- Email: [email protected]
db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c
Biochemical and Biophysical Research Communications xxx (2016) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c Ye Yin b, 1, Lu Gao b, 1, Haiyan Lin b, Yue Wu b, Xiao Han b, Yunxia Zhu b, *, Jie Li a, ** a b
Department of Neurosurgery, Jingling Hospital, School of Medicine, Nanjing University, China Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing, 210029, Jiangsu, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 November 2016 Accepted 17 November 2016 Available online xxx
In this study, we report that daily administration of luteolin for 8 weeks improved hepatic steatosis by repressing hepatic TG accumulation and increasing glycogen storage. Luteolin inhibited hepatic de novo lipid synthesis by regulating the LXR-SREBP-1c signaling pathway, which is over-activated in the livers of db/db mice. Further in vitro studies revealed that luteolin can competitively bind to the ligand binding domain to suppress the LXR activation induced by an LXR agonist and high glucose, thereby decreasing TG accumulation in HepG2 cells and primary hepatocytes. Taken together, our results indicate that luteolin can abolish lipid accumulation induced by LXR-SREBP-1c activation both in vivo and in vitro, and may have potential as a therapeutic agent for treating NAFLD. © 2016 Elsevier Inc. All rights reserved.
Keywords: Non-alcoholic fatty liver disease Luteolin Liver X receptor Fatty acid db/db mouse
1. Introduction The current prevalence of non-alcoholic fatty liver disease (NAFLD), a common chronic liver disease encountered in hepatology clinics, is closely linked to the worldwide epidemic of obesity [1]. Patients with metabolic disorders are at high risk for NAFLD, which is defined as the accumulation of lipid, mainly in the form of triacylglycerol, exceeding 5e10% of the liver weight [2]. Three major sources of fat contribute to the excessive triglycerides (TGs) accumulated in the liver: dietary fat intake; increased lipolysis of fat originally stored in white fat tissue and transfer of metabolites to the liver; and fatty acids synthesized within the liver through de novo lipogenesis [3]. Previous studies suggested a substantial contribution of de novo fat synthesis to the pathology of NAFLD: over one-fourth of liver TGs were newly synthesized from 2-carbon precursors derived from glucose, fructose, and amino acids [4]. De novo fat synthesis in the liver converts excess carbohydrates into fatty acids and their esterified TG forms through the activity of many enzymes, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS),
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (Y. Zhu), [email protected] (J. Li). 1 These authors contributed equally to this work.
and stearoyl-CoA desaturase 1 (SCD1). Recent studies have reported that knockdown of these key lipogenic enzymes in mice could reverse many metabolic disorders associated with hepatic steatosis, suggesting that decreasing lipogenesis and TG synthesis in the liver could represent an important treatment for NAFLD [5,6]. Lipogenic gene expression can be regulated by a key transcriptional factor, the sterol regulatory element binding protein-1c (SREBP-1c) [7]. Deletion of SREBP isoforms can lead to impaired fatty acid and TG synthesis [8], and SREBP-1c expression is abolished in LXR null animals, suggesting that LXRs are key regulators of this gene [9]. LXRs, which are ligand-activated transcription factors belonging to the superfamily of nuclear hormone-receptors [10], are classified as two types, LXRa and LXRb, and these share sequence homology as well as sharing the same ligands and DNA binding sites [11]. The differences in biological activities of these two members are mainly due to their different organ distributions. LXRa is primarily expressed in tissues related to lipid metabolism, including liver, adipose tissue, and intestine, whereas LXRb is widely expressed in the immune system, pancreatic islets, and skeletal muscle [11,12]. Activation of LXRs by natural ligands, including fatty acids and oxysterols, as well as by synthetic compounds such as T0901317 and GW3965, is well documented [13,14]. However, a recent study also revealed that LXRs can be activated in the liver by glucose at physiological concentrations and that glucose induces the
http://dx.doi.org/10.1016/j.bbrc.2016.11.101 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
2
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
expression of LXR target genes with an efficacy similar to that observed with oxysterols [15]. LXRs therefore provide a transcriptional switch that integrates hepatic glucose metabolism and fatty acid synthesis. Treatment of rodents with synthetic LXR ligands decreased hepatic gluconeogenesis and enhanced lipogenesis, indicating an importance of LXRs in the integration of liver carbohydrate and lipid metabolism [16]. Luteolin, a flavonoid, occurs in a broad range of vegetables, fruits, and grains and has a variety of biological activities, including anti-cancer, anti-diabetic, anti-oxidant, anti-inflammatory, and antiviral properties [17,18]. Luteolin is also a general phosphodiesterase inhibitor, and its effect on cholesterol synthesis has been well documented [19]. Other recent studies have also revealed that luteolin may ameliorate obesity induced by high fat diets and may promote insulin resistance in mice [20e22]. However, the antiobesity effect of luteolin and its underlying mechanism needs further study. The current study examined the effects of luteolin and its mechanism of action with respect to NAFLD in db/db mice. The particular focus is on its effect in the LXR-SREBP-1c pathway, as this pathway is known to play a key role in carbohydrate and lipid metabolism in the livers of db/db mice fed a normal chow diet. 2. Materials and methods 2.1. Animal treatments Male db/db mice (6 weeks old; C57BL/KsJ; n ¼ 6 per group) were purchased from the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. The animals fed with a normal diet were dosed daily by oral gavage with vehicle (0.5% carboxymethylcellulose) or selected test compounds suspended in 0.5% carboxymethylcellulose, at 20 or 100 mg/kg of luteolin. All animal studies were performed according to guidelines established by the Research Animal Care Committee of Nanjing Medical University who specifically approved this study with a no. NJMUIACUC2011011203. 2.2. Glucose tolerance test Intraperitoneal glucose tolerance tests (IPGTT) were performed at 0, 4, and 8 weeks after the onset of luteolin dosing. Mice were fasted for 16 h before glucose challenge. After treatment with luteolin for 2 h, animals were injected intraperitoneally with glucose at a concentration of 1 g/kg body wt Approximately 5 ml of whole blood was drawn from the tip of the tail vein, and glucose was measured with the Optium Xceed™ Diabetes Monitoring System. Blood was collected at 0, 15, 30, 60 and 120 min after the glucose injection. 2.3. Oil Red O and periodic acid schiff (PAS) staining Cells were washed twice with PBS and fixed with 4% formaldehyde in PBS for 30 min. After washing twice in PBS, cells were stained for 15 min in freshly diluted Oil Red O solution. Paraffinembedded livers were sectioned at 4 mm and stained with hematoxylin-eosin and PAS as previously described [23]. Representative photomicrographs were captured at 200 magnification using a system incorporated in the microscope.
