Low temperature enhanced the podophyllotoxin accumulation vis-a-vis its biosynthetic pathway gene(s) expression in Dysosma versipellis (Hance) M. Cheng – A pharmaceutically important medicinal plant

Journal Pre-proof Low temperature enhanced the podophyllotoxin accumulation vis-a-vis its biosynthetic pathway gene(s) expression in Dysosma versipellis (Hance) M. Cheng – A pharmaceutically important medicinal plant Palaniyandi Karuppaiya, Jun Wu

PII:

S1359-5113(19)31410-2

DOI:

https://doi.org/10.1016/j.procbio.2020.02.009

Reference:

PRBI 11927

To appear in:

Process Biochemistry

Received Date:

20 September 2019

Revised Date:

26 January 2020

Accepted Date:

11 February 2020

Please cite this article as: Palaniyandi K, Jun W, Low temperature enhanced the podophyllotoxin accumulation vis-a-vis its biosynthetic pathway gene(s) expression in Dysosma versipellis (Hance) M. Cheng – A pharmaceutically important medicinal plant, Process Biochemistry (2020), doi: https://doi.org/10.1016/j.procbio.2020.02.009

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Low temperature enhanced the podophyllotoxin accumulation vis-a-vis its biosynthetic pathway gene(s) expression in Dysosma versipellis (Hance) M. Cheng – A pharmaceutically important medicinal plant

of

Palaniyandi Karuppaiyaa* [email protected] and Jun Wua*

Department of Botany, Key Laboratory of Bio-Resources and Eco-Environment,

re

a

-p

ro

[email protected]

ur na

610064, China.

lP

Ministry of Education, College of Life Science,Sichuan University, Chengdu

*To whom correspondence should be addressed No. 24, South Section 1, Yihuan Road, Chengdu, 610065 China

Jo

Tel: +86-28 85417281

Fax: +86-28 85417281

of

Graphical abstract

Low temperature enhanced plant biomass, chlorophyll and carotenoid content of Dysosma pleiantha compared to greenhouse plants.



-p



ro

Highlights

Podophyllotoxin pathway genes secoisolariciresinol dehydrogenase and pinoresionol to greenhouse temperature.

D. versipellis grown at low temperature (4~6ºC) increased podophyllotoxin accumulation

lP



re

lariciresinol reductase expression levels were up-regulated at low temperature compared

Jo

Abstract

ur na

in rhizome than greenhouse temperature (25~30ºC).

Dysosma versipellis (Hance) M. Chang is an endemic and endangered Chinese medicinal

herb. Podophyllotoxin, a lead compound for the semi-synthesis of clinically useful anticancer compounds, is the main active aryltetralin lignan accumulated in D. versipellis. In this study, morphology and physiology traits in response to podophyllotoxin accumulation and its biosynthetic pathway genes expression were investigated in D. versipellis plants grown at low

temperature (4~6C) and greenhouse (25~30C) temperature. Our study found that low temperature significantly increased plant biomass (2.7-fold), chlorophyll, and carotenoid content compared to greenhouse temperature. The mRNA expression analysis of podophyllotoxin pathway genes secoisolariciresinol dehydrogenase and pinoresionol lariciresinol reductase expression levels were also up-regulated by low temperature. In addition, plants grown at low

of

temperature markedly increased podophyllotoxin accumulation to 3.49-fold in rhizome of D. versipellis than the greenhouse temperature. These results suggest that plants at low temperature

ro

enhance the accumulation of podophyllotoxin in rhizome of D. versipellis by over-expressing podophyllotoxin pathway genes. This study finding could be useful in the producing

re

-p

pharmaceutically important podophyllotoxin without overexploiting this endangered species.

Key words: Dysosma versipellis; podophyllotoxin; Low temperature; Lignan biosynthetic

ur na

lP

pathway; secoisolariciresinol dehydrogenase; pinoresionol lariciresinol reductase.

Introduction

Most of the clinical drugs used today are obtained from natural bioactive compounds and these natural products have gained much attention owing to its biological activities against various

