered sufficient in terms of protein, lipids, n-3 and n-6, as well as available phosphorus to meet the requirements of young grass carp according to Xu et al. (2016) [30], Ni et al. (2016) [17], Zeng et al. (2015) [31] and Wen et al. (2015) [32]. The other five diets (C0.3, C0.6, C0.9, C1.2 and C1.5) were supplemented with 0.3, 0.6, 0.9, 1.2 and 1.5% cholesterol (purity ≥ 95%), at the expense of corn starch in the basal diet. The actual cholesterol contents of C0, C0.3, C0.6, C0.9, C1.2 and C1.5 diets were determined as 0.041, 0.334, 0.636, 0.932, 1.243 and 1.526%, respectively, according to Deng et al. (2013) [18], and the diets were prepared and stored at −20 °C.

2. Materials and methods 2.1. Experimental diets and procedures The ingredients and proximate composition of experimental diets are presented in Table 1. Six isonitrogenous and isoenergetic diets were formulated to contain increasing levels of cholesterol. The basal diet (C0) was formulated by using a combination of casein, gelatin and 203

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

skin were determined according to the procedures reported by Deng et al. (2013) [18]. The tissue homogenates of head kidney, spleen and skin were prepared in 10 volumes (w/v) of ice-cold physiological saline solution, followed by centrifugation (6000 g for 20 min at 4 °C); then, the supernatant was conserved for immune parameters analysis, as described by Wu et al. (2016) [37]. Lysozyme (LZ) activity was determined by a lysozyme kit (Jiancheng Bioengineering Institute, Nanjing, China), which measures the decrease in turbidity after the lysis of Micrococcus peptidoglycan in the cell wall, according to the procedures reported by Zuo et al. (2012) [38]. Acid phosphatase (ACP) activity was assayed with a commercial kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the procedures reported by Jiang et al. (2016) [39], briefly, after incubation for 30 min; then, the concentration of phenol was spectrophotometrically detected at 520 nm. Complements C3 and C4 were determined by using the immunoturbidimetry kit according to the method of He et al. (2009) [40]. Immunoglobulin M (IgM) content was measured by immunoturbidimetry kit (Zhejiang Elikan Biological Technology Co., Ltd, Zhejiang, China), according to the method of Li et al. (2016) [41].

2.2. Growth trial and sample collection All protocols were approved by the Institutional Animal Care and Use Committee (IACUC) of Sichuan Agricultural University. Grass carp obtained from a fishery (Sichuan, China) were acclimatized to the experimental conditions for 4 weeks according to Xu et al. (2016) [25]. After the acclimation period, a total of 540 fish (average weight 225.37 ± 0.43 g) were randomly distributed into 18 cages (1.4 L × 1.4 W × 1.4 H m) with 30 fish per cage as one group (triplicate groups per dietary treatment). Every cage was equipped with a disc of 100 cm diameter in the bottom to collect the uneaten feed according to Wu et al. (2015) [33]. The fish were manually fed their respective diets to apparent satiation four times per day for 60 days. At 30 min after feeding, the uneaten feed was collected as described in our previous study [33]. During the experimental period, the water temperature 28.5 ± 2 °C, dissolved oxygen concentrations were higher than 6.0 mg/L, and the pH was 7.2 ± 0.5. The fish were subjected to a natural photoperiod as described by Xu et al. (2016) [25]. At the end of growth trial, first, the total number of fish was counted, and the mean body weight of the fish in each cage was measured to calculate the growth performance-related indices. Second, the serum, head kidney, spleen and skin samples of six fish per treatment were collected and stored at −80 °C for analysis of the total cholesterol content, according to Deng et al. (2013) [18]. Third, the head kidney and spleen samples of twelve fish per treatment were weighed to calculate the index of head kidney and spleen in young grass carp, according the procedures reported by to Ni et al. (2016) [17].

2.5. Histological examination To observe the histopathological damage in head kidney and spleen of young grass carp after infection with A. hydrophila, the preserved head kidney and spleen were embedded in paraffin wax after dehydration and clear. Then tissue was sectioned to 4 μm. Sections were stained using standard hematoxylin and eosin (H & E) and examined by a Nikon TS100 light microscope according to Wu et al. (2016) [37].

2.3. Infection trial and sample collection A. hydrophila (FDL20120711) was kindly provided by the College of Veterinary Medicine, Sichuan Agricultural University, China and cultured according to the procedures reported by Shoemaker et al. (2008) [34]. After the growth trial, 15 fish (similar body weight) from each dietary treatment were infected by intraperitoneal injection with 1.0 mL of A. hydrophila (2.5 × 108 CFU mL−1) for each individual after the acclimatization period. Simultaneously, another 15 fish from the C0 group were inoculated with a sterile saline solution as a control (noninfected) group. The infection trial lasted 14 d, and the dosage of A. hydrophila that could effectively induce an inflammation response and consequently enable the investigation of fish reactivity against a threatening disease was nonlethal according to preliminary tests (data was not shown), referring to the method described by Nya and Austin (2011) [35]. The managements during the infection trial were the same as those during the growth trial. At the end of infection trial, first, the skin haemorrhage and lesion morbidity in grass carp was evaluated according to Song et al. (2014) [36]. Second, all experimental fish were sacrificed, and the head kidney and spleen samples of three fish per treatment were collected and preserved in 4% paraformaldehyde for histological examination according to Wu et al. (2016) [37]. Simultaneously, the head kidney, spleen and skin samples of the remaining fish per treatment were quickly removed, frozen in liquid nitrogen, and then stored at −80 °C for subsequent determination according to Xu et al. (2016) [25]. Additionally, by comparing the determination in samples of C0 + saline and C0 + A. hydrophila group, we established a successful model of A. hydrophila infection test for analysing the immune response in fish (Supplementary Figs. 1, 2 and 3).

2.6. Real-time quantitative PCR The procedures of RNA extraction, reverse transcription and quantitative real-time PCR were similar to the previous study in our laboratory [42]. Total RNA were extracted from the head kidney, spleen and skin using RNAiso Plus Kit (Takara, Dalian, China). The purity of RNA was assessed by spectrophotometry at 260 and 280 nm, and electrophoresis on 1% agarose gels. Subsequently, the PrimeScript™ RT reagent Kit (Takara) was used to synthesize the first-strand cDNA using the total RNA. For quantitative real-time PCR, PCR specific primers were designed according to the sequences cloned in our laboratory and the published sequences of grass carp in the National Center for Biotechnology Information (NCBI) (Table 2). The threshold cycle (Ct) value was obtained from the CFX96™ Real-Time PCR system software (Bio-Rad). According to the results of our preliminary experiment concerning the evaluation of internal control genes (data not shown), βactin was used as a reference gene to normalize cDNA loading. The target and housekeeping gene amplification efficiency were calculated according to the specific gene standard curves generated from 10-fold serial dilutions. The relative expression levels of target genes were determined by the 2−ΔΔCT method according to Torrecillas et al. (2015) [43]. 2.7. Western blot analysis The processes for head kidney, spleen and skin protein extract preparation and Western blotting are the same as those described by Jiang et al. (2016) [44]. Briefly, after extraction, the protein concentrations were determined with the BCA assay kit (Beyotime Biotechnology Inc., Jiangsu, China). Equal amounts of protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a PVDF membrane. The membranes were blocked for 1 h at room temperature (RT), washed thrice with TBST (10 min each), and incubated with primary antibody overnight at 4 °C. We used the same primary antibodies, namely, total TOR, Phospho-TOR (Ser2448), β-actin and lamin B1, as those used in our

2.4. Biochemical analysis Analysis of DM (105 °C, 24 h), crude protein (micro-Kjeldahl method) and crude lipid (ether extraction by Soxhlet method) in feed ingredients and experimental diets were performed following standard laboratory procedures (AOAC 2000). Gross energy of experimental diets was determined by an XYR-1 bomb calorimeter. The total cholesterol content in experimental diets, serum, head kidney, spleen and 204

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Table 2 Real-time PCR primer sequencesa. Target gene

Primer sequence Forward (5’→3′)

Primer sequence Reverse (5’→3′)

Temperature (°C)

Accession number

hepcidin LEAP-2A LEAP-2B β-defensin-1 Mucin2 IL-1β IL-6 IL-8 IL-12p35 IL-12p40 IL-15 IL-17D TNF-α IFN-γ2 IL-4/13A IL-4/13B IL-10 IL-11 TGF-β1 TGF-β2 NF-κB p52 NF-κB p65 c-Rel IκBα IKKα IKKβ IKKγ TOR S6K1 4E-BP1 4E-BP2 p38 MAPK β-actin

AGCAGGAGCAGGATGAGC TGCCTACTGCCAGAACCA TGTGCCATTAGCGACTTCTGAG TTGCTTGTCCTTGCCGTCT GAGTTCCCAACCCAACACAT AGAGTTTGGTGAAGAAGAGG CAGCAGAATGGGGGAGTTATC ATGAGTCTTAGAGGTCTGGGT TGGAAAAGGAGGGGAAGATG ACAAAGATGAAAAACTGGAGGC CCTTCCAACAATCTCGCTTC GTGTCCAGGAGAGCACCAAG CGCTGCTGTCTGCTTCAC TGTTTGATGACTTTGGGATG CTACTGCTCGCTTTCGCTGT TGTGAACCAGACCCTACATAACC AATCCCTTTGATTTTGCC GGTTCAAGTCTCTTCCAGCGAT TTGGGACTTGTGCTCTAT TACATTGACAGCAAGGTGGTG TCAGTGTAACGACAACGGGAT GAAGAAGGATGTGGGAGATG GCGTCTATGCTTCCAGATTTACC TCTTGCCATTATTCACGAGG GGCTACGCCAAAGACCTG GTGGCGGTGGATTATTGG AGAGGCTCGTCATAGTGG TCCCACTTTCCACCAACT GCAATCTGCTGAGGATGTGA GCTGGCTGAGTTTGTGGTTG CACTTTATTCTCCACCACCCC TGGGAGCAGACCTCAACAAT GGCTGTGCTGTCCCTGTA

GCCAGGGGATTTGTTTGT AATCGGTTGGCTGTAGGA ATGATTCGCCACAAAGGGG AATCCTTTGCCACAGCCTAA AAAGGTCTACACAATCTGCCC TTATTGTGGTTACGCTGGA CTCGCAGAGTCTTGACATCCTT ACAGTGAGGGCTAGGAGGG AGACGGACGCTGTGTGAGTGTA GTGTGTGGTTTAGGTAGGAGCC AACACATCTTCCAGTTCTCCTT GCGAGAGGCTGAGGAAGTTT CCTGGTCCTGGTTCACTC TCAGGACCCGCAGGAAGAC CCCAGTTTTCAGTTCTCTCAGG TTCAGGACCTTTGCTGCTTG GTGCCTTATCCTACAGTATGTG TGCGTGTTATTTTGTTCAGCCA AGTTCTGCTGGGATGTTT TCTTGTTGGGGATGATGTAGTT ATACTTCAGCCACACCTCTCTTAG TGTTGTCGTAGATGGGCTGAG ACTGCCACTGTTCTTGTTCACC TGTTACCACAGTCATCCACCA CGGACCTCGCCATTCATA GCACGGGTTGCCAGTTTG CTGTGATTGGCTTGCTTT ACACCTCCACCTTCTCCA AACCGACGAGGTGAACGA CGAGTCGTGCTAAAAAGGGTC TTCATTGAGGATGTTCTTGCC TACCATCGGGTGGCAACATA GGGCATAACCCTCGTAGAT