CO2. 2.5. Transient transfection and luciferase reporter assay The luciferase reporter construct LXRE 3-TK-LUC was transiently transfected into HepG2 cells grown in 24-well plates using the Lipofectamine 2000 reagent according to the manufacturer's instructions. The LXRE-luciferase reporter construct (LXRE 3-TKLUC) driven by three copies of the LXR response element (LXRE) was obtained from B.M. Forman (Department of Gene Regulation and Drug Discovery, Beckman Research Institute of City of Hope National Medical Center, Duarte, CA, USA). A plasmid expressing the gene encoding b-galactosidase driven by the cytomegalovirus (CMV) promoter (Clontech Laboratories, Palo Alto, CA, USA) was simultaneously co-transfected as an internal control. The medium was replaced 4 h after transfection. Twenty-four hours after transfection, the cells were treated with the indicated concentrations of LXR agonists or luteolin for an additional 24 h and harvested for luciferase reporter assays as described previously [24]. 2.6. Real-time RT-PCR assay and Western blot Cells were cultured and treated as described above. The sequences of the primers (shown in Table 1) used are available upon request. Q-PCR and Western blotting was performed as described previously [25]. 2.7. Immunofluorescence Cells were incubated with drug or 25 mM glucose for 24 h and then washed three times with cold PBS and fixed with 4% paraformaldehyde for 20 min. After an extensive PBS wash, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min. Myotubes were incubated overnight at 4 C with the anti-SREBP-1 antibody, washed three times with PBS and then treated for 1 h with FITCconjugated goat-anti-mouse immunoglobulin G. Nuclei were counterstained with Hoechst stain. Slides were prepared with mounting medium (BioRad), and pictures were taken using a Leica DM IRB fluorescence microscope equipped with a CF1 APO PLAN 600 /1.40 oil objective and a CoolPix digital camera. 2.8. Fatty acids assay For testing fatty acid content, 106 cells were extracted by homogenization with 200 ml of chloroform-Triton X-100 (1% Triton X100 in pure chloroform) in a microhomogenizer. The detection was following the instructions of the manufacturer (ab65341, Abcam). 2.9. Blood lipid assay About 50 ml tail vein blood was collected in EDTA-coated tubes. Plasma TG and cholesterol were determined using a Roche Cobas blood chemistry analyzer. 2.10. Statistical analysis Differences between groups were analyzed using the two-sided t-test and ANOVA with P < 0.05 considered statistically significant. 3. Results
2.4. Cell culture Human hepatoma HepG2 cells obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) were cultured in DMEM medium at 37 C in a humidified atmosphere containing 5%
3.1. Treatment with luteolin decreases the body weight gain and reduces triglyceride levels in db/db mice Mice treated with 20 or 100 mg/kg luteolin per day for 8 weeks
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
3
Table 1 Primers for real-time RT-PCR. Genes
hLXRa hLXRb hSREBP-1c hFas hACC1 hSCD1 hGPAM hb-action mLXRa mLXRb mSREBP-1c mFas mACC1 mSCD1 mGPAM mb-action
Gene ID
10062 7376 6720 134637 200350 6319 57678 646821 22259 22260 20787 14102 104371 20249 14732 11461
Primers (50 -30 ) Forward
Reverse
CAACCCTGGGAGTGAGAGTATCAC AAGGACTTCACCTACAGCAAGGA ATCGACTA CATTCGCTTTCT TGTC CTGCTG AA GCCCAAC CCGAGCAAGGGATAAGTT CCTCTACTTGGAAGACGACATTCGC TGAGGAATGGGGTGAGTG TCATGAAGTGTGACGTGGACAT GGAGTGTCGACTTCGCAAATG CCCCACAAGTTCTCTGGACACT GGAGCCATGGATTGCACATT CTGAGGGACCCTACCGCATA AGAATCTCCTGGTGACAATGCTTAT CCACGCCTGGCTTCCTTGGCT AGCACCAGCAATTCATCACC AGGCCAACCGTGAAAAGATG
CATTCATGGCCCTGGAAGAACT CATTCATGGCCCTGGAAGAACT CAGATCCTTCAGAGATTTGC AGTACCCATTCCCCTCTGT ATGGAATGG CAGTGAGGT GCAGCCGAGCTTTGTAAGAGCGGT CTGGGGAGTGCAGGAGTA CTCAGGAGGAGCAATGATCTTG GATCTGTTCTTCTGACAGCACACA TGACGTGGCGGAGGTACTG GGCCCGGAAGTCACTGT AGCACATCTCGAAGGCTACACA GTAGGGTCCCGGCCACAT TGGTGTAGGCGAGTGGCGGA TTCTGCAGGTACTCAGACTC AGAGCATAGCCCTCGTAGATGG
showed decreased body weight gains (Fig. 1A and B), although no significant difference was noted in the food intake during the therapy (data not shown). Blood glucose levels, as well as plasma TG and cholesterol levels, were measured following luteolin treatment. As shown in Fig. 1C, plasma TG levels were significantly reduced, while plasma cholesterol levels showed a decreasing trend in the group treated with 100 mg/kg luteolin (data not shown). Although no significant differences were observed in the fasting blood glucose level of these groups, the luteolin treatment actually improved the impaired in vivo glucose tolerance (Fig. 1D).
3.2. Luteolin treatment reduced fatty liver disease symptoms in db/ db mice The liver plays a central role in controlling the whole body homeostasis, including lipid and carbohydrate metabolism. As shown in Fig. 2, luteolin treatment significantly attenuated lipid droplet accumulation and promoted hepatic glycogen storage in db/db mice. Ultrasound images also revealed that an 8-week treatment with luteolin markedly improved the fatty infiltration in the livers of these mice (data not shown).
Fig. 1. Luteolin improves lipid and glucose metabolism in db/db mice. Male mice were dosed daily by oral gavage with vehicle or luteolin for 8 weeks (week 6e14). Mouse body weights were monitored during treatment (A, B). Plasma triglycerides (TG) and cholesterol were quantitatively analyzed (C). An intraperitoneal glucose tolerance test (D) was performed 2 h after treatment with luteolin. Values are the means ± SD. *P < 0.05, **P < 0.01 vs. db/db mice (0.5% carboxymethylcellulose).
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
4
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
Fig. 2. Luteolin reduces hepatic steatosis in livers of db/db mice. Mice were treated with either vehicle or luteolin (n ¼ 6 per group) for 8 weeks. Representative images of livers are shown for all groups. Liver sections were stained with Oil Red O reagent or PAS reagent to evaluate lipid accumulation or glycogen storage, respectively.