Jo

diseases [1, 2]. Aryltetralin type lignan podophyllotoxin is accumulated in many plant genera including Podophyllum and Dysosma. Plants of the genus Dysosma are rich sources of tumor inhibitory podophyllotoxin next to genus Podophyllum [3]. Podophyllotoxin has been used as a lead compound for the synthesis of clinically useful anticancer drug etoposide, etopophos, teniposide, Pod-Ben-25, Condofil, Verrusol, and Warticon. In particular, etoposide is used in the

treatment of testicular cancer and small-cell lung cancer. Other drugs in phase-III clinical trials are GL 331, Top 53, NK 611, and CPH 82 [4]. Dysosma versipellis (Hance) M. Cheng (Berberidaceae), an endemic, important rhizomatous Chinese medicinal herb grows in the highaltitude Mountains of evergreen and deciduous forests in China. These plants have long been used in the Traditional Chinese Medicines for the treatment of cough, carbuncles, snakebite, parotitis, lumbago, skelalgia, and rheumatism [5]. In folk medicine, the leaves of D. versipellis

of

fried with chicken egg used for cough in the tribal areas of China. Based on these medicinal

ro

properties, D. versipellis has been over exploited in natural habitat which resulted in categorizing this species as endangered plant species by both China species Red list [6] and China Plant Red

-p

Data Book [7]. Oral use of D. versipellis rhizome extract is restricted due to its toxicity [5].

re

However, Traditional Chinese medicine (TCM) stores and TCM practitioners are still prescribing D. versipellis rhizome for various herbal formulations in China. Since therapeutic and lethal dose

lP

is very similar, D. versipellis poisoning cases were numerous in China. This is attributable to the rhizome which has different levels of podophyllotoxin content obtained from various

ur na

environmental condition such as high elevation and low or chilling temperature. Therefore, there is a need to understand biological influences on podophyllotoxin accumulation in rhizome of D. versipellis in relation to low temperature. Lignans biosynthesis in plants occurs by phenylpropanoid pathway. The full biosynthetic route

Jo

of podophyllotoxin has not been elucidated yet, nevertheless efforts have been made to understand podophyllotoxin biosynthesis in plant genera such as Forsythia, Linum, and Podophyllum than Dysosma [3]. Recent studies reported that only 33 steps are known and another 36 steps have been predicted but yet to be validated for genes/protein/enzymes in the podophyllotoxin biosynthesis pathway [4, 8, 9]. A total of 26 genes are known to catalyze 33 known steps in podophyllotoxin biosynthetic pathway. Only 12 genes out of 26 have correlated

their role in podophyllotoxin biosynthesis in Podophyllum species via gene expression analysis [9-12]. Modern genomics such as the de novo sequence of transcriptome analysis revealed that cytochrome P450s enzymes CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum play an effective catalytic role in converting matairesinol into pluviatolide. In addition, it was also recorded that proteins such as chalcone synthase, O-methyltransferases, and caffeoyl CoA 3O-methyltransferase are involved in podophyllotoxin biosynthesis in P. hexandrum [8] (Figure 1).

of

To improve the podophyllotoxin biosynthesis, many strategies have been used, such as callus

ro

culture, cell suspension culture, hairy root culture and transgenic plants through overexpression of pathway gene in Podophyllum, Forsythia and Linnum [13]. In addition, few studies reported

-p

that exogenous factor increased podophyllotoxin production such as additives [3], methyl

re

jasmonate [14] and abiotic stress [10]. A wide range of environmental stress effectively increase the accumulation of phenylpropanoids [15]. Recent studies reported that P. hexandrum cultivated

lP

in greenhouse or in situ conditions at lower altitude decreased the podophyllotoxin accumulation than wild plants [16-19]. Low temperature is one of the most harmful abiotic stress and it can

ur na

effectively increase the secondary metabolites accumulation in plants including apple trees [20], Artemisia annua [21], blood oranges [22], wheat [23], P. hexandrum [24]. Accumulating research evidence suggests that Podophyllum species has been shown to acclimatize with low temperatures at high altitude environments [10, 25]. Climate factors have contributed

Jo

significantly more to the production of medically important secondary compounds of Sinopodophyllum hexandrum than soil factors [26]. Chilling temperature markedly increased chlorophyll content, net photosynthetic rate, stomatal conductance, and plant biomass, while dramatically reduced transpiration rates and intercellular CO2 concentration in P. hexandrum. Podophyllotoxin content in rhizome increased 5.00- (4 °C) and 3.33-fold (10 °C) higher compared to 22 °C by up-regulating podophyllotoxin pathway genes [24]. The accumulation of

podophyllotoxin in podophyllum hexandrum rhizomes was positively associated to the higher altitude [27, 28]. Wu et al. [19] suggested that altitude plays crucial role in accumulation of podophyllotoxin with an ideal altitude range between 2800 to 3200 m. P. hexandrum cultivated at high altitude increased the growth and accumulation of podophyllotoxin [18]. The present study reports for the first time in Dysosma versipellis that plants at high altitude with chilling (4~6ºC) temperature and greenhouse (25ºC~30ºC) were investigated for

of

podophyllotoxin content and expression levels of its biosynthetic pathway genes. This study

ro

would provide information in regarding the mechanism of genetic regulation governing the podophyllotoxin biosynthesis under low temperature through correlation analysis between

re

-p

podophyllotoxin content and its related gene expression in Dysosma versipellis.