59.3 59.3 59.3 58.4 60.4 57.1 62.3 60.3 55.4 59.0 61.4 62.3 58.4 60.4 55.9 55.9 61.4 57.0 55.9 55.9 58.4 62.3 59.3 62.3 60.3 60.3 58.4 61.4 56.4 60.3 60.3 60.4 61.4

JQ246442.1 FJ390414 KT625603.1 KT445868.1 KT625602 JQ692172 KC535507.1 JN663841 KF944667.1 KF944668.1 KT445872.1 KF245426.1 HQ696609 JX657682 KT445871.1 KT625600.1 HQ388294 KT445870.1 EU099588 KM279716 KM279720 KJ526214 KT445865.1 KJ125069 KM279718 KP125491.1 KM079079 JX854449 KY939577 KT757305.1 KT757306.1 KM112098 M25013

a LEAP-2, liver expressed antimicrobial peptide 2; TNF-α, tumor necrosis factor α; IFN-γ2, interferon γ2; IL, interleukin; TGF-β, transforming growth factor β; NFκB, nuclear factor kappa B; IκBα, inhibitor of κBα; IKK, IκB kinase; TOR, target of rapamycin; S6K1, ribosomal protein S6 kinases 1; 4E-BP, eIF4E-binding proteins; p38 MAPK, p38 mitogen-activated protein kinase.

previous studies [44,45]. In addition, the anti-NF-κB p65 were purchased from Affinity BioReagents (Golden, Colorado, USA). The specificity of the anti-NF-κB p65 was previously determined according to Seiliez et al. (2008) [46]. Briefly, the alignment of the amino acid sequences of the peptides was used to produce polyclonal antibodies against the corresponding grass carp sequences and comparative Western blots of grass carp and murine samples. β-Actin and lamin B1 were used as control proteins for total and nuclear protein, respectively. Next, the membranes were washed three more times before incubation with HRP-conjugated secondary antibody in TBST for 2 h. Immune complexes were visualized with an ECL kit (Beyotime Biotechnology Inc., Jiangsu, China). Densitometric analyses of the protein bands were performed in ImageJ (NIH, USA). Different treatments were expressed relative to the level observed in the C0 group. The experiment was repeated at least three times, and similar results were obtained each time.

Head kidney index = 100 × [head kidney weight (g)/body weight (g)]; Spleen index = 100 × [spleen weight (g)/body weight (g)]. All data were subjected to one-way analysis of variance followed by Duncan's multiple range test to determine significant differences among the treatments at P < 0.05 with SPSS 20.0 (SPSS Inc., Chicago, IL, USA), as described by Hoseinifar et al. (2016) [48]. The results are represented as the means ± SD. The correlations were estimated by using Pearson's correlation test with SPSS 20.0. In addition, a quadratic regression model was used to estimate the optimal dietary cholesterol levels for young grass carp according to Ahmed et al. (2004) [49]. The relationship between dietary cholesterol and the growth performance, the LZ and ACP activities, as well as C3, C4 and IgM contents in the head kidney, spleen and skin were respectively subjected to a linear regression or quadratic regression model.

2.8. Calculations and statistical analysis

3. Results

The percent weight gain (PWG), specific growth rate (SGR) and feed efficiency (FE) were calculated by initial body weight (IBW), final body weight (FBW) and feed intake (FI), as described by Ni et al. (2016) [17]. The weight of head kidney and spleen were used to calculate the index of head kidney and spleen respectively, as described by Wu et al. (2013) [47].

3.1. Growth performance and immune organ growth of young grass carp As shown in Table 3, optimal dietary cholesterol significantly elevated FBW, PWG, SGR, FI, FE as well as the weight and index of the head kidney and spleen (P < 0.05). The total cholesterol level in the head kidney was significantly improved with the increase of dietary cholesterol levels up to 1.526% (P < 0.05). The total cholesterol levels in serum, spleen and skin were significantly improved with the increased dietary cholesterol levels up to 1.243% (P < 0.05) and plateaued thereafter (P > 0.05).

PWG = 100 × [FBW (g fish−1) – IBW (g fish−1)]/IBW (g fish−1); SGR = 100 × ln [FBW (g fish−1)/IBW (g fish−1)]/days; FE = 100 × [FBW (g fish−1) – IBW (g fish−1)]/FI (g fish−1); 205

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Table 3 Growth performance,a head kidney and spleen weight (g), index (%) and total cholesterol concentrations in serum, head kidney (wet matter), spleen (wet matter) and skin (wet matter) of young grass carp (Ctenopharyngodon idellus) fed diets containing graded levels of cholesterol for 60 days. Cholesterol in the diet (% diet) 0.041 225.56 ± 0.38a IBWb FBWb 734.45 ± 8.11a PWGb 225.61 ± 3.19a SGRb 1.97 ± 0.02a FIb 809.77 ± 16.95b FEb 0.63 ± 0.005a Head kidney Weightc 1.043 ± 0.085a Indexc 0.146 ± 0.007a Spleen Weightc 0.833 ± 0.071a Indexc 0.117 ± 0.005a Total cholesterol Serum (mmol l−1)d 3.90 ± 0.30a Head kidney (g kg−1)d 0.50 ± 0.03a Spleen (g kg−1)d 0.59 ± 0.04a Skin (g kg−1)d 0.39 ± 0.03a Regressions YFBW = −320.1753x2 + 461.1324x + 727.5265 YPWG = −142.2841x2 + 205.2958x + 222.4701 YSGR = −0.6626x2 + 0.9547x + 1.9532 YFI = −261.1068x2 + 369.1299x + 806.6834 YFE = −0.1677x2 + 0.2465x + 0.6229 YHead kidney weight = −1.1861x2 + 2.0286x + 0.9972 YHead kidney index = −0.0730x2 + 0.1448x + 0.1445 YSpleen weight = −0.6395x2 + 0.9405x + 0.8053 YSpleen index = 0.0318x2 + 0.0458x + 0.1153

0.334

0.636

0.932

1.243

1.526

225.56 ± 0.38a 846.22 ± 14.31c 275.18 ± 6.64c 2.20 ± 0.03c 904.68 ± 3.98c 0.69 ± 0.013c

225.33 ± 0.38a 933.56 ± 11.12d 314.31 ± 6.11d 2.37 ± 0.02d 970.90 ± 3.90d 0.73 ± 0.009d

225.11 ± 0.67a 863.89 ± 13.77c 283.76 ± 5.89c 2.24 ± 0.03c 911.07 ± 7.14c 0.70 ± 0.010c

225.56 ± 0.38a 763.63 ± 19.17b 238.56 ± 8.89b 2.03 ± 0.04b 823.54 ± 19.47b 0.65 ± 0.011b

225.11 ± 0.38a 712.11 ± 16.07a 216.34 ± 6.88a 1.92 ± 0.04a 786.04 ± 14.21a 0.62 ± 0.015a

1.536 ± 0.138c 0.188 ± 0.006b

1.962 ± 0.142e 0.215 ± 0.011e

1.788 ± 0.070d 0.210 ± 0.006de

1.560 ± 0.098c 0.206 ± 0.010cd

1.414 ± 0.095b 0.200 ± 0.006c

1.033 ± 0.100bc 0.127 ± 0.006b

1.211 ± 0.105d 0.132 ± 0.006b

1.111 ± 0.078c 0.130 ± 0.009b

0.922 ± 0.067b 0.122 ± 0.009b

0.789 ± 0.078a 0.112 ± 0.007a

10.08 ± 0.53d 0.88 ± 0.07c 0.97 ± 0.08d 0.77 ± 0.06d

10.59 ± 0.85d 0.99 ± 0.08d 1.04 ± 0.04d 0.75 ± 0.03cd

R2 = 0.8740 R2 = 0.8718 R2 = 0.8910 R2 = 0.8604 R2 = 0.9177 R2 = 0.8949 R2 = 0.9440 R2 = 0.9224 R2 = 0.9942

P < 0.05 P < 0.05 P < 0.05 P = 0.052 P < 0.05 P < 0.05 P < 0.05 P < 0.05 P < 0.01

4.47 0.57 0.69 0.45

± ± ± ±

0.18ab 0.04a 0.06b 0.04a

5.18 0.72 0.85 0.69

± ± ± ±

0.22bc 0.04b 0.04c 0.03bc

5.92 0.73 0.83 0.66

± ± ± ±

0.50c 0.04b 0.06c 0.04b

a IBW: Initial body weight (g fish−1); FBW: final body weight (g fish−1); PWG: percent weight gain (%); SGR: specific growth rate (%/day); FI: feed intake (g fish−1); FE: feed efficiency (%). b Values are means ± SD for three replicate groups, with 30 fish in each group, and different superscripts in the same row are significantly different (P < 0.05). c Values are means ± SD (n = 12), and different superscripts in the same row are significantly different (P < 0.05). d Values are means ± SD (n = 6), and different superscripts in the same row are significantly different (P < 0.05).

decreased the skin haemorrhage and lesion morbidity (P < 0.05). As shown in Fig. 2, in the head kidney, the extravasated blood, increased macrophage numbers and haemosiderosis were observed in fish fed 0.041% cholesterol diets (Fig. 2A), and extravasated blood was observed in fish fed 1.526% cholesterol diets (Fig. 2C). In the spleen, haemorrhage were observed in fish fed 0.041 and 1.526% cholesterol diets (Fig. 2D and F).

3.2. Skin haemorrhage and lesion morbidity as well as histopathological examination of immune organs in young grass carp after infection with A. hydrophila As displayed in Fig. 1, compared with fish fed a diet containing 0.0932%, 0.041 and 1.526% cholesterol diets led to obvious skin haemorrhage and lesions. Additionally, optimal dietary cholesterol

Fig. 1. The skin haemorrhage and lesions in young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days, and then infected with A. hydrophila for 14 days. (A) Low or excess levels of dietary cholesterol led to obvious skin haemorrhage and lesions, compared to optimal dietary cholesterol level in young grass carp (Ctenopharyngodon idella). (B) The skin haemorrhage and lesion morbidity in young grass carp (Ctenopharyngodon idella). Data are expressed as means of three replicate groups, with 5 fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05). 206

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 2. The histology of head kidney and spleen in young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days, and then infected with A. hydrophila for 14 days. Head kidney: A) The C0 group. Trilateral showed the extravasated blood. Square showed the increased macrophage numbers and haemosiderosis. B) The C0.9 group. C) The C1.5 group. Trilateral showed the extravasated blood. Spleen: D) The C0 group. Circle showed the haemorrhage. E) The C0.9 group. F) The C1.5 group. Circle showed the haemorrhage. The sections were H&E staining and observed at 400× original magnification. The size of original images were 1280×1024, and they appeared in the communication were 438×402.

dietary cholesterol significantly improved the LZ activity, as well as C3, C4 and IgM contents (P < 0.05). Additionally, optimal dietary cholesterol significantly enhanced the ACP activity in the head kidney and spleen (P < 0.05), while dietary cholesterol significantly enhanced the ACP activity in the skin (P < 0.05). As presented in Fig. 3, in the head kidney, optimal dietary

3.3. Immunological parameters in immune organs of young grass carp after infection with A. hydrophila 3.3.1. Innate and adaptive immune components in the head kidney, spleen and skin As shown in Table 4, in the head kidney, spleen and skin, optimal

Table 4 Immune parameters in the head kidney, spleen and skin of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days.a Cholesterol in the diet (% diet) 0.041