3.3. Luteolin reduced TG levels by regulating SREBP-1c activation in the liver Further investigations into hepatic lipid metabolism revealed that mice treated with 100 mg/kg luteolin showed markedly
reduced TG levels when compared with the untreated control group (Fig. 3A). LXRs are key transcriptional regulators of lipid metabolism; thus, abnormal activation of LXRs will induce lipid dysregulation in most organs [16]. The LXRs are therefore an important transcriptional switch, regulating the expression of
Fig. 3. Luteolin inhibits liver triglyceride (TG) accumulation and lipid synthesis in db/db mice. Quantitative analysis of hepatic TG content (A) and expression of LXR-SREBP-1c system proteins (B) in the livers of mice treated with luteolin for 8 weeks. Values are the means ± SD. **P < 0.01 vs. db/db mice.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
lipogenic enzymes through the target gene SREBP-1c. The SREBP-1c gene, in turn, plays an important role in the pathogenesis of NAFLD in db/db mice. As shown in Fig. 3B and C, the hepatic SREBP-1c protein and its target gene products involved in lipogenesis were significantly decreased in luteolin-treated mice, indicating that luteolin may regulate hepatic lipid homeostasis by inhibiting the activation of the LXR-SREBP-1c signaling pathway.
3.4. Luteolin inhibited the LXR-SREBP-1c pathway and reduced lipid droplet accumulation in vitro We evaluated the possibility of a direct effect of luteolin on hepatocytes by investigating the response of lipid synthesis to luteolin in both HepG2 cells and mouse primary hepatocytes. As shown in Fig. 4A and B, lipid accumulation was markedly increased in cells incubated for 48 h with T1317, a well-known LXR agonist, indicating a key role for LXR activation in TG synthesis. A consistent and significant suppression of lipid droplet formation was also
5
observed in cells treated with luteolin. We then examined the effect of luteolin on the LXR-SREBP-1c pathway in vitro. As shown in Fig. 4C, the increased expression of SREBP-1c and its target genes in response to T1317 was significantly inhibited in cells treated with luteolin. In HepG2 cells, similar results were also observed in primary hepatocytes (data not shown). SREBP-1c is synthesized as a precursor (125 kDa) attached to the nuclear envelope and endoplasmic reticulum, and the membranebound precursor is cleaved to generate a soluble NH2-terminal fragment (68 kDa) that translocates to the nucleus and binds to the sterol regulatory element of the promoter region of target genes [26]. Immunofluorescence localization studies (Fig. 4E) revealed an inhibition of SREBP-1c cleavage and translocation in response to luteolin treatment. The inhibition of LXR activation was confirmed by luciferase reporter assays. HepG2 cells transiently transfected with pGL3LXRE-Luc plasmid and treated with luteolin showed an inhibition of LXR activation induced by different ligands (including T1317 and
Fig. 4. Luteolin inhibits cellular lipogenesis through LXRs activation in hepatic cells. Cells were treated with vehicle or T1317 (5 mmol/l) in combination with luteolin (10 mmol/l) for 48 h. Lipid deposition was observed by Oil Red O staining (A) and free fatty acid content was quantitatively analyzed by a colorimetric assay (B). Cells were pre-incubated with luteolin for 2 h, followed by co-treatment with drugs for 24 h. The transcripts of lipogenic genes were then analyzed by real-time RT-PCR in HepG2 cells (C). The cells were transiently transfected with LXRE 3-TK-LUC and treated without (control) or with T1317 or high glucose for 24 h. Luteolin decreased LXR activation in HepG2 cells, as determined by the luciferase reporter assay (D). Representative images of immunofluorescence staining for SREBP-1c after HepG2 cells were incubated with the drug for 24 h (E). Values are the means ± SD of three independent experiments.*P < 0.05, **P < 0.01 vs. control.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
6
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
high glucose). The baseline level of LXR activation was also reduced in the luteolin-treated group (Fig. 4D). 4. Discussion Flavones are found widely in the plant kingdom and are reported to have various biological functions. Previous studies suggest that several known soy isoflavones, such as genistein and daidzein, have potential anti-diabetic and anti-obesity effects [27,28]. Luteolin, a commonly occurring flavone, was reported to alleviate obesity and its comorbidity [20,22], but its effects on NAFLD need further research. NAFLD encompasses a wide spectrum of liver diseases, ranging from asymptomatic steatosis to cirrhosis and ultimately to liver injury. Several lines of evidence have shown that obesity and insulin-resistance are two key contributors to the development of this disease [29,30]. In the present study, we found that treatment with luteolin can significantly inhibit the body weight gain in db/db mice without affecting their food intake. The plasma TG level was also decreased and glucose tolerance impairment was overcome in luteolin treated db/db mice (Fig. 1). A previous study suggested that liver triacylglycerol is a more persistent and robust measure of increased lipogenesis than are plasma triacylglycerols [16]. Our determination of liver TG levels showed that hepatic TG accumulation was repressed in luteolintreated mice. This result was supported by both hepatic histology and ultrasonic findings (Fig. 2). The liver plays a major role in the whole body metabolism of glucose, lipids, and energy, and the LXRs are recognized as key regulators that integrate hepatic glucose metabolism and fatty acid synthesis [11]. Chronic hyperglycemia can induce LXR overactivation, which is possibly a predisposing factor for hepatic steatosis in db/db mice. The expression of LXR mRNA was significantly increased in a rat model of NAFLD, and a significant positive correlation was observed between LXR activation and the degree of NAFLD [31]. LXRs control hepatic TG homeostasis mainly through regulation of the transcription of SREBP-1c, the master regulator for TG synthesis. Our evaluation of the protein level of the genes involved in the LXR-SREBP1c signaling pathway revealed that these genes were suppressed in the livers of luteolin-treated mice (Fig. 3). Our in vitro examination of luteolin effects on LXR ligands in treated hepatocytes used T1317, a high-affinity ligand of LXRs, to stimulate the expression of lipogenic genes and increase short-term accumulation of intracellular lipids. As expected, luteolin treatment reversed the lipid accumulation and increased gene expression caused by T1317, indicating that luteolin regulates hepatic lipid homeostasis by inhibiting LXR activation. Luteolin possibly binds to the LBD (ligand binding domain) of the nuclear receptor and competes with the ligands to repress the activation of LXRs (Fig. 4). Increased lipolysis of peripheral fats stored in white adipose tissue and the flow of lipolysis products to the liver is generally recognized as important in NAFLD, since over 60% of the TG accumulated in the livers of NAFLD patients originates from adipose tissue [4]. Luteolin can potentiate insulin action in adipocytes by increasing PPARg transcriptional activity and enhancing GLUT4 expression [21]. Kwon and coworkers recently reported that luteolin upregulated the expression of genes related to lipolysis and the TCA cycle prior to lipid droplet formation in adipocytes, which may result in reduced adiposity and decreased plasma free fatty acid levels [22]. In the present study, a decreased fat cell size was also observed in the luteolin treated groups (data not shown). Therefore, based on previous reports and our studies, we can postulate that luteolin maintains cellular lipid homeostasis in the liver and other peripheral tissues, thereby reducing the signs of fatty liver disease.