Materials and Methods

lP

Chemicals and reagents

The standard compound Podophyllotoxin was purchased from sigma chemicals. Methyl Alcohol,

ur na

Acetonitrile, Ammonium Formate and Formic acid were of HPLC grade, purchased from Swell Scientific (China). Purified water was obtained from Milli Q system from Millipore (Milford, MA, USA).

Jo

Plant materials and growth conditions Dysosma versipellis plants at the same age (24 months old) were identified based on the taxonomical descriptions in the Emei Mountains (29º34ʹ36ʺN 103º24ʹ23ʺE), Sichuan Province, China. Six plants have been relocated to the Sichuan University greenhouse and the remaining plants have been kept in the same location for the next 18 months. After 18 months, D. versipellis rhizomes were collected from the Emei mountain at 4~6ºC and Sichuan University greenhouse at

25~30ºC in mid of December and then frozen in liquid nitrogen soon after removing mud from rhizomes by washing in tap water. The rhizomes of D. versipellis collected at 4~6ºC and 25~30ºC were maintained at –80°C and used in genes expression studies and the quantification of podophyllotoxin.

Extraction and determination of chlorophyll and carotenoid content

of

Fresh leaf discs (20 mg) of D. versipellis were cut down using scalpel and grounded in pre-

ro

chilled pestle and mortar with 8 mL of 80 % acetone. The homogenate was incubated at 4C for overnight and then centrifuged at 4C 4000 rpm for 5 minutes. The supernatant was collected and

-p

the remaining pellet was washed with 10 mL of 95 % ethanol and centrifuged three times. The

re

supernatant was pooled and the volume was adjusted to 15 mL with 95 % of ethanol. The absorbance of samples was measured using UV-Vis spectrophotometer (Thermo-Scientific, USA)

lP

at 663 nm and 645 nm for chlorophyll (Chl) and 470 nm and 546 nm for carotenoid content.

ur na

Sample preparation for chromatography

The rhizomes of D. versipellis were dried at 35ºC for overnight and then ground to fine powder using kitchen blender. About 1.0 g of powdered rhizome was accurately weighed and ultrasonicated with 10 mL of ethanol for 10 min. The process was repeated three times for each

Jo

sample. After filtration, the combined ethanol extracts were evaporated to dryness by a rotary evaporator. The residue was dissolved in 10 mL ethanol and filtered by a syringe filter (0.2 μm) prior to analysis. UPLC analysis, the more sensitive method, required dilutions of 2–30 times.

Ultra-performance liquid chromatography and chromatographic conditions

The rhizome extract of D. versipellis were analyzed for podophyllotoxin using UPLC system (Waters ACQUITY UPLC system, Waters Corp., Milford, MA) coupled with a binary pump system, sample manager, column manager and PDA detector (Waters Corp., Milford, MA). C18+ column was used for the separation of samples and maintained at 40ºC. The following solvent system: mobile phase A (25 mmol ammonium formate + 0.1% formic acid in Milli-Q water, v/v) and mobile phase B (0.1% formic acid + 25 mmol ammonium formate in acetonitrile, v/v) were

of

applied with isocratic method at 70% A, 30% B for 6.0 min. The injection volume of the sample

ro

was 1.0 mL and samples were analyzed in triplicate. Strong needle wash solution (95:5,

methanol:water, v/v) and weak needle wash solution (5:95, methanol:water, v/v) were used. The

-p

samples were maintained at 25ºC in the sample manager and the detection was performed at 285

re

nm using PDA detector. The separation of the sample was completed in 6 min. Empower version

lP

3.0 (Waters Corp., Milford, MA) was used for acquisition and data processing.

Standard solution preparation and calibration curve

ur na

The podophyllotoxin standard solution was prepared using methanol at 1 mg/mL. The calibration line was prepared for this study as follows: Y = 1533.5x-3016.7 (R2=9993). The podophyllotoxin content was calculated using peak area (Y) and the standard curve prepared using

Jo

podophyllotoxin standard compound.

RNA isolation and cDNA synthesis Total RNA was isolated from rhizome of D. versipellis using RNA extraction reagents from TIANGEN RNAprep pure Plant kit (TIANGEN Biotech Co., Ltd. Beijing, China) with manufacturer’s instructions. The quality and quantity of RNA were examined using agarose gel electrophoresis and spectrophotometer respectively (Nanovue, Healthcare Bio-Sciences AB,

Sweden). cDNA synthesis was carried out using PrimeScript™ RT Reagent Kit, Takara Bio. Inc., Dalian, China. cDNA samples were diluted at 1:10 with RNase-free water and stored at −80°C.