0.334

Head kidney 237.03 ± 8.90bc LZ 206.55 ± 6.45a ACP 209.19 ± 9.41a 238.73 ± 9.70b C3 18.22 ± 1.49a 20.79 ± 1.58b C4 5.02 ± 0.36a 8.00 ± 0.39c IgM 49.54 ± 4.52ab 53.31 ± 3.28bc Spleen LZ 123.13 ± 4.72a 132.66 ± 8.60b ACP 255.28 ± 11.13a 270.85 ± 9.79b C3 25.39 ± 0.99a 30.83 ± 1.73b C4 6.94 ± 0.52a 8.34 ± 0.44b IgM 54.24 ± 5.32a 63.86 ± 4.77b Skin LZ 129.63 ± 11.72a 152.03 ± 8.96b ACP 186.78 ± 15.31a 206.08 ± 13.78ab C3 20.16 ± 1.58a 21.46 ± 2.04ab C4 5.18 ± 0.52a 6.71 ± 0.61b IgM 111.40 ± 9.14a 117.35 ± 6.34abc Regressions YLZ in head kidney = −70.6069x2 + 113.2149x + 203.9359 YACP in head kidney = −85.0825x2 + 134.1314x + 204.1396 YC3 in head kidney = −7.9805x2 + 12.2135x + 17.9278 YC4 in head kidney = −11.6578x2 + 19.1211x + 3.9302 YIgM in head kidney = −11.5601x2 + 16.4909x + 49.0335 YLZ in spleen = −45.2394x2 + 82.3215x + 116.7948 YACP in spleen = −77.1370x2 + 119.0872x + 248.2319 YC3 in spleen = −23.1446x2 + 40.5761x + 22.7639 YC4 in spleen = −5.8216x2 + 9.2522x + 6.3362 YIgM in spleen = −27.5276x2 + 48.6748x + 52.1597 YLZ in skin = −92.8868x2 + 160.3389x + 118.4809 YACP in skin = 68.9031x + 182.6049 Ymax = 204.7650 YC3 in skin = −10.9993x2 + 19.3656x + 18.3933 YC4 in skin = −6.8663x2 + 11.4524x + 4.3723 YIgM in skin = −21.1663x2 + 34.6564x + 109.3719

0.636

0.932

1.243

1.526

248.08 ± 12.01d 255.68 ± 11.71c 24.19 ± 1.41c 12.01 ± 0.88d 55.16 ± 4.20c

245.95 ± 7.71cd 260.47 ± 12.85c 21.15 ± 0.97b 12.60 ± 0.93d 54.52 ± 3.46bc

234.61 ± 7.98b 231.01 ± 9.13b 20.35 ± 1.89b 8.22 ± 0.34c 50.86 ± 4.58abc

213.46 ± 7.60a 214.24 ± 5.31a 18.44 ± 1.50a 6.51 ± 0.45b 47.70 ± 3.94a

153.12 ± 3.86cd 301.24 ± 12.09c 41.61 ± 2.40d 10.01 ± 0.73c 74.58 ± 5.88c

156.86 ± 7.51d 295.42 ± 13.23c 40.88 ± 1.78d 9.78 ± 0.90c 73.49 ± 5.11c

148.35 ± 5.43c 267.70 ± 12.89ab 36.07 ± 1.93c 9.26 ± 0.37c 67.81 ± 6.06bc

136.59 ± 5.17b 254.30 ± 9.15a 31.27 ± 2.10b 6.67 ± 0.64a 63.54 ± 5.83b

184.11 ± 8.51cd 221.44 ± 21.01bc 26.74 ± 1.63d 8.96 ± 0.40d 122.47 ± 9.13bc

194.46 ± 15.61d 250.00 ± 21.78d 28.63 ± 2.23d 9.63 ± 0.78d 125.40 ± 6.91c

171.00 ± 11.67c 256.06 ± 21.16d 24.25 ± 1.93c 7.75 ± 0.64c 118.33 ± 8.85abc

146.57 ± 11.31b 242.24 ± 16.43cd 22.52 ± 1.37bc 5.84 ± 0.31a 113.25 ± 6.01ab

R2 = 0.9856 R2 = 0.9494 R2 = 0.7873 R2 = 0.8911 R2 = 0.9776 R2 = 0.9233 R2 = 0.8672 R2 = 0.9128 R2 = 0.9512 R2 = 0.9439 R2 = 0.9401 R2 = 0.9827 R2 = 0.7997 R2 = 0.9342 R2 = 0.9389

P < 0.05 P < 0.05 P = 0.098 P < 0.05 P < 0.05 P < 0.05 P < 0.05 P = 0.090 P < 0.05 P < 0.05 P < 0.05 P < 0.05 P = 0.090 P < 0.05 P < 0.05

a Values are means ± SD (n = 6), and superscripted different letters in the same row are significantly different (P < 0.05). LZ: Lysozyme (U mg−1 protein); ACP: acid phosphatase (U mg−1 protein); C3: complement component 3 (mg g−1 protein); C4: complement component 4 (mg g−1 protein); IgM: immunoglobulin M (mg g−1 protein).

207

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 3. Relative mRNA levels of hepcidin, LEAP-2A, LEAP-2B, β-defensin-1 and Mucin2 in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of six fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

208

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 4. Relative mRNA levels of pro-inflammatory cytokines in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of six fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

209

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 5. Relative mRNA levels of NF-κB p65, NF-κB p52, c-Rel, IκBα, IKKα, IKKβ and IKKγ in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of six fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

210

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 6. Western blot analysis of Nuclear NF-κB p65 in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of three fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

down-regulated the mRNA levels of IL-8, IL-15, IKKβ and IKKγ (P < 0.05). Dietary cholesterol down-regulated the mRNA level of IFNγ2 (P < 0.05). Moreover, optimal dietary cholesterol up-regulated the IκBα mRNA level (P < 0.05). In the skin, optimal dietary cholesterol down-regulated the mRNA levels of IL-15, IFN-γ2, and IKKβ (P < 0.05). Dietary cholesterol down-regulated the mRNA levels of IL8 and IKKγ (P < 0.05). In addition, optimal dietary cholesterol upregulated the IκBα mRNA level (P < 0.05). However, dietary cholesterol had no influences on the IL-1β and IL-12p40 mRNA levels in the spleen and skin (P > 0.05), as well as IKKα in the head kidney, spleen and skin (P > 0.05).

cholesterol up-regulated the hepcidin and Mucin2 mRNA levels (P < 0.05). Moreover, dietary cholesterol up-regulated the LEAP-2A, LEAP-2B and β-defensin-1 mRNA levels (P < 0.05). In the spleen, optimal dietary cholesterol up-regulated the hepcidin, LEAP-2A, β-defensin-1 and Mucin2 mRNA levels (P < 0.05). Dietary cholesterol upregulated the LEAP-2B mRNA levels (P < 0.05). In the skin, optimal dietary cholesterol up-regulated the Mucin2 mRNA level (P < 0.05). Dietary cholesterol up-regulated the hepcidin, LEAP-2A and LEAP-2B mRNA levels (P < 0.05). However, dietary cholesterol had no effect on the mRNA levels of β-defensin-1 in the skin (P > 0.05).

3.3.2. The pro-inflammatory cytokines and related signalling molecules in the head kidney, spleen and skin As displayed in Figs. 4–6, in the head kidney, spleen and skin, optimal dietary cholesterol down-regulated the mRNA levels of IL-6, IL12p35, IL-17D, TNF-α, NF-κB p65, NF-κB p52 and c-Rel (P < 0.05), and decreased the nuclear NF-κB p65 protein levels (P < 0.05). In the head kidney, optimal dietary cholesterol down-regulated the mRNA levels of IL-1β, IL-8 and IFN-γ2 (P < 0.05). Dietary cholesterol downregulated the mRNA levels of IL-12p40, IL-15, IKKβ and IKKγ (P < 0.05). Additionally, dietary cholesterol up-regulated the mRNA levels of IκBα (P < 0.05). In the spleen, optimal dietary cholesterol

3.3.3. The anti-inflammatory cytokines and related signalling molecules in the head kidney, spleen and skin As shown in Figs. 7–9, in the head kidney, spleen and skin, optimal dietary cholesterol up-regulated the mRNA levels of IL-10 and IL-11 (P < 0.05), as well as increased the Phospho-TOR (Ser2448) and TTOR protein levels (P < 0.05). In the head kidney, optimal dietary cholesterol up-regulated the mRNA level of S6K1 (P < 0.05). Dietary cholesterol up-regulated the mRNA levels of IL-4/13B, TGF-β1, TGF-β2 and TOR (P < 0.05). In addition, optimal dietary cholesterol downregulated the mRNA level of 4E-BP2 (P < 0.05). Dietary cholesterol 211

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 7. Relative mRNA levels of anti-inflammatory cytokines in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of six fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

212

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 8. Relative mRNA levels of TOR, S6K1, 4E-BP1, 4E-BP2 and p38 MAPK in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of six fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

213

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Fig. 9. Western blot analysis of TOR protein phosphorylation at Ser2448 in the head kidney (A), spleen (B) and skin (C) of young grass carp (Ctenopharyngodon idella) fed diets containing graded levels of cholesterol for 60 days. Data are expressed as means of three fish in each group, error bars indicate S.D. Values having different letters are significantly different (P < 0.05).

However, dietary cholesterol had no effect on the mRNA levels of IL-4/ 13A and p38MAPK in the head kidney, spleen and skin (P > 0.05).

down-regulated the mRNA level of 4E-BP1 (P < 0.05). In the spleen, optimal dietary cholesterol up-regulated the mRNA level of S6K1 (P < 0.05). Dietary cholesterol up-regulated the mRNA levels of IL-4/ 13B, TGF-β1, TGF-β2 and TOR (P < 0.05). Optimal dietary cholesterol down-regulated the mRNA level of 4E-BP1 (P < 0.05). Dietary cholesterol down-regulated the mRNA level of 4E-BP2 (P < 0.05). In the skin, optimal dietary cholesterol up-regulated the mRNA levels of IL-4/ 13B, TGF-β1, TGF-β2 and TOR (P < 0.05). Dietary cholesterol upregulated the S6K1 mRNA level (P < 0.05). Optimal dietary cholesterol down-regulated the 4E-BP1 and 4E-BP2 mRNA levels (P < 0.05).

4. Discussion A. hydrophila, a gram-negative bacterium, can induce multiple inflammatory lesions (such as hemorrhagic septicemia) in grass carp [17,50]. In the present study, we established a model of A. hydrophila infection test to investigate the effect of dietary cholesterol on the immune response in fish. The immune response was dose-dependent to A. 214

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

4.3. The low level of dietary cholesterol aggravated inflammation response is partly related to NF-κB and TOR signalling pathways in the head kidney and spleen of fish

hydrophila infection in Indian major carp (L. rohita Ham) [51]. Previous studies have shown that the expression of immune-related genes (such as IL-1β, TNF-α, IL-10 and TGF-β2) showed a 5–20-fold change in juvenile Jian carp (Cyprinus carpio var. Jian) infected with a semi-lethal dosage of A. hydrophila [52], and a 1–2.5-fold change in grass carp infected with a nonlethal dosage [10,53]. Similarly, Kong et al. (2017) demonstrated that the gene expression of IL-1β and TNF-α was upregulated by 1–2.5-fold in grass carp after infection with A. hydrophila [54]. The above observations indicate that the expression of immunerelated genes is partly related to the dose of A. hydrophila infection in fish.