The early stages of NAFLD are characterized by the frequent occurrence of hyperglycemia and hyperlipemia in patients. Many tissues, including the liver, can take up excess fatty acids and carbohydrates and convert them to TGs for storage. Several studies have reported that flavonoids, such as genistein, quercetin, and isorhamnetin, can act as competitive inhibitors of glucose uptake in many different cell types [22]. Our evaluation of the effects of luteolin on hepatic fatty acid and glucose uptake showed no inhibition of hepatic lipid uptake nor glucose uptake into hepatocytes (data not shown). Evaluation of glycogen synthesis and glycolysis, the two main ways for glucose consumption in the liver, revealed that the barrier to liver glycogen synthesis in db/db mice was reversed by luteolin treatment (Fig. 2). The data obtained from our animal study revealed that luteolin could alleviate and modulate obesity-associated NAFLD in db/db mice. Luteolin can suppress the hepatic conversion of excess carbohydrates to TG by directly blocking the LXR-SREBP-1c pathway. It is encouraging that inhibiting lipid synthesis to improve metabolic disorders is more attainable than enhancing fatty acid oxidation by drug treatment. Therefore, luteolin may have future usefulness in the clinical setting as a treatment for NAFLD. Acknowledgments This work was supported by grants from the Natural Science Foundation of Jiangsu Province (BK20130889) to Ye Yin; the Natural Science Foundation of Jiangsu Province (BK20131389) to Haiyan Lin; the National Natural Science Foundation of China (81670703). References [1] K. Qureshi, G.A. Abrams, Metabolic liver disease of obesity and role of adipose tissue in the pathogenesis of nonalcoholic fatty liver disease, World J. Gastroenterol. WJG 13 (2007) 3540e3553. [2] N. Chalasani, Z. Younossi, J.E. Lavine, A.M. Diehl, E.M. Brunt, K. Cusi, M. Charlton, A.J. Sanyal, The diagnosis and management of non-alcoholic fatty liver disease: practice guideline by the american association for the study of liver diseases, american college of gastroenterology, and the american gastroenterological association, Hepatology 55 (2012) 2005e2023. [3] C. Postic, J. Girard, The role of the lipogenic pathway in the development of hepatic steatosis, Diabetes Metab. 34 (2008) 643e648. [4] K.L. Donnelly, C.I. Smith, S.J. Schwarzenberg, J. Jessurun, M.D. Boldt, E.J. Parks, Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease, J. Clin. Investig. 115 (2005) 1343e1351. [5] D.B. Savage, C.S. Choi, V.T. Samuel, Z.X. Liu, D. Zhang, A. Wang, X.M. Zhang, G.W. Cline, X.X. Yu, J.G. Geisler, S. Bhanot, B.P. Monia, G.I. Shulman, Reversal of diet-induced hepatic steatosis and hepatic insulin resistance by antisense oligonucleotide inhibitors of acetyl-CoA carboxylases 1 and 2, J. Clin. Investig. 116 (2006) 817e824. [6] G. Jiang, Z. Li, F. Liu, K. Ellsworth, Q. Dallas-Yang, M. Wu, J. Ronan, C. Esau, C. Murphy, D. Szalkowski, R. Bergeron, T. Doebber, B.B. Zhang, Prevention of obesity in mice by antisense oligonucleotide inhibitors of stearoyl-CoA desaturase-1, J. Clin. Investig. 115 (2005) 1030e1038. [7] J.D. Horton, Y. Bashmakov, I. Shimomura, H. Shimano, Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 5987e5992. [8] G. Liang, J. Yang, J.D. Horton, R.E. Hammer, J.L. Goldstein, M.S. Brown, Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c, J. Biol. Chem. 277 (2002) 9520e9528. [9] J.J. Repa, G. Liang, J. Ou, Y. Bashmakov, J.M. Lobaccaro, I. Shimomura, B. Shan, M.S. Brown, J.L. Goldstein, D.J. Mangelsdorf, Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta, Genes Dev. 14 (2000) 2819e2830. [10] N. Zelcer, P. Tontonoz, Liver X receptors as integrators of metabolic and inflammatory signaling, J. Clin. Investig. 116 (2006) 607e614. [11] M. Korach-Andre, J.A. Gustafsson, Liver X receptors as regulators of metabolism, Biomol. Concepts 6 (2015) 177e190. [12] S.W. Beaven, A. Matveyenko, K. Wroblewski, L. Chao, D. Wilpitz, T.W. Hsu, J. Lentz, B. Drew, A.L. Hevener, P. Tontonoz, Reciprocal regulation of hepatic and adipose lipogenesis by liver X receptors in obesity and insulin resistance, Cell Metab. 18 (2013) 106e117. [13] S.M. Ulven, K.T. Dalen, J.A. Gustafsson, H.I. Nebb, LXR is crucial in lipid metabolism, Prostagl. Leukot. Essent. Fat. Acids 73 (2005) 59e63. [14] J.M. Lehmann, S.A. Kliewer, L.B. Moore, T.A. Smith-Oliver, B.B. Oliver, J.L. Su,
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
S.S. Sundseth, D.A. Winegar, D.E. Blanchard, T.A. Spencer, T.M. Willson, Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway, J. Biol. Chem. 272 (1997) 3137e3140. N. Mitro, P.A. Mak, L. Vargas, C. Godio, E. Hampton, V. Molteni, A. Kreusch, E. Saez, The nuclear receptor LXR is a glucose sensor, Nature 445 (2007) 219e223. J.W. Chisholm, J. Hong, S.A. Mills, R.M. Lawn, The LXR ligand T0901317 induces severe lipogenesis in the db/db diabetic mouse, J. lipid Res. 44 (2003) 2039e2048. S. Jang, K.W. Kelley, R.W. Johnson, Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 7534e7539. G.K. Harris, Y. Qian, S.S. Leonard, D.C. Sbarra, X. Shi, Luteolin and chrysin differentially inhibit cyclooxygenase-2 expression and scavenge reactive oxygen species but similarly inhibit prostaglandin-E2 formation in RAW 264.7 cells, J. Nutr. 136 (2006) 1517e1521. M.C. Yu, J.H. Chen, C.Y. Lai, C.Y. Han, W.C. Ko, Luteolin, a non-selective competitive inhibitor of phosphodiesterases 1-5, displaced [3H]-rolipram from high-affinity rolipram binding sites and reversed xylazine/ketamineinduced anesthesia, Eur. J. Pharmacol. 627 (2010) 269e275. N. Xu, L. Zhang, J. Dong, X. Zhang, Y.G. Chen, B. Bao, J. Liu, Low-dose diet supplement of a natural flavonoid, luteolin, ameliorates diet-induced obesity and insulin resistance in mice, Mol. Nutr. Food Res. 58 (2014) 1258e1268. L. Ding, D. Jin, X. Chen, Luteolin enhances insulin sensitivity via activation of PPARgamma transcriptional activity in adipocytes, J. Nutr. Biochem. 21 (2010) 941e947. E.Y. Kwon, U.J. Jung, T. Park, J.W. Yun, M.S. Choi, Luteolin attenuates hepatic steatosis and insulin resistance through the interplay between the liver and adipose tissue in mice with diet-induced obesity, Diabetes 64 (2015) 1658e1669. H.O. Lyon, E.K. Schulte, P. Prento, M.R. Barer, M.C. Bene, Standardized staining