Quantitative Polymerase Chain Reaction (qPCR) Quantitative PCR was performed in order to quantify the mRNA expression of PLR and SDH genes associated with podophyllotoxin biosynthesis. The primer sequences for amplification of

of

the 2 selected genes are shown in Table 2. ACTIN (ACT) gene was used as a reference gene

ro

(Accession No: FL640971). qPCR analysis was achieved using One step SYBR PrimeScript Plus RT-PCR kit (TaKaRa Co. Ltd) in a 96 well platform as follows: 95°C for 30 s; followed by 40

-p

cycles at 95°C for 5 s and 60°C for 30 s. All quantifications were performed in triplicate. The

re

relative fold gene expression was calculated using 2-△△Ct method [29].

lP

Statistical analysis

All the experiments were repeated triplicates. The data values were shown as mean ± standard

ur na

deviation. The statistical significance of the data obtained from this study was determined by oneway analysis of variance using Prism version 6.0 (GraphPad Software, La Jolla, CA, USA). The mean values were compared by Duncan’s multiple range test (p < 0.05).

Jo

Results

Plant growth in response to low temperature The growth parameters of D. versipellis at low and green house temperature were outlined in Table 2. At low temperature plants showed significant increase in leaf area, length of stem and rhizome and fresh weight of whole plant compared to greenhouse temperature. Low temperature (4~6ºC) found effective in increasing the fresh and dry weight of rhizome. Especially, at low

temperature dry weight of rhizome increased up to 2.7-fold when compared to greenhouse temperature. These results suggested that low temperature significantly affected the growth and development of D. versipellis.

Chlorophyll and carotenoid content in response to low temperature The chlorophyll (Chl a, b and total Chl) and carotenoid content of plants grown at low

of

temperature were significantly higher than greenhouse grown plants (Fig. 2). This investigation

ro

indicates that the low temperature might prompt the chlorophyll and carotenoid content of

-p

D.versipellis.

re

Podophyllotoxin biosynthesis pathway genes expression at low temperature Low temperature tolerance is a multigenic trait with low temperature-inducible genes mainly

lP

coding three proteins such as structural, regulatory (e.g. transcription factors, translation elongation factors and signal transduction proteins) and osmoprotectants protein (dehydrins and

ur na

late-embryogenesis abundant) [30]. In the present study, the expression levels of PLR and SDH genes associated with podophyllotoxin biosynthesis were analyzed by qPCR and the results showed both genes expression levels were significantly increased in rhizome grown at low temperature compared to greenhouse grown plants (25~30ºC) (Figure 3). The results obtained in

Jo

this study revealed that the mRNA expression of PLR and SDH genes were significantly increased at low temperatures (4°C ~ 6°C) than plants grown at 25~30ºC.

Podophyllotoxin accumulation in response to low temperature In order to analyze the anticancer compound podophyllotoxin in low- and greenhouse temperature plants, the rhizome extract was subjected to UPLC analysis. Podophyllotoxin content

of D. versipellis rhizome grown at low temperature showed significantly higher than the rhizome grown in greenhouse (25~30ºC), where the content of podophyllotoxin was 3.49-fold higher (Figure 4). This finding reveals that D. versipellis grown at low temperature increased the podophyllotoxin accumulation in underground part of rhizome.

Discussion

of

Resisting environmental stress is one of the most significant challenges affecting plants. Plant

ro

secondary metabolites plays vital role in protecting plants against adverse conditions from biotic and abiotic environmental stresses and have significant contribution in pharmaceutical, nutrition,

-p

and cosmetics [31]. Modulation of their secondary metabolism is a central mechanism deployed

re

by plants which helps them to mitigate environmental stress [32]. Chilling temperature is one of the environmental stresses virtually affecting the growth and development of plants.

lP

Acclimatization of plant at low temperature is associated with cellular function at all levels and induces changes in transcriptome [33]. In the present study, we found that chilling temperature

ur na

significantly affects the growth, development, gene expression and secondary metabolites content of Dysosma versipellis.

Several studies have demonstrated that stress due to low temperature affects the growth and

Jo

development in plants [34]. Yang et al. [24] reported that chilling temperature increased the chlorophyll content, stomatal conductance, photosynthetic rate whereas transpiration rate and intercellular CO2 decreased in P. hexandrum. Similarly, effect of low temperature on root growth was reported by Kushwaha et al. [25], where poor root growth in P. hexandrum was due to high consumption of starch at 25 °C compared to 10 °C. It was also reported that photosynthetic rate reduced at 30 °C than at 20 °C and it was due to increased transpiration rate [35]. Kumari et al.