4.3.1. The low level of dietary cholesterol aggravated inflammation response by up-regulating pro-inflammatory cytokines partly through the NF-κB signalling pathway in the head kidney and spleen of fish In a previous study, we observed that the aggravated inflammation response was correlated with inflammatory disorders, which were accompanied with up-regulated pro-inflammatory cytokines and downregulated anti-inflammatory cytokines in fish [47]. In the present study, low levels of cholesterol up-regulated pro-inflammatory cytokines IL-6, IL-8, IL-12p35, IL-15, IL-17D, TNF-α and IFN-γ2 mRNA levels in the head kidney and spleen of young grass carp, suggesting that inadequate cholesterol aggravated the head kidney and spleen inflammation response in fish. Furthermore, the expression of pro-inflammatory cytokines was closely related to the signalling regulator of NF-κB in the HMC-1 human mast cell line [65]. Therefore, we next investigated the influence of cholesterol on NF-κB signalling in the head kidney and spleen of fish. In humans, NF-κB p65, NF-κB p52 and c-Rel are important members of the NF-κB family [66], and the NF-κB signalling could induce proinflammatory cytokines expression, which is closely related to the nuclear translocation of NF-κB [67]. The nuclear translocation of NF-κB could be assessed by the measuring nuclear NF-κB protein level [68]. In the present study, low levels of dietary cholesterol increased the nuclear NF-κB p65 protein levels in the head kidney and spleen of young grass carp, suggesting that insufficient dietary cholesterol induced the nuclear translocation of NF-κB p65, thus resulting in the activation of NFκB p65 signalling in fish. Correlation analyses (Table 5) showed that pro-inflammatory cytokines (IL-6, IL-8, IL-12p35, IL-15, IL-17D, TNF-α and IFN-γ2) were positively correlated with the nuclear NF-κB p65 protein in the head kidney and spleen of young grass carp. These results implied that insufficient cholesterol up-regulated pro-inflammatory cytokines expression by activating the NF-κB signalling in the head kidney and spleen of fish. The potential reasons why insufficient cholesterol increased the nuclear NF-κB p65 protein level in fish are explained as follows. First, insufficient cholesterol increased the nuclear NF-κB p65 protein level, in part due to the promotion of the de novo synthesis of NF-κB protein in fish. We found that low levels of cholesterol up-regulated the NF-κB p65 mRNA levels in the head kidney and spleen of young grass carp, suggesting that inadequate cholesterol could activate the de novo synthesis of NF-κB p65 protein, thereby increasing the nuclear NF-κB p65 protein levels in head kidney and spleen of fish. Second, inadequate cholesterol increased the nuclear NF-κB p65 protein levels might be related to IKKβ and IKKγ/IκBα in fish. In mammals, the nuclear translocation of NF-κB could be activated by IKK (including IKKα, IKKβ and IKKγ) through catalysing the degradation of IκBα [69]. In the present study, low levels of cholesterol up-regulated the IKKβ and IKKγ (rather than IKKα) mRNA levels and down-regulated IκBα mRNA levels in the head kidney and spleen of young grass carp. These results suggested that inadequate cholesterol activated IKKβ and IKKγ/IκBα and subsequently increased the nuclear NF-κB p65 protein levels in fish. Additionally, low levels of cholesterol also up-regulated the NF-κB p52 and c-Rel mRNA levels in head kidney and spleen of young grass carp. Correlation analyses (Table 5) indicated that pro-inflammatory cytokines (IL-8, IL-12p35, IL-15, IL-17D, TNF-α and IFN-γ2) were positively correlated with the NF-κB p52 and c-Rel mRNA levels in the head kidney and spleen of young grass carp. Simultaneously, the nuclear NFκB p65 protein levels, and NF-κB p52 and c-Rel mRNA levels were negatively correlated with IkBα, which was inversely related to the IKKβ and IKKγ mRNA levels. The above data indicated that inadequate cholesterol up-regulated the pro-inflammatory cytokines expression, partially resulting from the activation of [IKKβ and IKKγ (rather than IKKα)/IkBα/NF-κB (P65, P52 and c-Rel)] signalling pathway, thus aggravating the inflammation response in the head kidney and spleen of

4.1. The low level of dietary cholesterol reduced growth and resistance to A. hydrophila infection in fish In the present study, low levels of cholesterol decreased the growth performance and immune organ growth of young grass carp. Based on the quadratic regression analysis of PWG (Table 6), the optimal dietary cholesterol level for young grass carp was 0.721%. The growth performance and immune organ size were directly correlated with fish immunity, which was related to the resistance to pathogenic bacteria infection [25,55]. In the present study, a low level of dietary cholesterol induced the highest skin haemorrhage and lesion morbidity (18.60%) following infection with A. hydrophila, while optimal dietary cholesterol decreased the morbidity (5.07%) (Fig. 1). Based on the quadratic regression analysis, the optimal dietary cholesterol level for protecting young grass carp against skin haemorrhage and lesions was 0.826% (Table 6). In addition, the C0 group revealed the extravasated blood, increased macrophage numbers and haemosiderosis in the head kidney, as well as the haemorrhage in the spleen of young grass carp infected with A. hydrophila (Fig. 2). These data suggested that a low level of dietary cholesterol might depress the resistance to A. hydrophila infection in fish. The resistance to A. hydrophila infection can be impacted by immunity which relies on the immune response of immune organs in fish [10]. Hence, we next investigated the effect of dietary cholesterol on the immune response of immune organs in young grass carp after infection of A. hydrophila. 4.2. The low level of dietary cholesterol impaired immunity by decreasing innate and adaptive immune components production in the head kidney and spleen of fish In fish, the immunity relies on the immune response which is closely associated with innate and adaptive immune components such as LZ, ACP, complement system, antibacterial peptides and immunoglobulins [56]. The present results showed that low levels of cholesterol decreased the LZ and ACP activities, C3, C4 and IgM contents, and downregulated the hepcidin, LEAP-2A, LEAP-2B, β-defensin-1 and Muin2 mRNA levels in the head kidney and spleen of young grass carp. These data indicated that inadequate cholesterol impaired the immunity, which may be attributed to the decreased innate and adaptive immune components in the head kidney and spleen of fish. This finding might be partly ascribed to the inhibition of immune cells proliferation or accumulation. As we know, the neutrophils and lymphocytes within head kidney and spleen are involved in the production of innate and adaptive immune components in fish [12,57–59]. Studies observed that low levels of cholesterol decreased peripheral blood lymphocyte proliferation in human [60], and depressed the accumulation of neutrophils in zebrafish [61]. Thus, we hypothesized that insufficient dietary cholesterol decreased innate and adaptive immune components is partly related to the inhibition of lymphocytes proliferation or neutrophils accumulation in fish, which needs further investigation. Fish immunity is also bound up with inflammation response which is primarily mediated by cytokines [62] and related signalling molecules [63,64]. Therefore, we next examined the effect of dietary cholesterol on inflammatory cytokines and related signalling molecules in the head kidney and spleen of fish. 215

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

of young grass carp could partly be ascribed to the up-regulated IL-1β only in the head kidney (rather than the spleen). IL-1β could up-regulate the expression of IL-12p40 in HK cells of Atlantic salmon (Salmo salar) [70]. The present study demonstrated that low levels of cholesterol only up-regulated the IL-1β mRNA level in head kidney (rather than the spleen) of young grass carp, supporting our hypothesis. Second, low levels of dietary cholesterol only up-regulated the mRNA level of IL-1β in head kidney (rather than the spleen) of young grass carp could partly be correlated with SATA3 altering the glucocorticoid receptor. The low level of cholesterol could decrease hepatic SATA3 activity in mice [71], and the lack of STAT3 could decrease the glucocorticoid receptor activity in rat [72]. The decreased glucocorticoid receptor up-regulated the IL-1β mRNA level in the macrophages of mice [73]. Importantly, the expression level of glucocorticoid receptor was higher in the head kidney than the spleen of Eurasian perch (Perca fluviatilis) [74]. Hence, we hypothesized that inadequate dietary cholesterol down-regulated SATA3 activity, partly resulting in decreasing glucocorticoid receptor activity only in the head kidney (rather than the spleen), thus leading to the up-regulation of IL-1β only in the head kidney (rather than the spleen) of fish. However, this hypothesis warrants further verification. Third, low levels of cholesterol up-regulated the IKKβ and IKKγ (rather than IKKα) mRNA levels in head kidney and spleen of young grass carp may partly be related to IFN-γ altering PKCζ. In the present study, we observed that lows level of cholesterol upregulated the IFN-γ mRNA levels in head kidney and spleen of young grass carp. IFN-γ could enhance the mice C2C12 myoblasts PKCζ levels [75], which could up-regulate IKKβ and IKKγ but not IKKα expression in rats [76]. Hence, we presume that insufficient dietary cholesterol upregulated the IFN-γ mRNA level, resulting in increasing the PKCζ level, thus leading to the up-regulation of IKKβ and IKKγ (rather than IKKα) in head kidney and spleen of fish. However, further investigation should be conducted to support this hypothesis. Moreover, apart from the up-regulation of pro-inflammatory cytokines, the down-regulation of anti-inflammatory cytokines also aggravated the inflammatory response in fish [77]. Then, we examined the effect of cholesterol on antiinflammatory cytokines in the head kidney and spleen of fish.

Table 5 Correlation coefficient of parameters in the head kidney and spleen. Independent parameters

Dependent parameters

Head kidney

Spleen

Correlation coefficients

P

Correlation coefficients

P

Nuclear NF-κB p65

IL-1β IL-6 IL-8 IL-12p35 IL-12p40 IL-15 IL-17D TNF-α IFN-γ2

+0.756 +0.802 +0.838 +0.980 +0.684 +0.648 +0.876 +0.929 +0.687

= 0.082 = 0.055 < 0.05 < 0.01 = 0.134 = 0.164 < 0.05 < 0.01 = 0.132

– +0.875 +0.870 +0.892 – +0.836 +0.968 +0.737 +0.869

– < 0.05 < 0.05 < 0.05 – < 0.05 < 0.01 = 0.095 < 0.05

NF-κB p52

IL-1β IL-6 IL-8 IL-12p35 IL-12p40 IL-15 IL-17D TNF-α IFN-γ2

+0.934 +0.518 +0.957 +0.857 +0.795 +0.766 +0.937 +0.835 +0.880

< 0.01 = 0.293 < 0.01 < 0.05 = 0.058 = 0.076 < 0.01 < 0.05 < 0.05

– +0.762 +0.890 +0.835 – +0.790 +0.814 +0.837 +0.825

– = 0.078 < 0.05 < 0.05 – = 0.062 < 0.05 < 0.05 < 0.05

c-Rel

IL-1β IL-6 IL-8 IL-12p35 IL-12p40 IL-15 IL-17D TNF-α IFN-γ2

+0.807 +0.675 +0.783 +0.808 +0.668 +0.660 +0.875 +0.888 +0.966

= 0.052 < 0.141 = 0.065 = 0.052 = 0.147 = 0.154 < 0.05 < 0.05 < 0.01

– +0.861 +0.957 +0.905 – +0.839 +0.924 +0.934 +0.914

– < 0.05 < 0.01 < 0.05 – < 0.05 < 0.01 < 0.01 < 0.05

IkBα

Nuclear NFκB p65 NF-κB p52 c-Rel IKKβ IKKγ

−0.906

< 0.05

−0.936

< 0.01

−0.781 −0.781 −0.840 −0.776

= 0.067 = 0.067 < 0.05 = 0.070

−0.804 −0.933 −0.944 −0.841

= 0.054 < 0.01 < 0.01 < 0.05

Phospho-TOR (Ser2448)