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
7
methods: feulgen-rossenbeck reaction for desoxyribonucleic acid and periodic acid-schiff (PAS) procedure, Biotech. Histochem. Off. Publ. Biol. Stain Comm. 77 (2002) 121e125. X. Han, Y. Sun, S. Scott, D. Bleich, Tissue inhibitor of metalloproteinase-1 prevents cytokine-mediated dysfunction and cytotoxicity in pancreatic islets and beta-cells, Diabetes 50 (2001) 1047e1055. Z.X. Meng, J.X. Sun, J.J. Ling, J.H. Lv, D.Y. Zhu, Q. Chen, Y.J. Sun, X. Han, Prostaglandin E2 regulates Foxo activity via the Akt pathway: implications for pancreatic islet beta cell dysfunction, Diabetologia 49 (2006) 2959e2968. X. Wang, R. Sato, M.S. Brown, X. Hua, J.L. Goldstein, SREBP-1, a membranebound transcription factor released by sterol-regulated proteolysis, Cell 77 (1994) 53e62. M.S. Choi, U.J. Jung, J. Yeo, M.J. Kim, M.K. Lee, Genistein and daidzein prevent diabetes onset by elevating insulin level and altering hepatic gluconeogenic and lipogenic enzyme activities in non-obese diabetic (NOD) mice, Diabetes Metab. Res. Rev. 24 (2008) 74e81. N. Palanisamy, P. Viswanathan, C.V. Anuradha, Effect of genistein, a soy isoflavone, on whole body insulin sensitivity and renal damage induced by a high-fructose diet, Ren. Fail. 30 (2008) 645e654. G. Pagano, G. Pacini, G. Musso, R. Gambino, F. Mecca, N. Depetris, M. Cassader, E. David, P. Cavallo-Perin, M. Rizzetto, Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome: further evidence for an etiologic association, Hepatology 35 (2002) 367e372. G. Marchesini, M. Brizi, G. Bianchi, S. Tomassetti, E. Bugianesi, M. Lenzi, A.J. McCullough, S. Natale, G. Forlani, N. Melchionda, Nonalcoholic fatty liver disease: a feature of the metabolic syndrome, Diabetes 50 (2001) 1844e1850. N. Higuchi, M. Kato, Y. Shundo, H. Tajiri, M. Tanaka, N. Yamashita, M. Kohjima, K. Kotoh, M. Nakamuta, R. Takayanagi, M. Enjoji, Liver X receptor in cooperation with SREBP-1c is a major lipid synthesis regulator in nonalcoholic fatty liver disease, Hepatol. Res. Off. J. Jpn. Soc. Hepatol. 38 (2008) 1122e1129.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c Ye Yin b, 1, Lu Gao b, 1, Haiyan Lin b, Yue Wu b, Xiao Han b, Yunxia Zhu b, *, Jie Li a, ** a b
Department of Neurosurgery, Jingling Hospital, School of Medicine, Nanjing University, China Key Laboratory of Human Functional Genomics of Jiangsu Province, Nanjing Medical University, Nanjing, 210029, Jiangsu, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 16 November 2016 Accepted 17 November 2016 Available online xxx
In this study, we report that daily administration of luteolin for 8 weeks improved hepatic steatosis by repressing hepatic TG accumulation and increasing glycogen storage. Luteolin inhibited hepatic de novo lipid synthesis by regulating the LXR-SREBP-1c signaling pathway, which is over-activated in the livers of db/db mice. Further in vitro studies revealed that luteolin can competitively bind to the ligand binding domain to suppress the LXR activation induced by an LXR agonist and high glucose, thereby decreasing TG accumulation in HepG2 cells and primary hepatocytes. Taken together, our results indicate that luteolin can abolish lipid accumulation induced by LXR-SREBP-1c activation both in vivo and in vitro, and may have potential as a therapeutic agent for treating NAFLD. © 2016 Elsevier Inc. All rights reserved.
Keywords: Non-alcoholic fatty liver disease Luteolin Liver X receptor Fatty acid db/db mouse
1. Introduction The current prevalence of non-alcoholic fatty liver disease (NAFLD), a common chronic liver disease encountered in hepatology clinics, is closely linked to the worldwide epidemic of obesity [1]. Patients with metabolic disorders are at high risk for NAFLD, which is defined as the accumulation of lipid, mainly in the form of triacylglycerol, exceeding 5e10% of the liver weight [2]. Three major sources of fat contribute to the excessive triglycerides (TGs) accumulated in the liver: dietary fat intake; increased lipolysis of fat originally stored in white fat tissue and transfer of metabolites to the liver; and fatty acids synthesized within the liver through de novo lipogenesis [3]. Previous studies suggested a substantial contribution of de novo fat synthesis to the pathology of NAFLD: over one-fourth of liver TGs were newly synthesized from 2-carbon precursors derived from glucose, fructose, and amino acids [4]. De novo fat synthesis in the liver converts excess carbohydrates into fatty acids and their esterified TG forms through the activity of many enzymes, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS),
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (Y. Zhu), [email protected] (J. Li). 1 These authors contributed equally to this work.