[10] observed that genes associated with growth (protein kinase activity, and calcium ionbinding) were over-accumulated at 15 °C, whereas genes involved in stress response (monoxygenase activity, peptidase activity, galactinol-sucrose galactosyltransferase activity) were over-expressed at 25 °C. From gene expression studies it was found that fundamental pathways such as respiration, photosynthesis, and phenylpropanoid biosynthesis required for growth and development of plant body was up-regulated at 15 °C. Li et al. [18] reported that aerial parts

of

growth and biomass, fruits (number of fruits and dry weight), and underground parts were

ro

significantly increased at higher elevation (3300 m) compared to 2300 m. Consistent with

previous reports, present study also found that chlorophyll, carotenoid content and biomass

-p

significantly increased in plants grown in chilling temperature compared to greenhouse grown

re

plants.

lP

Plant body get acclimatize to cold stress by triggering the gene that translate into alterations in the composition of the transcriptome, proteome and metabolome [34, 36]. Yang et al. [24]

ur na

reported that the six genes (PAL, CCR,CAD, DPO, PLR, and SDH) related to podophyllotoxin biosynthesis increased significantly at temperature between 4 °C and 10 °C compared to control maintained at 22 °C. Further it was recorded that content of podophyllotoxin at 4 °C and 10 °C were 5.00- and 3.33-fold higher than that of 22 °C. Kumari et al. [10] reported that eight genes

Jo

PAL, 4CL, COMT, CCR, CAD, DPO, PLR, and SDH were up-regulated when P. hexandrum were exposed to 15°C and 25°C. On the other hand, four genes (C4H, HCT, C3H and CCoAMT) were down-regulated at 15°C. Finally, there was a significant increase in podophyllotoxin level at 15°C. Consistent with previous investigations, the present study also found that PLR and SDH genes were over-expressed to increase copious amount of podophyllotoxin in rhizome of D.

versipellis. This study finding revealed that PLR and SDH genes may play a key role in plants cultivated at low temperature.

Further, we demonstrated the podophyllotoxin accumulation corresponding to its pathway genes expression in rhizome grown at low temperature using UPLC analysis. In our study, UPLC analysis revealed that podophyllotoxin content significantly increased to 3.49-fold higher in

of

rhizome grown at low temperature compared to greenhouse grown plants. Our report is supported

ro

by the findings of Yang et al. [24] where podophyllotoxin content increased 5-fold in

Podophyllum hexandrum seedlings grown at chilling temperature compared to control. Similarly,

-p

Nadeem et al. [27] and Alam et al. [37] also observed that the content of podophyllotoxin in

re

rhizome of P. hexandrum was positively correlated with increasing altitude and ecological conditions when correlated with genotypic variations. Liu et al. [26] postulated that ecological

lP

factors plays key role in podophyllotoxin content in Sinopodophyllum hexandrum. In high elevation cultivation (3300 m), accumulation of podophyllotoxin in rhizomes of P. hexandrum

ur na

was 1.5-5.5% (dry weight), which is comparable to wild plants with a range of 1.5-10% [38, 39]. Cultivation of P. hexandrum at high elevation (3300 m) increased the accumulation of podophyllotoxin [18]. It was also reported that the metabolic activity of underground rhizome was triggered thereby enabling the plant to survive [25]. Together our findings suggest that SDH

Jo

and PLR pathway genes expression under low temperature were associated with podophyllotoxin accumulation.

Conclusions Conclusively, the expression levels of podophyllotoxin biosynthetic pathway genes SDH and PLR were up-regulated under low temperature, leading to an enhancement of podophyllotoxin

biosynthesis (3.49 folds) in rhizome of Dysosma versipellis. The induction of podophyllotoxin biosynthetic pathway under low temperature is the result of increased transcription of genes encoding the corresponding biosynthetic enzymes. However, further studies are needed to determine the role of low temperature in plant growth and podophyllotoxin biosynthesis. Therefore, the findings of this investigation will contribute to future studies in the field of functional genomics and metabolic engineering for this medicinally important TCM herb. This

of

study finding could be used to improve the production of podophyllotoxin through

ro

biotechnological manipulations and to develop methods for domesticating Dysosma versipellis. Meanwhile, it could be helpful for the TCM practitioners to know about the podophyllotoxin

re

-p

content at low temperature that can be useful for them to prescribe therapeutic dosage.

lP

Author statement

ur na

PK and JW carried out the experiments. PK conceived and planned the experiments. PK wrote the manuscript. PK and JW provided critical feedback and helped to shape the research, analysis and manuscript.

Declaration of interests

Jo

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgements This study was financially supported by Dr. Palaniyandi Karuppaiya's Postdoctoral Research Fellowship (No.0020407602031), Sichuan University, Chengdu, China.