IL-4/13B IL-10 IL-11 TGF-β1 TGF-β2

+0.793 +0.687 +0.910 +0.926 +0.618

= 0.060 = 0.131 < 0.05 < 0.01 = 0.191

+0.954 +0.783 +0.990 +0.921 +0.945

< 0.01 = 0.065 < 0.01 < 0.01 < 0.01

S6K1

IL-4/13B IL-10 IL-11 TGF-β1 TGF-β2

+0.741 +0.597 +0.916 +0.943 +0.608

= 0.092 = 0.229 < 0.05 < 0.01 = 0.200

+0.835 +0.648 +0.850 +0.904 +0.921

< 0.05 = 0.164 < 0.05 < 0.05 < 0.01

4E-BP1

IL-4/13B IL-10 IL-11 TGF-β1 TGF-β2

−0.786 −0.597 −0.867 −0.974 0.703

= 0.064 = 0.211 < 0.05 < 0.01 = 0.119

−0.926 −0.814 −0.982 −0.873 −0.898

< 0.01 < 0.05 < 0.01 < 0.05 < 0.05

4E-BP2

IL-4/13B IL-10 IL-11 TGF-β1 TGF-β2

−0.718 −0.584 −0.948 −0.932 −0.589

= 0.108 = 0.224 < 0.01 < 0.01 = 0.219

−0.825 −0.364 −0.756 −0.907 −0.756

< 0.05 = 0.478 = 0.082 < 0.05 = 0.082

4.3.2. The low level of dietary cholesterol aggravated inflammation response via down-regulating anti-inflammatory cytokines partly through the TOR signalling pathway in the head kidney and spleen of fish Inflammation response could be attenuated by anti-inflammatory cytokines such as TGF-β, IL-4/13A, IL-4/13B and IL-10 in fish [78,79]. In the present study, low levels of dietary cholesterol down-regulated anti-inflammatory cytokines IL-4/13B, IL-10, TGF-β1 and TGF-β2 mRNA levels in the head kidney and spleen of young grass carp, suggesting that insufficient cholesterol aggravated the inflammation response via down-regulating anti-inflammatory cytokines in fish. Furthermore, anti-inflammatory cytokines could be regulated by TOR signalling pathway in human monocytes, in which the Ser2448 phosphorylation of mTOR play a vital role [80]. Additionally, TOR signalling could activate S6K1 and inhibit 4E-BP in mammalians [81]. Our data displayed that low levels of cholesterol decreased the TOR protein and its phosphorylation (Ser2448) levels, down-regulated the TOR and S6K1 mRNA levels, and up-regulated the 4E-BP1 and 4EBP2 mRNA levels in the head kidney and spleen of young grass carp. Further correlation analyses (Table 5) indicated that anti-inflammatory cytokines (IL-4/13B and TGF-β1) were positively related to Phospho-TOR (Ser2448) protein and S6K1 mRNA levels and were negatively related to 4E-BP1 and 4E-BP2 mRNA levels in the head kidney and spleen of young grass carp. The above observations manifested that inadequate cholesterol down-regulated anti-inflammatory cytokines partially due to the suppressed TOR/(S6K1 and 4E-BP) signalling pathway in the head kidney and spleen of fish. Nevertheless, dietary cholesterol had no effect on the mRNA levels of IL-4/13A in the head kidney and spleen of young grass carp, which was partly ascribed to the unchanged p38MAPK and transcription

fish. However, we surprisingly found that low levels of dietary cholesterol up-regulated the IL-1β and IL-12p40 mRNA levels only in the head kidney (rather than the spleen), and only up-regulated the IKKβ and IKKγ (rather than IKKα) mRNA levels in the head kidney and spleen of young grass carp. The potential reasons for these diverse results are analysed as follows. First, low levels of dietary cholesterol up-regulated IL-12p40 mRNA level only in the head kidney (rather than the spleen) 216

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

cholesterol level is a risk factor for the development of the disorders of lipid regulation which could induce cardiovascular disease [90]. A previous study demonstrated that cholesterol-rich diets induced coronary atherosclerosis in Atlantic salmon [91]. Additionally, the plasma cholesterol level was 5.47–6.95 mmol l−1 for the good growth of juvenile turbot [92]. The present data showed that the serum cholesterol level increased to 10.59 mmol l−1 with increasing dietary cholesterol levels up to 1.526%. Thus, the poor growth of young grass carp fed an excessive cholesterol diet was likely due to the high serum cholesterol level, resulting in the dysfunction of lipid metabolism, but the precise mechanisms need further investigation.

factor GATA-3. The p38MAPK played a critical role in the phosphorylation of GATA-3 in human T cells [82]. The phosphorylation of GATA-3 could up-regulated the IL-4/13A gene expression in Fugu (Takifugu rubripes) [83]. In the present study, we observed that cholesterol had no effect on the p38MAPK mRNA levels in the head kidney and spleen of young grass carp, supporting our hypothesis. Additionally, in the present study, dietary cholesterol had no effect on the mRNA levels of p38MAPK in head kidney and spleen of young grass carp could partly be connected with vitamin D. Cholesterol serves as a precursor for vitamin D in animals [8]. It was reported that vitamin D had no influence on the p38MAPK mRNA expression in the intestine of juvenile Jian carp (Cyprinus carpio var. Jian) [84]. Therefore, we presume that cholesterol could increase vitamin D content, partly resulting in having no effect on the p38MAPK expression in head kidney and spleen of fish. However, the speculated reason still remains to be elucidated further.

4.5.2. Excessive cholesterol attenuated the innate and adaptive immunity in fish Interestingly, high level of cholesterol (1.526% diet) depressed the LZ activity, C3, C4 and IgM contents in the head kidney, spleen and skin, as well as decreased the ACP activity in the head kidney and spleen of young grass carp, suggesting that excessive cholesterol impaired the innate and adaptive immunity in fish. This finding might be partly related to the impaired function of macrophages. Macrophages play a role in the innate and adaptive immune systems of fish [93]. Studies have shown that cholesterol-rich diet accelerated the senescent macrophage phenotype in mice [94], and impaired the phagocytosis of macrophages in pigs [95]. Therefore, we speculated that excessive cholesterol could impair the function of macrophages, thus leading to the depression of innate and adaptive immunity in fish. However, this hypothesis warrants further verification.

4.4. The low level of dietary cholesterol impaired immunity and aggravated inflammation response in the skin of fish: compared with the head kidney and spleen Fish skin is a critical barrier to pathogen infection [85]. Skin haemorrhage and lesion morbidity could be used to evaluate the anti-infection ability of fish [86]. Our data showed that low levels of dietary cholesterol increased the skin haemorrhage and lesion morbidity of young grass carp after infection with A. hydrophila, indicating that insufficient cholesterol could depress the ability against skin haemorrhage and lesions of fish. In the present study, we compared with the results in the head kidney and spleen and detected several indices with different models in the skin of young grass carp. First, low levels of cholesterol only downregulated the mRNA levels of β-defensin-1 in the head kidney and spleen (rather than skin) of young grass carp, which might be partly related to the lack of proliferator-activated receptor-γ (PPARγ) expression in the skin. In mice, the low level of cholesterol decreased the protein expression level of epididymal adipose tissue PPARγ [87], which could up-regulate β-defensin-1 expression in colon [88]. Interestingly, PPARγ was expressed in the kidney and spleen (rather than the skin) of brown trout (Salmo trutta f. fario) [89]. Thus, we hypothesized that insufficient cholesterol decreased the PPARγ expression in kidney and spleen (rather than skin), leading to the down-regulation of β-defensin-1 expression in the kidney and spleen (rather than the skin) of fish. However, this hypothesis warrants further verification. Second, low levels of cholesterol up-regulated the IL-1β and IL-12p40 mRNA levels only in head kidney (rather than in the spleen and skin) of young grass carp. The potential reasons were the same as those explaining the variances between the spleen and head kidney mentioned above. Briefly, Milla et al. (2016) demonstrated that the expression level of glucocorticoid receptor was higher in the head kidney than in the spleen and skin of Eurasian perch [74]. Hence, we hypothesized that the low level of cholesterol decreased SATA3 activity partly resulting in the decreased glucocorticoid receptor activity only in the in the head kidney (rather than the spleen and skin), thus leading to the up-regulation of IL-1β and IL-12p40 mRNA levels only in the head kidney (rather than the spleen and skin) of fish. However, this hypothesis warrants further verification.

4.5.3. Excessive cholesterol aggravated inflammation response of the head kidney, spleen and skin in fish In the present study, the 1.526% diet up-regulated the mRNA levels of pro-inflammatory cytokines (IL-6, IL-12p35, IL-17D and TNF-α) and down-regulated the mRNA levels of anti-inflammatory cytokines (IL-10, and IL-11) in the head kidney, spleen and skin of young grass carp, suggesting that excessive cholesterol aggravated the inflammation response of the immune organs in fish. Excessive cholesterol aggravated inflammation response might be related to the activated NF-κB and the suppressed TOR signalling in fish. As mentioned above, in mammals, pro-inflammatory cytokines could be regulated by NF-κB [21] and antiinflammatory cytokines could be modulated by mTOR [22]. The present results showed that the 1.526% diet increased the nuclear NF-κB p65 protein levels, up-regulated the NF-kB p65, NF-kB p52 and c-Rel mRNA levels, as well as reduced the TOR protein and its phosphorylation levels in the head kidney, spleen and skin of young grass carp. These data suggested that excessive cholesterol activated NF-κB and suppressed TOR signalling, up-regulated the pro-inflammatory cytokines expression and down-regulated anti-inflammatory cytokines expression in fish. The mechanisms underlying these results are still unclear, and the potential reasons are analysed as follows. First, excessive cholesterol activated the NF-κB signalling may partially be related to the enhancement of Toll-like receptor 2 (TLR2) expression and the aggravated oxidative stress in fish. A recent study reported that a highcholesterol diet could enhance the expression level of TLR2 in macrophages and gut epithelial cells of goldfish (Carassius auratus) [96]. TLR2 could activate NF-κB in shrimp [97]. Additionally, cholesterol-rich diets could aggravate oxidative stress in liver of rats and rabbits [98], and oxidative stress could activate NF-κB in peripheral blood mononuclear cells (PBMC) in humans [99]. Thus, excessive cholesterol-activated NFκB signalling might be partly related to the enhancement of TLR2 expression and the aggravated oxidative stress in fish. However, the underlying reason for this effect still remains unknown. Second, excessive cholesterol suppressed TOR signalling might be partly attributed to vitamin C deficiency in fish. Excessive dietary cholesterol caused vitamin C deficiency in guinea pigs [24]. In a previous study, we demonstrated that vitamin C deficiency could suppress the TOR signalling in the head kidney of grass carp [25]. Thus, excessive cholesterol

4.5. Excessive cholesterol led to negative effect on growth performance and immune status in fish 4.5.1. Excessive cholesterol depressed growth performance in fish The present study observed that high level of cholesterol (1.526% diet) decreased the PWG, FI and FE in young grass carp, indicating that excessive cholesterol retard growth performance in fish. This finding could be partly explained by the high serum cholesterol level leading to the dysfunction of lipid metabolism in fish. In humans, high serum 217

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

that cholesterol could promote lymphocyte proliferation in humans [60]. Thus, more cholesterol might be required for the proliferation of immune cells in fish after infection with A. hydrophila.