and stearoyl-CoA desaturase 1 (SCD1). Recent studies have reported that knockdown of these key lipogenic enzymes in mice could reverse many metabolic disorders associated with hepatic steatosis, suggesting that decreasing lipogenesis and TG synthesis in the liver could represent an important treatment for NAFLD [5,6]. Lipogenic gene expression can be regulated by a key transcriptional factor, the sterol regulatory element binding protein-1c (SREBP-1c) [7]. Deletion of SREBP isoforms can lead to impaired fatty acid and TG synthesis [8], and SREBP-1c expression is abolished in LXR null animals, suggesting that LXRs are key regulators of this gene [9]. LXRs, which are ligand-activated transcription factors belonging to the superfamily of nuclear hormone-receptors [10], are classified as two types, LXRa and LXRb, and these share sequence homology as well as sharing the same ligands and DNA binding sites [11]. The differences in biological activities of these two members are mainly due to their different organ distributions. LXRa is primarily expressed in tissues related to lipid metabolism, including liver, adipose tissue, and intestine, whereas LXRb is widely expressed in the immune system, pancreatic islets, and skeletal muscle [11,12]. Activation of LXRs by natural ligands, including fatty acids and oxysterols, as well as by synthetic compounds such as T0901317 and GW3965, is well documented [13,14]. However, a recent study also revealed that LXRs can be activated in the liver by glucose at physiological concentrations and that glucose induces the
http://dx.doi.org/10.1016/j.bbrc.2016.11.101 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
2
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
expression of LXR target genes with an efficacy similar to that observed with oxysterols [15]. LXRs therefore provide a transcriptional switch that integrates hepatic glucose metabolism and fatty acid synthesis. Treatment of rodents with synthetic LXR ligands decreased hepatic gluconeogenesis and enhanced lipogenesis, indicating an importance of LXRs in the integration of liver carbohydrate and lipid metabolism [16]. Luteolin, a flavonoid, occurs in a broad range of vegetables, fruits, and grains and has a variety of biological activities, including anti-cancer, anti-diabetic, anti-oxidant, anti-inflammatory, and antiviral properties [17,18]. Luteolin is also a general phosphodiesterase inhibitor, and its effect on cholesterol synthesis has been well documented [19]. Other recent studies have also revealed that luteolin may ameliorate obesity induced by high fat diets and may promote insulin resistance in mice [20e22]. However, the antiobesity effect of luteolin and its underlying mechanism needs further study. The current study examined the effects of luteolin and its mechanism of action with respect to NAFLD in db/db mice. The particular focus is on its effect in the LXR-SREBP-1c pathway, as this pathway is known to play a key role in carbohydrate and lipid metabolism in the livers of db/db mice fed a normal chow diet. 2. Materials and methods 2.1. Animal treatments Male db/db mice (6 weeks old; C57BL/KsJ; n ¼ 6 per group) were purchased from the Shanghai Institute of Materia Medica, Chinese Academy of Sciences. The animals fed with a normal diet were dosed daily by oral gavage with vehicle (0.5% carboxymethylcellulose) or selected test compounds suspended in 0.5% carboxymethylcellulose, at 20 or 100 mg/kg of luteolin. All animal studies were performed according to guidelines established by the Research Animal Care Committee of Nanjing Medical University who specifically approved this study with a no. NJMUIACUC2011011203. 2.2. Glucose tolerance test Intraperitoneal glucose tolerance tests (IPGTT) were performed at 0, 4, and 8 weeks after the onset of luteolin dosing. Mice were fasted for 16 h before glucose challenge. After treatment with luteolin for 2 h, animals were injected intraperitoneally with glucose at a concentration of 1 g/kg body wt Approximately 5 ml of whole blood was drawn from the tip of the tail vein, and glucose was measured with the Optium Xceed™ Diabetes Monitoring System. Blood was collected at 0, 15, 30, 60 and 120 min after the glucose injection. 2.3. Oil Red O and periodic acid schiff (PAS) staining Cells were washed twice with PBS and fixed with 4% formaldehyde in PBS for 30 min. After washing twice in PBS, cells were stained for 15 min in freshly diluted Oil Red O solution. Paraffinembedded livers were sectioned at 4 mm and stained with hematoxylin-eosin and PAS as previously described [23]. Representative photomicrographs were captured at 200 magnification using a system incorporated in the microscope.
CO2. 2.5. Transient transfection and luciferase reporter assay The luciferase reporter construct LXRE 3-TK-LUC was transiently transfected into HepG2 cells grown in 24-well plates using the Lipofectamine 2000 reagent according to the manufacturer's instructions. The LXRE-luciferase reporter construct (LXRE 3-TKLUC) driven by three copies of the LXR response element (LXRE) was obtained from B.M. Forman (Department of Gene Regulation and Drug Discovery, Beckman Research Institute of City of Hope National Medical Center, Duarte, CA, USA). A plasmid expressing the gene encoding b-galactosidase driven by the cytomegalovirus (CMV) promoter (Clontech Laboratories, Palo Alto, CA, USA) was simultaneously co-transfected as an internal control. The medium was replaced 4 h after transfection. Twenty-four hours after transfection, the cells were treated with the indicated concentrations of LXR agonists or luteolin for an additional 24 h and harvested for luciferase reporter assays as described previously [24]. 2.6. Real-time RT-PCR assay and Western blot Cells were cultured and treated as described above. The sequences of the primers (shown in Table 1) used are available upon request. Q-PCR and Western blotting was performed as described previously [25]. 