Reference [1] P. Karuppaiya, H.S. Tsay, Therapeutic values, chemical constituents and toxicity of Taiwanese Dysosma pleiantha–A review, Toxicology letters 236(2) (2015) 90-97. [2] K. Palaniyandi, S. Wang, F. Chen, Chinese Medicinal Herbs as Source of Rational Anticancer Therapy, Medicinal Plants-Recent Advances in Research and Development, Springer2016, pp. 327-362.

of

[3] P. Karuppaiya, In vitro production of anti-cancer compounds, expression of lignan

biosynthetic pathway gene (s) and anti-cancer activity of biogenic metal nanoparticles

ro

synthesized from Dysosma pleiantha, Ph.D., Thesis, Department of Applied Chemistry,

-p

Chaoyang University of Technology, Taichung, Taiwan, 2013, pp. 1-150.

[4] P. Kumar, T. Pal, N. Sharma, V. Kumar, H. Sood, R.S. Chauhan, Expression analysis of Protoplasma 252(5) (2015) 1253-1262.

re

biosynthetic pathway genes vis-à-vis podophyllotoxin content in Podophyllum hexandrum Royle,

lP

[5] M. Liang, Y. Liu, S. An, L. Zhuo, L. Liu, Toxicology of Dysosma versipallis rhizome: a review, Journal of Medicinal Plants Research 4(9) (2010) 717-721.

ur na

[6] S. Wang, Y. Xie, China species red list, vol. 1, Red List. Beijing (2004). [7] L. Fu, China Plant Red Book—Rare and Endangered Plants, vol. 1, Science Press, Beijing, 1992.

[8] J.V. Marques, K.-W. Kim, C. Lee, M.A. Costa, G.D. May, J.A. Crow, L.B. Davin, N.G.

Jo

Lewis, Next generation sequencing in predicting gene function in podophyllotoxin biosynthesis, Journal of Biological Chemistry 288(1) (2013) 466-479. [9] D.P. Wankhede, D.K. Biswas, S. Rajkumar, A.K. Sinha, Expressed sequence tags and molecular cloning and characterization of gene encoding pinoresinol/lariciresinol reductase from Podophyllum hexandrum, Protoplasma 250(6) (2013) 1239-1249. [10] A. Kumari, H.R. Singh, A. Jha, M.K. Swarnkar, R. Shankar, S. Kumar, Transcriptome

sequencing of rhizome tissue of Sinopodophyllum hexandrum at two temperatures, BMC genomics 15(1) (2014) 871. [11] X. Lan, S. Ren, Y. Yang, M. Chen, C. Yang, H. Quan, G. Zhong, Z. Liao, Molecular cloning and characterization of the secoisolariciresinol dehydrogenase gene involved in podophyllotoxin biosynthetic pathway from Tibet Dysosma, Journal of Medicinal Plants Research 4(6) (2010) 484-489. [12] M. Yousefzadi, M. Sharifi, M. Behmanesh, A. Ghasempour, E. Moyano, J. Palazon, Salicylic

of

acid improves podophyllotoxin production in cell cultures of Linum album by increasing the

ro

expression of genes related with its biosynthesis, Biotechnology letters 32(11) (2010) 1739-1743. [13] M. Yousefzadi, M. Sharifi, M. Behmanesh, E. Moyano, M. Bonfill, R.M. Cusido, J. Palazon, Engineering in Life Sciences 10(4) (2010) 281-292.

-p

Podophyllotoxin: current approaches to its biotechnological production and future challenges,

re

[14] D. Bhattacharyya, R. Sinha, S. Ghanta, A. Chakraborty, S. Hazra, S. Chattopadhyay, Proteins differentially expressed in elicited cell suspension culture of Podophyllum hexandrum with

lP

enhanced podophyllotoxin content, Proteome science 10(1) (2012) 34. [15] R.A. Dixon, N.L. Paiva, Stress-induced phenylpropanoid metabolism, The plant cell 7(7)

ur na

(1995) 1085.

[16] R. Kushwaha, A. Bhattacharya, B. Singh, R. Singh, Factors affecting podophyllotoxin yield in the ex situ grown Podophyllum hexandrum, an endangered alpine native of the western Himalayas, Journal of natural medicines 66(1) (2012) 1-7.

Jo

[17] C.L. Seegers, R. Setroikromo, P.G. Tepper, P. Horvatovich, R. Peters, W.J. Quax, Methyl jasmonate treatment increases podophyllotoxin production in Podophyllum hexandrum roots under glasshouse conditions, Plant and Soil 417(1-2) (2017) 117-126. [18] M. Li, L. Ge, T. Kang, P. Sun, H. Xing, D. Yang, J. Zhang, P.W. Paré, High-elevation cultivation increases anti-cancer podophyllotoxin accumulation in Podophyllum hexandrum, Industrial crops and products 121 (2018) 338-344.