Table 6 The optimal dietary cholesterol levels based on PWG, skin haemorrhage and lesion morbidity, LZ activity in head kidney and ACP activity in spleen of young grass carp (Ctenopharyngodon idella). Indices

Regression equation

R2

P

Optimal cholesterol levels

PWG

Y = −142.2841x2 + 205.2958x + 222.4701 Y = 19.9988x2 - 33.0393x + 19.3810 Y = −70.6069x2 + 113.2149x + 203.9359 Y = −77.1370x2 + 119.0872x + 248.2319

0.8718

< 0.05

0.721% diet

0.8809

< 0.05

0.826% diet

0.9856

< 0.05

0.802% diet

0.8672

< 0.05

0.772% diet

Morbidity LZ in head kidney ACP in spleen

5. Conclusions In summary (Fig. 10), the present study confirmed that the low level of dietary cholesterol impaired fish immunity, and for the first time, the results herein demonstrated that the low level of dietary cholesterol aggravated the inflammation response in fish, as well as provided partial theoretical evidence for the underlying molecular mechanisms. First, the low level of dietary cholesterol impaired immunity by depressing the production of innate and adaptive immune components in immune organs of fish. Second, the low level of dietary cholesterol aggravated inflammation response, mainly involving pro-/anti-inflammatory cytokines in immune organs of fish, which might partly be ascribed to the activated NF-κB signalling pathway and the suppressed TOR signalling pathway. Moreover, the low level of dietary cholesterol aggravated the inflammation response with un-changed expression levels of IKKα and IL-4/13A in the head kidney, spleen and skin of fish. The most interesting finding was that the low level of dietary cholesterol impaired immunity and aggravated inflammation response, which were different among the immune organs in fish. First, the low level of dietary cholesterol impaired the immunity by down-regulating β-defensin-1 expression only in the head kidney and spleen (rather than the skin) of fish. Second, the low level of dietary cholesterol aggravated inflammation response via up-regulating IL-1β and IL-12p40 expression only in the head kidney (rather than the spleen and skin) of fish. Furthermore, excessive cholesterol impaired immunity and aggravated the inflammation response in fish. In addition, based on quadratic regression for the PWG, the ability against skin haemorrhage and lesions, as well as the LZ activity in head kidney and the ACP activity in spleen, the optimal dietary cholesterol levels for young grass carp were estimated as 0.721, 0.826, 0.802 and 0.772%, respectively.

suppressed TOR signalling is partly ascribed to vitamin C deficiency in fish, which requires further investigation. In summary, excessive cholesterol up-regulated the pro-inflammatory cytokines expression and down-regulated the anti-inflammatory cytokines expression, which might be partially attributed to the enhanced TLR2 expression and the aggravated oxidative stress, as well as the vitamin C deficiency resulting in the activated NF-κB signalling and suppressed TOR signalling in fish. However, this finding requires further investigation.

4.6. Optimal dietary cholesterol levels for young grass carp based on different indices As shown in Table 6, based on the growth performance (PWG), the defence against skin haemorrhage and lesions, and the immune indices (the LZ activity in head kidney and the ACP activity in spleen), as the optimal dietary cholesterol levels for young grass carp (225–934 g) were estimated as 0.721, 0.826, 0.802 and 0.772% diet, respectively. The results indicated that the optimal dietary cholesterol levels based on the ability against skin haemorrhage and lesions and the immunerelated indices were slightly higher than that on the growth performance, suggesting that more dietary cholesterol was required for enhancing the immunity of fish. This phenomenon might be partially related to the proliferation of immune cells. A previous study observed

Acknowledgements This research was financially supported by the National Basic Research Program of China (973 Program) (2014CB138600), National

Fig. 10. Potential action pathways of inadequate dietary cholesterol impaired immunity and aggravated inflammation response in fish. 218

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

Department Public Benefit Research Foundation (Agriculture) of China (201003020), The Earmarked Fund for China Agriculture Research System (CARS-45), Outstanding Talents and Innovative Team of Agricultural Scientific Research (Ministry of Agriculture), Science and Technology Support Program of Sichuan Province of China (2014NZ0003), Major Scientific and Technological Achievement Transformation Project of Sichuan Province of China (2013NC0045), Foundation of Sichuan Youth Science and Technology Innovation Research Team (2017TD0002), The Demonstration of Major Scientific and Technological Achievement Transformation Project of Sichuan Province of China (2015CC0011) and the Modern Agricultural Industry Technology System of Sichuan Freshwater Fish Innovation Team. The authors would like to thank the personnel of these teams for their kind assistance.

[18]

[19]

[20] [21]

[22] [23]

Appendix A. Supplementary data

[24]

Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.fsi.2018.04.030.

[25]

References [1] D.M. Gatlin, F.T. Barrows, P. Brown, K. Dabrowski, T.G. Gaylord, R.W. Hardy, E. Herman, G. Hu, Å. Krogdahl, R. Nelson, Expanding the utilization of sustainable plant products in aquafeeds: a review, Aquacult. Res. 38 (6) (2007) 551–579. [2] C. Burrells, P. Williams, P. Southgate, V. Crampton, Immunological, physiological and pathological responses of rainbow trout (Oncorhynchus mykiss) to increasing dietary concentrations of soybean proteins, Vet. Immunol. Immunopathol. 72 (3) (1999) 277–288. [3] A. Sitjà-Bobadilla, S. Peña-Llopis, P. Gómez-Requeni, F. Médale, S. Kaushik, J. Pérez-Sánchez, Effect of fish meal replacement by plant protein sources on nonspecific defence mechanisms and oxidative stress in gilthead sea bream (Sparus aurata), Aquaculture 249 (1) (2005) 387–400. [4] Q. Zhou, M. Jin, Z.C. Elmada, X. Liang, K. Mai, Growth, immune response and resistance to Aeromonas hydrophila of juvenile yellow catfish, Pelteobagrus fulvidraco, fed diets with different arginine levels, Aquaculture 437 (2015) 84–91. [5] W.M. Sealey, D.M. Gatlin, In vitro manipulations of vitamin C and vitamin E concentrations alter intracellular O−2 production of hybrid striped bass (Morone chrysops×Morone saxatilis) head-kidney cells, Fish Shellfish Immunol. 12 (2) (2002) 131–140. [6] R.W. Hardy, Utilization of plant proteins in fish diets: effects of global demand and supplies of fishmeal, Aquacult. Res. 41 (5) (2010) 770–776. [7] E.A. Amaya, D.A. Davis, D.B. Rouse, Replacement of fish meal in practical diets for the Pacific white shrimp (Litopenaeus vannamei) reared under pond conditions, Aquaculture 262 (2) (2007) 393–401. [8] S.-S. Sheen, P.-C. Liu, S.-N. Chen, J.-C. Chen, Cholesterol requirement of juvenile tiger shrimp (Penaeus monodon), Aquaculture 125 (1) (1994) 131–137. [9] M. Maita, J. Maekawa, K.i. Satoh, K. Futami, S. Satoh, Disease resistance and hypocholesterolemia in yellowtail Seriola quinqueradiata fed a non-fishmeal diet, Fish. Sci. 72 (3) (2006) 513–519. [10] Y.-L. Guo, W.-D. Jiang, P. Wu, Y. Liu, X.-Q. Zhou, S.-Y. Kuang, L. Tang, W.-N. Tang, Y.-A. Zhang, L. Feng, The decreased growth performance and impaired immune function and structural integrity by dietary iron deficiency or excess are associated with TOR, NF-κB, p38MAPK, Nrf2 and MLCK signaling in head kidney, spleen and skin of grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 65 (2017) 145–168. [11] J. Deng, B. Kang, L. Tao, H. Rong, X. Zhang, Effects of dietary cholesterol on antioxidant capacity, non-specific immune response, and resistance to Aeromonas hydrophila in rainbow trout (Oncorhynchus mykiss) fed soybean meal-based diets, Fish Shellfish Immunol. 34 (1) (2013) 324–331. [12] B. Magnadóttir, Innate immunity of fish (overview), Fish Shellfish Immunol. 20 (2) (2006) 137–151. [13] J. Stenvik, M. Schrøder, K. Olsen, A. Zapata, T.Ø. Jørgensen, Expression of immunoglobulin heavy chain transcripts (VH-families, IgM, and IgD) in head kidney and spleen of the Atlantic cod (Gadus morhua L.), Dev. Comp. Immunol. 25 (4) (2001) 291–302. [14] N. Merendino, M. d'Aquino, O. Franci, V. Gentili, G. Tomassi, Cholesterol-rich diet enhances peripheral blood mononuclear cell proliferation, vitamin E, and glutathione levels in rabbits, J. Nutr. Biochem. 9 (5) (1998) 294–297. [15] J.-H. Pan, L. Feng, W.-D. Jiang, P. Wu, S.-Y. Kuang, L. Tang, Y.-A. Zhang, X.Q. Zhou, Y. Liu, Vitamin E deficiency depressed fish growth, disease resistance, and the immunity and structural integrity of immune organs in grass carp (Ctenopharyngodon idella): referring to NF-κB, TOR and Nrf2 signaling, Fish Shellfish Immunol. 60 (2017) 219–236. [16] T. Zhu, Q. Ai, K. Mai, W. Xu, H. Zhou, Z. Liufu, Feed intake, growth performance and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed defatted fish meal diets with graded levels of cholesterol, Aquaculture 428 (2014) 290–296. [17] P.-J. Ni, W.-D. Jiang, P. Wu, Y. Liu, S.-Y. Kuang, L. Tang, W.-N. Tang, Y.-A. Zhang,

[26]