2.7. Immunofluorescence Cells were incubated with drug or 25 mM glucose for 24 h and then washed three times with cold PBS and fixed with 4% paraformaldehyde for 20 min. After an extensive PBS wash, cells were permeabilized with 0.1% Triton X-100 in PBS for 10 min. Myotubes were incubated overnight at 4 C with the anti-SREBP-1 antibody, washed three times with PBS and then treated for 1 h with FITCconjugated goat-anti-mouse immunoglobulin G. Nuclei were counterstained with Hoechst stain. Slides were prepared with mounting medium (BioRad), and pictures were taken using a Leica DM IRB fluorescence microscope equipped with a CF1 APO PLAN 600 /1.40 oil objective and a CoolPix digital camera. 2.8. Fatty acids assay For testing fatty acid content, 106 cells were extracted by homogenization with 200 ml of chloroform-Triton X-100 (1% Triton X100 in pure chloroform) in a microhomogenizer. The detection was following the instructions of the manufacturer (ab65341, Abcam). 2.9. Blood lipid assay About 50 ml tail vein blood was collected in EDTA-coated tubes. Plasma TG and cholesterol were determined using a Roche Cobas blood chemistry analyzer. 2.10. Statistical analysis Differences between groups were analyzed using the two-sided t-test and ANOVA with P < 0.05 considered statistically significant. 3. Results
2.4. Cell culture Human hepatoma HepG2 cells obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA) were cultured in DMEM medium at 37 C in a humidified atmosphere containing 5%
3.1. Treatment with luteolin decreases the body weight gain and reduces triglyceride levels in db/db mice Mice treated with 20 or 100 mg/kg luteolin per day for 8 weeks
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
3
Table 1 Primers for real-time RT-PCR. Genes
hLXRa hLXRb hSREBP-1c hFas hACC1 hSCD1 hGPAM hb-action mLXRa mLXRb mSREBP-1c mFas mACC1 mSCD1 mGPAM mb-action
Gene ID
10062 7376 6720 134637 200350 6319 57678 646821 22259 22260 20787 14102 104371 20249 14732 11461
Primers (50 -30 ) Forward
Reverse
CAACCCTGGGAGTGAGAGTATCAC AAGGACTTCACCTACAGCAAGGA ATCGACTA CATTCGCTTTCT TGTC CTGCTG AA GCCCAAC CCGAGCAAGGGATAAGTT CCTCTACTTGGAAGACGACATTCGC TGAGGAATGGGGTGAGTG TCATGAAGTGTGACGTGGACAT GGAGTGTCGACTTCGCAAATG CCCCACAAGTTCTCTGGACACT GGAGCCATGGATTGCACATT CTGAGGGACCCTACCGCATA AGAATCTCCTGGTGACAATGCTTAT CCACGCCTGGCTTCCTTGGCT AGCACCAGCAATTCATCACC AGGCCAACCGTGAAAAGATG
CATTCATGGCCCTGGAAGAACT CATTCATGGCCCTGGAAGAACT CAGATCCTTCAGAGATTTGC AGTACCCATTCCCCTCTGT ATGGAATGG CAGTGAGGT GCAGCCGAGCTTTGTAAGAGCGGT CTGGGGAGTGCAGGAGTA CTCAGGAGGAGCAATGATCTTG GATCTGTTCTTCTGACAGCACACA TGACGTGGCGGAGGTACTG GGCCCGGAAGTCACTGT AGCACATCTCGAAGGCTACACA GTAGGGTCCCGGCCACAT TGGTGTAGGCGAGTGGCGGA TTCTGCAGGTACTCAGACTC AGAGCATAGCCCTCGTAGATGG
showed decreased body weight gains (Fig. 1A and B), although no significant difference was noted in the food intake during the therapy (data not shown). Blood glucose levels, as well as plasma TG and cholesterol levels, were measured following luteolin treatment. As shown in Fig. 1C, plasma TG levels were significantly reduced, while plasma cholesterol levels showed a decreasing trend in the group treated with 100 mg/kg luteolin (data not shown). Although no significant differences were observed in the fasting blood glucose level of these groups, the luteolin treatment actually improved the impaired in vivo glucose tolerance (Fig. 1D).
3.2. Luteolin treatment reduced fatty liver disease symptoms in db/ db mice The liver plays a central role in controlling the whole body homeostasis, including lipid and carbohydrate metabolism. As shown in Fig. 2, luteolin treatment significantly attenuated lipid droplet accumulation and promoted hepatic glycogen storage in db/db mice. Ultrasound images also revealed that an 8-week treatment with luteolin markedly improved the fatty infiltration in the livers of these mice (data not shown).
Fig. 1. Luteolin improves lipid and glucose metabolism in db/db mice. Male mice were dosed daily by oral gavage with vehicle or luteolin for 8 weeks (week 6e14). Mouse body weights were monitored during treatment (A, B). Plasma triglycerides (TG) and cholesterol were quantitatively analyzed (C). An intraperitoneal glucose tolerance test (D) was performed 2 h after treatment with luteolin. Values are the means ± SD. *P < 0.05, **P < 0.01 vs. db/db mice (0.5% carboxymethylcellulose).
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
4
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
Fig. 2. Luteolin reduces hepatic steatosis in livers of db/db mice. Mice were treated with either vehicle or luteolin (n ¼ 6 per group) for 8 weeks. Representative images of livers are shown for all groups. Liver sections were stained with Oil Red O reagent or PAS reagent to evaluate lipid accumulation or glycogen storage, respectively.
3.3. Luteolin reduced TG levels by regulating SREBP-1c activation in the liver Further investigations into hepatic lipid metabolism revealed that mice treated with 100 mg/kg luteolin showed markedly
reduced TG levels when compared with the untreated control group (Fig. 3A). LXRs are key transcriptional regulators of lipid metabolism; thus, abnormal activation of LXRs will induce lipid dysregulation in most organs [16]. The LXRs are therefore an important transcriptional switch, regulating the expression of
Fig. 3. Luteolin inhibits liver triglyceride (TG) accumulation and lipid synthesis in db/db mice. Quantitative analysis of hepatic TG content (A) and expression of LXR-SREBP-1c system proteins (B) in the livers of mice treated with luteolin for 8 weeks. Values are the means ± SD. **P < 0.01 vs. db/db mice.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
lipogenic enzymes through the target gene SREBP-1c. The SREBP-1c gene, in turn, plays an important role in the pathogenesis of NAFLD in db/db mice. As shown in Fig. 3B and C, the hepatic SREBP-1c protein and its target gene products involved in lipogenesis were significantly decreased in luteolin-treated mice, indicating that luteolin may regulate hepatic lipid homeostasis by inhibiting the activation of the LXR-SREBP-1c signaling pathway.