[19] A. Wu, M. Li, S. Zhang, J. Zhao, X. Liu, C. Wang, X. Wang, G. Zhong, Effect of topographical factors on podophyllotoxin content in Sinopodophyllum hexandrum and study on ecological suitability, Zhongguo Zhong yao za zhi= Zhongguo zhongyao zazhi= China journal of Chinese materia medica 40(12) (2015) 2299-2303. [20] X.B. Xie, S. Li, R.F. ZHANG, J. Zhao, Y.C. CHEN, Q. Zhao, Y.X. YAO, C.X. YOU, X.S. ZHANG, Y.J. HAO, The bHLH transcription factor MdbHLH3 promotes anthocyanin accumulation and fruit colouration in response to low temperature in apples, Plant, cell &

of

environment 35(11) (2012) 1884-1897.

[21] W. Liu, H. Wang, Y. Chen, S. Zhu, M. Chen, X. Lan, G. Chen, Z. Liao, Cold stress improves

ro

the production of artemisinin depending on the increase in endogenous jasmonate, Biotechnology

-p

and applied biochemistry 64(3) (2017) 305-314.

[22] T. Crifò, I. Puglisi, G. Petrone, G.R. Recupero, A.R.L. Piero, Expression analysis in response

re

to low temperature stress in blood oranges: implication of the flavonoid biosynthetic pathway, Gene 476(1) (2011) 1-9.

lP

[23] Z. Kovács, L. Simon-Sarkadi, A. Szűcs, G. Kocsy, Differential effects of cold, osmotic stress and abscisic acid on polyamine accumulation in wheat, Amino acids 38(2) (2010) 623-631.

ur na

[24] L. Yang, P. Sun, M. Li, Chilling temperature stimulates growth, gene over-expression and podophyllotoxin biosynthesis in Podophyllum hexandrum Royle, Plant physiology and biochemistry: PPB 107 (2016) 197.

[25] R. Kushwaha, S. Pandey, S. Chanda, A. Bhattacharya, P.S. Ahuja, Temperature-dependent growth and emergence of functional leaves: an adaptive mechanism in the seedlings of the

Jo

western Himalayan plant Podophyllum hexandrum, Journal of plant research 121(3) (2008) 299309.

[26] W. Liu, J. Liu, D. Yin, X. Zhao, Influence of ecological factors on the production of active substances in the anti-cancer plant Sinopodophyllum hexandrum (Royle) TS Ying, PLoS one 10(4) (2015) e0122981. [27] M. Nadeem, L. Palni, A. Kumar, S. Nandi, Podophyllotoxin content, above-and

belowground biomass in relation to altitude in Podophyllum hexandrum populations from Kumaun region of the Indian Central Himalaya, Planta medica 73(04) (2007) 388-391. [28] M.A. Alam, P. Gulati, A.K. Gulati, G.P. Mishra, P.K. Naik, Assessment of genetic diversity among Podophyllum hexandrum genotypes of the North-western Himalayan region for podophyllotoxin production, Indian J Biotechnol 8 (2009) 391-399. [29] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-time

of

quantitative PCR and the 2− ΔΔCT method, methods 25(4) (2001) 402-408. [30] G. Breton, J. Danyluk, J.-B.F. Charron, F. Sarhan, Expression profiling and bioinformatic and Arabidopsis, Plant physiology 132(1) (2003) 64-74.

ro

analyses of a novel stress-regulated multispanning transmembrane protein family from cereals

-p

[31] R. Akula, G.A. Ravishankar, Influence of abiotic stress signals on secondary metabolites in

re

plants, Plant signaling & behavior 6(11) (2011) 1720-1731.

[32] N. Austen, J.A. Lake, G. Phoenix, D.D. Cameron, The Regulation of Plant Secondary

lP

Metabolism in Response to Abiotic Stress: Interactions Between Heat Shock and Elevated CO2, Frontiers in Plant Science 10 (2019) 1463.

[33] H.Z. Rihan, M. Al-Issawi, M.P. Fuller, Advances in physiological and molecular aspects of

ur na

plant cold tolerance, Journal of Plant Interactions 12(1) (2017) 143-157. [34] V. Chinnusamy, J. Zhu, J.-K. Zhu, Cold stress regulation of gene expression in plants, Trends in plant science 12(10) (2007) 444-451.