[27] [28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

219

X.-Q. Zhou, L. Feng, Dietary low or excess levels of lipids reduced growth performance, and impaired immune function and structure of head kidney, spleen and skin in young grass carp (Ctenopharyngodon idella) under the infection of Aeromonas hydrophila, Fish Shellfish Immunol. 55 (2016) 28–47. J. Deng, B. Bi, B. Kang, L. Kong, Q. Wang, X. Zhang, Improving the growth performance and cholesterol metabolism of rainbow trout (Oncorhynchus mykiss) fed soyabean meal-based diets using dietary cholesterol supplementation, Br. J. Nutr. 110 (1) (2013) 29–39. S. Krisanaprakornkit, D. Jotikasthira, B. Dale, Intracellular calcium in signaling human β-defensin-2 expression in oral epithelial cells, J. Dent. Res. 82 (11) (2003) 877–882. S.K. Whyte, The innate immune response of finfish–a review of current knowledge, Fish Shellfish Immunol. 23 (6) (2007) 1127–1151. M.H. Hong, J.Y. Lee, H. Jung, D.-H. Jin, H.Y. Go, J.H. Kim, B.-H. Jang, Y.-C. Shin, S.-G. Ko, Sophora flavescens Aiton inhibits the production of pro-inflammatory cytokines through inhibition of the NF κB/IκB signal pathway in human mast cell line (HMC-1), Toxicol. Vitro 23 (2) (2009) 251–258. A.W. Thomson, H.R. Turnquist, G. Raimondi, Immunoregulatory functions of mTOR inhibition, Nat. Rev. Immunol. 9 (5) (2009) 324–337. R. Castro, J. Zou, C.J. Secombes, S.A. Martin, Cortisol modulates the induction of inflammatory gene expression in a rainbow trout macrophage cell line, Fish Shellfish Immunol. 30 (1) (2011) 215–223. H. Frikke-Schmidt, P. Tveden-Nyborg, M.M. Birck, J. Lykkesfeldt, High dietary fat and cholesterol exacerbates chronic vitamin C deficiency in Guinea pigs, Br. J. Nutr. 105 (1) (2011) 54–61. H.-J. Xu, W.-D. Jiang, L. Feng, Y. Liu, P. Wu, J. Jiang, S.-Y. Kuang, L. Tang, W.N. Tang, Y.-A. Zhang, Dietary vitamin C deficiency depresses the growth, head kidney and spleen immunity and structural integrity by regulating NF-κB, TOR, Nrf2, apoptosis and MLCK signaling in young grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 52 (2016) 111–138. L. Zhuang, J. Kim, R.M. Adam, K.R. Solomon, M.R. Freeman, Cholesterol targeting alters lipid raft composition and cell survival in prostate cancer cells and xenografts, J. Clin. Invest. 115 (4) (2005) 959. K. Inoki, Y. Li, T. Zhu, J. Wu, G. Kun-Liang, TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling, Nat. Cell Biol. 4 (9) (2002) 648. Z.Y. Du, Y.J. Liu, L.X. Tian, J.T. Wang, Y. Wang, G.Y. Liang, Effect of dietary lipid level on growth, feed utilization and body composition by juvenile grass carp (Ctenopharyngodon idella), Aquacult. Nutr. 11 (2) (2005) 139–146. R. Lunda, Z. Linhartová, J. Másílko, P. Dvořák, S.S. Možina, J. Mráz, Effect of different types of descaling methods on shelf life of air-/vacuum-packaged common carp (Cyprinus carpio L.) fillets under refrigerated storage conditions, Aquacult. Int. 24 (6) (2016) 1555–1568. J. Xu, P. Wu, W.-D. Jiang, Y. Liu, J. Jiang, S.-Y. Kuang, L. Tang, W.-N. Tang, Y.A. Zhang, X.-Q. Zhou, Optimal dietary protein level improved growth, disease resistance, intestinal immune and physical barrier function of young grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 55 (2016) 64–87. Y.Y. Zeng, W.D. Jiang, Y. Liu, P. Wu, J. Zhao, J. Jiang, S.Y. Kuang, L. Tang, W.N. Tang, Y.A. Zhang, Optimal dietary alpha- linolenic acid/linoleic acid ratio improved digestive and absorptive capacities and target of rapamycin gene expression of juvenile grass carp (Ctenopharyngodon idellus), Aquacult. Nutr. 22 (6) (2015) 1251–1266. J. Wen, W. Jiang, L. Feng, S. Kuang, J. Jiang, L. Tang, X. Zhou, Y. Liu, The influence of graded levels of available phosphorus on growth performance, muscle antioxidant and flesh quality of young grass carp (Ctenopharyngodon idella), Animal Nutrition 1 (2) (2015) 77–84. Y.P. Wu, L. Feng, W.D. Jiang, Y. Liu, J. Jiang, S.H. Li, L. Tang, S.Y. Kuang, X.Q. Zhou, Influence of dietary zinc on muscle composition, flesh quality and muscle antioxidant status of young grass carp (Ctenopharyngodon idella Val.), Aquacult. Res. 46 (10) (2015) 2360–2373. C. Shoemaker, O. Olivares-Fuster, C. Arias, P. Klesius, Flavobacterium columnare genomovar influences mortality in channel catfish (Ictalurus punctatus), Vet. Microbiol. 127 (3) (2008) 353–359. E.J. Nya, B. Austin, Development of immunity in rainbow trout (Oncorhynchus mykiss, Walbaum) to Aeromonas hydrophila after the dietary application of garlic, Fish Shellfish Immunol. 30 (3) (2011) 845–850. X. Song, J. Zhao, Y. Bo, Z. Liu, K. Wu, C. Gong, Aeromonas hydrophila induces intestinal inflammation in grass carp (Ctenopharyngodon idella): an experimental model, Aquaculture 434 (2014) 171–178. P. Wu, W.-D. Jiang, J. Jiang, J. Zhao, Y. Liu, Y.-A. Zhang, X.-Q. Zhou, L. Feng, Dietary choline deficiency and excess induced intestinal inflammation and alteration of intestinal tight junction protein transcription potentially by modulating NFκB, STAT and p38 MAPK signaling molecules in juvenile Jian carp, Fish Shellfish Immunol. 58 (2016) 462–473. R. Zuo, Q. Ai, K. Mai, W. Xu, J. Wang, H. Xu, Z. Liufu, Y. Zhang, Effects of dietary n3 highly unsaturated fatty acids on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans), Fish Shellfish Immunol. 32 (2) (2012) 249–258. W. Jiang, J. Li, Y. Gao, Y. Mao, Z. Jiang, M. Du, Y. Zhang, J. Fang, Effects of temperature change on physiological and biochemical responses of Yesso scallop, Patinopecten yessoensis, Aquaculture 451 (2016) 463–472. S. He, Z. Zhou, Y. Liu, P. Shi, B. Yao, E. Ringø, I. Yoon, Effects of dietary Saccharomyces cerevisiae fermentation product (DVAQUA®) on growth performance, intestinal autochthonous bacterial community and non-specific immunity of hybrid tilapia (Oreochromis niloticus ♀×O. aureus ♂) cultured in cages, Aquaculture 294 (1) (2009) 99–107.

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

(Ctenopharyngodon idella), Fish Shellfish Immunol. 47 (1) (2015) 46–62. [65] Y.-D. Min, C.-H. Choi, H. Bark, H.-Y. Son, H.-H. Park, S. Lee, J.-W. Park, E.-K. Park, H.-I. Shin, S.-H. Kim, Quercetin inhibits expression of inflammatory cytokines through attenuation of NF-κB and p38 MAPK in HMC-1 human mast cell line, Inflamm. Res. 56 (5) (2007) 210–215. [66] A.S. Baldwin Jr., Series introduction: the transcription factor NF-κB and human disease, J. Clin. Invest. 107 (1) (2001) 3. [67] N. Silswal, A.K. Singh, B. Aruna, S. Mukhopadhyay, S. Ghosh, N.Z. Ehtesham, Human resistin stimulates the pro-inflammatory cytokines TNF-α and IL-12 in macrophages by NF-κB-dependent pathway, Biochem. Biophys. Res. Commun. 334 (4) (2005) 1092–1101. [68] Y.-Z. Lin, S. Yao, R.A. Veach, T.R. Torgerson, J. Hawiger, Inhibition of nuclear translocation of transcription factor NF-κB by a synthetic peptide containing a cell membrane-permeable motif and nuclear localization sequence, J. Biol. Chem. 270 (24) (1995) 14255–14258. [69] G. Bonizzi, M. Karin, The two NF-κB activation pathways and their role in innate and adaptive immunity, Trends Immunol. 25 (6) (2004) 280–288. [70] T. Wang, M. Husain, The expanding repertoire of the IL-12 cytokine family in teleost fish: identification of three paralogues each of the p35 and p40 genes in salmonids, and comparative analysis of their expression and modulation in Atlantic salmon Salmo salar, Dev. Comp. Immunol. 46 (2) (2014) 194–207. [71] J. de Vries-van der Weij, K. Toet, S. Zadelaar, P.Y. Wielinga, R. Kleemann, P.C. Rensen, T. Kooistra, Anti-inflammatory salicylate beneficially modulates preexisting atherosclerosis through quenching of NF-κB activity and lowering of cholesterol, Atherosclerosis 213 (1) (2010) 241–246. [72] Z. Zhang, S. Jones, J.S. Hagood, N.L. Fuentes, G.M. Fuller, STAT3 acts as a coactivator of glucocorticoid receptor signaling, J. Biol. Chem. 272 (49) (1997) 30607–30610. [73] A. Kleiman, S. Hübner, J.M.R. Parkitna, A. Neumann, S. Hofer, M.A. Weigand, M. Bauer, W. Schmid, G. Schütz, C. Libert, Glucocorticoid receptor dimerization is required for survival in septic shock via suppression of interleukin-1 in macrophages, Faseb. J. 26 (2) (2012) 722–729. [74] S. Milla, C. Mathieu, N. Wang, S. Lambert, S. Nadzialek, S. Massart, E. Henrotte, J. Douxfils, C. Mélard, S. Mandiki, Spleen immune status is affected after acute handling stress but not regulated by cortisol in Eurasian perch, Perca fluviatilis, Fish Shellfish Immunol. 28 (5) (2010) 931–941. [75] W. Wieteska-Skrzeczyńska, K. Grzelkowska-Kowalczyk, E. Rejmak, Growth factor and cytokine interactions in myogenesis. Part II. Expression of IGF binding proteins and protein kinases essential for myogenesis in mouse C2C12 myogenic cells exposed to TNF-α and IFN-γ, Pol. J. Vet. Sci. 14 (3) (2011) 425–431. [76] Y. Peng, C.A. Sigua, C. Karsonovich, M.M. Murr, Protein kinase C-zeta (PKC-ζ) regulates Kupffer cell apoptosis during experimental sepsis, J. Gastrointest. Surg. 11 (12) (2007) 1712–1721. [77] S. Reyes-Cerpa, F.E. Reyes-López, D. Toro-Ascuy, J. Ibañez, K. Maisey, A.M. Sandino, M. Imarai, IPNV modulation of pro and anti-inflammatory cytokine expression in Atlantic salmon might help the establishment of infection and persistence, Fish Shellfish Immunol. 32 (2) (2012) 291–300. [78] J. Castillo, M. Teles, S. Mackenzie, L. Tort, Stress-related hormones modulate cytokine expression in the head kidney of gilthead seabream (Sparus aurata), Fish Shellfish Immunol. 27 (3) (2009) 493–499. [79] T. Kono, H. Takayama, R. Nagamine, H. Korenaga, M. Sakai, Establishment of a multiplex RT-PCR assay for the rapid detection of fish cytokines, Vet. Immunol. Immunopathol. 151 (1) (2013) 90–101. [80] T. Weichhart, G. Costantino, M. Poglitsch, M. Rosner, M. Zeyda, K.M. Stuhlmeier, T. Kolbe, T.M. Stulnig, W.H. Hörl, M. Hengstschläger, The TSC-mTOR signaling pathway regulates the innate inflammatory response, Immunity 29 (4) (2008) 565–577. [81] T. Weichhart, M. Säemann, The PI3K/Akt/mTOR pathway in innate immune cells: emerging therapeutic applications, Ann. Rheum. Dis. 67 (Suppl III) (2008) iii70–iii74. [82] K. Maneechotesuwan, Y. Xin, K. Ito, E. Jazrawi, K.-Y. Lee, O.S. Usmani, P.J. Barnes, I.M. Adcock, Regulation of Th2 cytokine genes by p38 MAPK-mediated phosphorylation of GATA-3, J. Immunol. 178 (4) (2007) 2491–2498. [83] M. Ohtani, N. Hayashi, K. Hashimoto, T. Nakanishi, J.M. Dijkstra, Comprehensive clarification of two paralogous interleukin 4/13 loci in teleost fish, Immunogenetics 60 (7) (2008) 383–397. [84] J. Jiang, D. Shi, X.-Q. Zhou, L. Yin, L. Feng, W.-D. Jiang, Y. Liu, L. Tang, P. Wu, Y. Zhao, Vitamin D inhibits lipopolysaccharide-induced inflammatory response potentially through the Toll-like receptor 4 signalling pathway in the intestine and enterocytes of juvenile Jian carp (Cyprinus carpio var. Jian), Br. J. Nutr. 114 (10) (2015) 1560–1568. [85] C. Li, B. Beck, B. Su, J. Terhune, E. Peatman, Early mucosal responses in blue catfish (Ictalurus furcatus) skin to Aeromonas hydrophila infection, Fish Shellfish Immunol. 34 (3) (2013) 920–928. [86] N. Navot, M.S. Sinyakov, R.R. Avtalion, Application of ultrasound in vaccination against goldfish ulcer disease: a pilot study, Vaccine 29 (7) (2011) 1382–1389. [87] S. Han, J. Jiao, W. Zhang, J. Xu, Z. Wan, W. Zhang, X. Gao, L. Qin, Dietary fiber prevents obesity-related liver lipotoxicity by modulating sterol-regulatory element binding protein pathway in C57BL/6J mice fed a high-fat/cholesterol diet, Sci. Rep. 5 (2015). [88] L. Peyrin-Biroulet, J. Beisner, G. Wang, S. Nuding, S.T. Oommen, D. Kelly, E. Parmentier-Decrucq, R. Dessein, E. Merour, P. Chavatte, Peroxisome proliferatoractivated receptor gamma activation is required for maintenance of innate antimicrobial immunity in the colon, Proc. Natl. Acad. Sci. Unit. States Am. 107 (19) (2010) 8772–8777. [89] C. Batista-Pinto, P. Rodrigues, E. Rocha, A. Lobo-da-Cunha, Identification and organ

[41] M. Li, L. Chen, J. Qin, N. Yu, Y. Chen, Z. Ding, E. Li, Growth, immune response and resistance to Aeromonas hydrophila of darkbarbel catfish Pelteobagrus vachelli fed diets with different linolenic acids, vitamins C and E levels, Aquacult. Nutr. 22 (3) (2016) 664–674. [42] P. Wu, L. Feng, S.-Y. Kuang, Y. Liu, J. Jiang, K. Hu, W.-D. Jiang, S.-H. Li, L. Tang, X.Q. Zhou, Effect of dietary choline on growth, intestinal enzyme activities and relative expressions of target of rapamycin and eIF4E-binding protein2 gene in muscle, hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian), Aquaculture 317 (1) (2011) 107–116. [43] S. Torrecillas, D. Montero, M.J. Caballero, L. Robaina, M.J. Zamorano, J. Sweetman, M. Izquierdo, Effects of dietary concentrated mannan oligosaccharides supplementation on growth, gut mucosal immune system and liver lipid metabolism of European sea bass (Dicentrarchus labrax) juveniles, Fish Shellfish Immunol. 42 (2) (2015) 508–516. [44] W.-D. Jiang, H.-L. Wen, Y. Liu, J. Jiang, P. Wu, J. Zhao, S.-Y. Kuang, L. Tang, W.N. Tang, Y.-A. Zhang, Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): avoid tryptophan deficiency or excess, Food Chem. 199 (2016) 210–219. [45] K. Hu, J.-X. Zhang, L. Feng, W.-D. Jiang, P. Wu, Y. Liu, J. Jiang, X.-Q. Zhou, Effect of dietary glutamine on growth performance, non-specific immunity, expression of cytokine genes, phosphorylation of target of rapamycin (TOR), and anti-oxidative system in spleen and head kidney of Jian carp (Cyprinus carpio var. Jian), Fish Physiol. Biochem. 41 (3) (2015) 635–649. [46] I. Seiliez, J.-C. Gabillard, S. Skiba-Cassy, D. Garcia-Serrana, J. Gutiérrez, S. Kaushik, S. Panserat, S. Tesseraud, An in vivo and in vitro assessment of TOR signaling cascade in rainbow trout (Oncorhynchus mykiss), American Journal of PhysiologyRegulatory, Int. Comp. Physiol. 295 (1) (2008) R329–R335. [47] P. Wu, J. Jiang, Y. Liu, K. Hu, W.D. Jiang, S.H. Li, L. Feng, X.Q. Zhou, Dietary choline modulates immune responses, and gene expressions of TOR and eIF4Ebinding protein2 in immune organs of juvenile Jian carp (Cyprinus carpio var. Jian), Fish Shellfish Immunol. 35 (3) (2013) 697–706. [48] S.H. Hoseinifar, F. Zoheiri, C.M. Caipang, Dietary sodium propionate improved performance, mucosal and humoral immune responses in Caspian white fish (Rutilus frisii kutum) fry, Fish Shellfish Immunol. 55 (2016) 523–528. [49] I. Ahmed, M.A. Khan, A.K. Jafri, Dietary threonine requirement of fingerling Indian major carp, Cirrhinus mrigala (Hamilton), Aquacult. Res. 35 (2) (2004) 162–170. [50] Y. Shen, J. Zhang, X. Xu, J. Fu, J. Li, A new haplotype variability in complement C6 is marginally associated with resistance to Aeromonas hydrophila in grass carp, Fish Shellfish Immunol. 34 (5) (2013) 1360–1365. [51] S. Dash, S.K. Das, J. Samal, P.K. Ojha, J.K. Patra, H. Thatoi, Dose dependence specific and non-specific immune responses of Indian major carp (L. rohita Ham) to intraperitoneal injection of formalin killed Aeromonas hydrophila whole cell vaccine, Vet. Res. Commun. 35 (8) (2011) 541–552. [52] P. Wu, J. Jiang, Y. Liu, K. Hu, W.-D. Jiang, S.-H. Li, L. Feng, X.-Q. Zhou, Dietary choline modulates immune responses, and gene expressions of TOR and eIF4Ebinding protein2 in immune organs of juvenile Jian carp (Cyprinus carpio var. Jian), Fish Shellfish Immunol. 35 (3) (2013) 697–706. [53] L. Zhang, L. Feng, W.-D. Jiang, Y. Liu, P. Wu, S.-Y. Kuang, L. Tang, W.-N. Tang, Y.A. Zhang, X.-Q. Zhou, Vitamin A deficiency suppresses fish immune function with differences in different intestinal segments: the role of transcriptional factor NF-κB and p38 mitogen-activated protein kinase signalling pathways, Br. J. Nutr. 117 (1) (2017) 67–82. [54] W. Kong, C. Huang, Y. Tang, D. Zhang, Z. Wu, X. Chen, Effect of Bacillus subtilis on Aeromonas hydrophila-induced intestinal mucosal barrier function damage and inflammation in grass carp (Ctenopharyngodon idella), Sci. Rep. 7 (1) (2017) 1588. [55] S. Hadidi, G.W. Glenney, T.J. Welch, J.T. Silverstein, G.D. Wiens, Spleen size predicts resistance of rainbow trout to Flavobacterium psychrophilum challenge, J. Immunol. 180 (6) (2008) 4156–4165. [56] R. Harikrishnan, C. Balasundaram, M.-S. Heo, Impact of plant products on innate and adaptive immune system of cultured finfish and shellfish, Aquaculture 317 (1) (2011) 1–15. [57] V.V. Trichet, Nutrition and immunity: an update, Aquacult. Res. 41 (3) (2010) 356–372. [58] B. Magnadóttir, S. Lange, S. Gudmundsdottir, J. Bøgwald, R. Dalmo, Ontogeny of humoral immune parameters in fish, Fish Shellfish Immunol. 19 (5) (2005) 429–439. [59] A. Rønneseth, H.I. Wergeland, E.F. Pettersen, Neutrophils and B-cells in atlantic cod (Gadus morhua L.), Fish Shellfish Immunol. 23 (3) (2007) 493–503. [60] J. Cuthbert, P.E. Lipsky, Provision of cholesterol to lymphocytes by high density and low density lipoproteins. Requirement for low density lipoprotein receptors, J. Biol. Chem. 262 (16) (1987) 7808–7818. [61] F. Progatzky, N.J. Sangha, N. Yoshida, M. McBrien, J. Cheung, A. Shia, J. Scott, J.R. Marchesi, J.R. Lamb, L. Bugeon, Dietary cholesterol directly induces acute inflammasome-dependent intestinal inflammation, Nat. Commun. 5 (2014) 5864. [62] G. Biswas, H. Korenaga, H. Takayama, T. Kono, H. Shimokawa, M. Sakai, Cytokine responses in the common carp, Cyprinus carpio L. treated with baker's yeast extract, Aquaculture 356 (2012) 169–175. [63] L. Tian, X.-Q. Zhou, W.-D. Jiang, Y. Liu, P. Wu, J. Jiang, S.-Y. Kuang, L. Tang, W.N. Tang, Y.-A. Zhang, Sodium butyrate improved intestinal immune function associated with NF-κB and p38MAPK signalling pathways in young grass carp (Ctenopharyngodon idella), Fish Shellfish Immunol. 66 (2017) 548–563. [64] Y.-P. Chen, W.-D. Jiang, Y. Liu, J. Jiang, P. Wu, J. Zhao, S.-Y. Kuang, L. Tang, W.N. Tang, Y.-A. Zhang, Exogenous phospholipids supplementation improves growth and modulates immune response and physical barrier referring to NF-κB, TOR, MLCK and Nrf2 signaling factors in the intestine of juvenile grass carp

220

Fish and Shellfish Immunology 78 (2018) 202–221

X.-Z. Wang et al.

[90] [91]

[92]

[93] [94]

[95]

expression of peroxisome proliferator activated receptors in brown trout (Salmo trutta f. fario), Biochim. Biophys. Acta Gene Struct. Expr. 1731 (2) (2005) 88–94. K. Khoo, H. Tan, Y. Liew, J. Deslypere, E. Janus, Lipids and coronary heart disease in Asia, Atherosclerosis 169 (1) (2003) 1–10. A.P. Farrell, R.L. Saunders, H.C. Freeman, T.P. Mommsen, Arteriosclerosis in Atlantic salmon. Effects of dietary cholesterol and maturation, Arteriosclerosis 6 (4) (1986) 453. B. Yun, K. Mai, W. Zhang, W. Xu, Effects of dietary cholesterol on growth performance, feed intake and cholesterol metabolism in juvenile turbot (Scophthalmus maximus L.) fed high plant protein diets, Aquaculture 319 (1) (2011) 105–110. L. Tort, J. Balasch, S. Mackenzie, Fish immune system. A crossroads between innate and adaptive responses, Inmunologia 22 (3) (2003) 277–286. A. Sene, A.A. Khan, D. Cox, R.E. Nakamura, A. Santeford, B.M. Kim, R. Sidhu, M.D. Onken, J.W. Harbour, S. Hagbi-Levi, Impaired cholesterol efflux in senescent macrophages promotes age-related macular degeneration, Cell Metabol. 17 (4) (2013) 549–561. A.K. Duwe, M. Fitch, R. Ostwald, Effects of dietary cholesterol on antibody-

[96]

[97]

[98]

[99]

221

dependent phagocytosis and cell-mediated lysis in Guinea pigs, J. Nutr. 111 (1981) 1672–1680. E. Lauriano, S. Pergolizzi, G. Capillo, M. Kuciel, A. Alesci, C. Faggio, Immunohistochemical characterization of Toll-like receptor 2 in gut epithelial cells and macrophages of goldfish Carassius auratus fed with a high-cholesterol diet, Fish Shellfish Immunol. 59 (2016) 250–255. S. Zhang, L. Shi, Q.-H. Yang, X.-H. Dong, S.-Y. Chi, H.-Y. Liu, B.-P. Tan, Molecular characterization and functional analysis of Cactin gene from Litopenaeus vannamei, Fish Shellfish Immunol. 41 (2) (2014) 608–617. M.M. Mahfouz, F.A. Kummerow, Cholesterol-rich diets have different effects on lipid peroxidation, cholesterol oxides, and antioxidant enzymes in rats and rabbits, J. Nutr. Biochem. 11 (5) (2000) 293–302. M. Hofmann, S. Schiekofer, B. Isermann, M. Kanitz, M. Henkels, M. Joswig, A. Treusch, M. Morcos, T. Weiss, V. Borcea, Peripheral blood mononuclear cells isolated from patients with diabetic nephropathy show increased activation of the oxidative-stress sensitive transcription factor NF-kB, Diabetologia 42 (2) (1999) 222–232.