Jo

[35] A. Singh, A. Purohit, Light and temperature effects on physiological reactions on alpine and temperate populations of Podophyllum hexandrum Royle, Journal of herbs, spices & medicinal plants 5(2) (1998) 57-66. [36] M.F. Thomashow, Plant cold acclimation: freezing tolerance genes and regulatory mechanisms, Annual review of plant biology 50(1) (1999) 571-599. [37] M.A. Alam, P. Gulati, A.K. Gulati, G.P. Mishra, P.K. Naik, Assessment of genetic diversity

among Podophyllum hexandrum genotypes of the North-western Himalayan region for podophyllotoxin production, (2009). [38] M.F. Li, W. Li, L.L. Zhou, T.T. Li, X.M. Su, Relationship between podophyllotoxin accumulation and soil nutrients and the influence of Fe2+ and Mn2+ on podophyllotoxin biosynthesis in Podophyllum hexandrum tissue culture, Plant physiology and biochemistry 71 (2013) 96-102. [39] H. Pandey, A. Kumar, L.M.S. Palni, S.K. Nandi, Podophyllotoxin content in rhizome and

of

root samples of Podophyllum hexandrum Royle populations from Indian Himalayan region,

Jo

ur na

lP

re

-p

ro

Journal of Medicinal Plants Research 9(9) (2015) 320-325.

Table 1. Primer sequences used for amplification ACTIN, PLR and SDH genes. Gene name

Sequences (5'→3')

Accession number

Forward TGGCACATCAAGCTGCAAAC EU573789

SDH Reverse GTTCTGGTGTAGCCCCCATC Forward TTGGTATGGATCCAGCACGG

KJ000045

PLR Forward GCAGGGATCCACGAGACCACC

of

Reverse TCGATCGCCTTTCTCACCAC FL640971

ACTIN

re

-p

ro

Reverse CCCACCACTGAGCACATTGTTCC

Table 2. The growth parameters of Dysosma versipellis at low and greenhouse temperature. Length (cm)

Fresh weight (g)

ºC

Stem

Rhizome

Stem and leaf

Rhizome

Stem and leaf

Rhizome

4~6

27.20±0.360a

13.30±0.458a

0.744±0.046a

1.164±0.097a

2.167±0.134a

0.478±0.019a

25~30

15.63±0.850b

6.93±0.611b

0.486±0.0345b

0.676±0.016b

0.127±0.020b

0.174±0.014b

ur na

lP

Temperature

Dry weight (g)

Jo

Note: Different letters indicated significant at P≤0.05 level at different temperatures.

Figure 1. Current biosynthetic pathway of Podophyllotoxin. Enzymatic abbreviates include: PAL, phenylalanine ammonia lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate CoA ligase; HCT, p-hydroxycinnamoyl-CoA; quinate shikimate p-hydroxycinnamoyl transferase; C3H, p-coumarate 3-hydroxylase; CCoAOMT, caffeoyl-CoA O-methyltransferase; COMT: caffeic acid 3-O-methyltransferase; CCR, cinnamoyl-CoA reductase; CAD, cinnamyl alcohol dehydrogenase; DPO, dirigent protein oxidase; PLR, pinoresinol–lariciresinol reductase; SDH,

of

secoisolariciresinol dehydrogenase; CYP719A23, cytochrome P450 719A23; OMT3, O-

ro

methyltransferase 3; CYP71CU1, cytochrome P450 71CU1; OMT1, O-methyltransferase1; 2ODD, 2-oxoglutarate/Fe(II)-dependent dioxygenase; DOP7H, deoxypodophyllotoxin 7-

Jo

ur na

lP

re

-p

hydroxylase [1].

Figure 2. Comparison of Chlorophyll A, B and Carotenoid content in leaf of D. versipellis grown at low and greenhouse temperature. Data represent as Mean ± SD of three replicates. If the

Jo

ur na

lP

re

-p

ro

of

letters are different, the results are significantly different at P≤0.05.

Figure 3. Podophyllotoxin biosynthetic pathway genes Secoisolariciresinol dehydrogenase (SDH) and Pinoresinollariciresinol reductase (PLR) expression at low (46ºC) and greenhouse temperature (25~30ºC). Data represent as Mean ± SD of three replicates. If the letters are

Jo

ur na

lP

re

-p

ro

of

different, the results are significantly different at P≤0.05.

Figure 4. A and B. UPLC Chromatograph of rhizome grown at low temperature (46ºC) and green house (25ºC). C. Podophyllotoxin accumulation in rhizome of Dysosma versipellis at low temperature (46ºC) and control (25~30ºC). Data represent as Mean ± SD of three replicates. If

Jo

ur na

lP

re

-p

ro

of

the letters are different, the results are significantly different at P≤0.05.