3.4. Luteolin inhibited the LXR-SREBP-1c pathway and reduced lipid droplet accumulation in vitro We evaluated the possibility of a direct effect of luteolin on hepatocytes by investigating the response of lipid synthesis to luteolin in both HepG2 cells and mouse primary hepatocytes. As shown in Fig. 4A and B, lipid accumulation was markedly increased in cells incubated for 48 h with T1317, a well-known LXR agonist, indicating a key role for LXR activation in TG synthesis. A consistent and significant suppression of lipid droplet formation was also
5
observed in cells treated with luteolin. We then examined the effect of luteolin on the LXR-SREBP-1c pathway in vitro. As shown in Fig. 4C, the increased expression of SREBP-1c and its target genes in response to T1317 was significantly inhibited in cells treated with luteolin. In HepG2 cells, similar results were also observed in primary hepatocytes (data not shown). SREBP-1c is synthesized as a precursor (125 kDa) attached to the nuclear envelope and endoplasmic reticulum, and the membranebound precursor is cleaved to generate a soluble NH2-terminal fragment (68 kDa) that translocates to the nucleus and binds to the sterol regulatory element of the promoter region of target genes [26]. Immunofluorescence localization studies (Fig. 4E) revealed an inhibition of SREBP-1c cleavage and translocation in response to luteolin treatment. The inhibition of LXR activation was confirmed by luciferase reporter assays. HepG2 cells transiently transfected with pGL3LXRE-Luc plasmid and treated with luteolin showed an inhibition of LXR activation induced by different ligands (including T1317 and
Fig. 4. Luteolin inhibits cellular lipogenesis through LXRs activation in hepatic cells. Cells were treated with vehicle or T1317 (5 mmol/l) in combination with luteolin (10 mmol/l) for 48 h. Lipid deposition was observed by Oil Red O staining (A) and free fatty acid content was quantitatively analyzed by a colorimetric assay (B). Cells were pre-incubated with luteolin for 2 h, followed by co-treatment with drugs for 24 h. The transcripts of lipogenic genes were then analyzed by real-time RT-PCR in HepG2 cells (C). The cells were transiently transfected with LXRE 3-TK-LUC and treated without (control) or with T1317 or high glucose for 24 h. Luteolin decreased LXR activation in HepG2 cells, as determined by the luciferase reporter assay (D). Representative images of immunofluorescence staining for SREBP-1c after HepG2 cells were incubated with the drug for 24 h (E). Values are the means ± SD of three independent experiments.*P < 0.05, **P < 0.01 vs. control.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
6
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
high glucose). The baseline level of LXR activation was also reduced in the luteolin-treated group (Fig. 4D). 4. Discussion Flavones are found widely in the plant kingdom and are reported to have various biological functions. Previous studies suggest that several known soy isoflavones, such as genistein and daidzein, have potential anti-diabetic and anti-obesity effects [27,28]. Luteolin, a commonly occurring flavone, was reported to alleviate obesity and its comorbidity [20,22], but its effects on NAFLD need further research. NAFLD encompasses a wide spectrum of liver diseases, ranging from asymptomatic steatosis to cirrhosis and ultimately to liver injury. Several lines of evidence have shown that obesity and insulin-resistance are two key contributors to the development of this disease [29,30]. In the present study, we found that treatment with luteolin can significantly inhibit the body weight gain in db/db mice without affecting their food intake. The plasma TG level was also decreased and glucose tolerance impairment was overcome in luteolin treated db/db mice (Fig. 1). A previous study suggested that liver triacylglycerol is a more persistent and robust measure of increased lipogenesis than are plasma triacylglycerols [16]. Our determination of liver TG levels showed that hepatic TG accumulation was repressed in luteolintreated mice. This result was supported by both hepatic histology and ultrasonic findings (Fig. 2). The liver plays a major role in the whole body metabolism of glucose, lipids, and energy, and the LXRs are recognized as key regulators that integrate hepatic glucose metabolism and fatty acid synthesis [11]. Chronic hyperglycemia can induce LXR overactivation, which is possibly a predisposing factor for hepatic steatosis in db/db mice. The expression of LXR mRNA was significantly increased in a rat model of NAFLD, and a significant positive correlation was observed between LXR activation and the degree of NAFLD [31]. LXRs control hepatic TG homeostasis mainly through regulation of the transcription of SREBP-1c, the master regulator for TG synthesis. Our evaluation of the protein level of the genes involved in the LXR-SREBP1c signaling pathway revealed that these genes were suppressed in the livers of luteolin-treated mice (Fig. 3). Our in vitro examination of luteolin effects on LXR ligands in treated hepatocytes used T1317, a high-affinity ligand of LXRs, to stimulate the expression of lipogenic genes and increase short-term accumulation of intracellular lipids. As expected, luteolin treatment reversed the lipid accumulation and increased gene expression caused by T1317, indicating that luteolin regulates hepatic lipid homeostasis by inhibiting LXR activation. Luteolin possibly binds to the LBD (ligand binding domain) of the nuclear receptor and competes with the ligands to repress the activation of LXRs (Fig. 4). Increased lipolysis of peripheral fats stored in white adipose tissue and the flow of lipolysis products to the liver is generally recognized as important in NAFLD, since over 60% of the TG accumulated in the livers of NAFLD patients originates from adipose tissue [4]. Luteolin can potentiate insulin action in adipocytes by increasing PPARg transcriptional activity and enhancing GLUT4 expression [21]. Kwon and coworkers recently reported that luteolin upregulated the expression of genes related to lipolysis and the TCA cycle prior to lipid droplet formation in adipocytes, which may result in reduced adiposity and decreased plasma free fatty acid levels [22]. In the present study, a decreased fat cell size was also observed in the luteolin treated groups (data not shown). Therefore, based on previous reports and our studies, we can postulate that luteolin maintains cellular lipid homeostasis in the liver and other peripheral tissues, thereby reducing the signs of fatty liver disease.
The early stages of NAFLD are characterized by the frequent occurrence of hyperglycemia and hyperlipemia in patients. Many tissues, including the liver, can take up excess fatty acids and carbohydrates and convert them to TGs for storage. Several studies have reported that flavonoids, such as genistein, quercetin, and isorhamnetin, can act as competitive inhibitors of glucose uptake in many different cell types [22]. Our evaluation of the effects of luteolin on hepatic fatty acid and glucose uptake showed no inhibition of hepatic lipid uptake nor glucose uptake into hepatocytes (data not shown). Evaluation of glycogen synthesis and glycolysis, the two main ways for glucose consumption in the liver, revealed that the barrier to liver glycogen synthesis in db/db mice was reversed by luteolin treatment (Fig. 2). The data obtained from our animal study revealed that luteolin could alleviate and modulate obesity-associated NAFLD in db/db mice. Luteolin can suppress the hepatic conversion of excess carbohydrates to TG by directly blocking the LXR-SREBP-1c pathway. It is encouraging that inhibiting lipid synthesis to improve metabolic disorders is more attainable than enhancing fatty acid oxidation by drug treatment. Therefore, luteolin may have future usefulness in the clinical setting as a treatment for NAFLD. Acknowledgments This work was supported by grants from the Natural Science Foundation of Jiangsu Province (BK20130889) to Ye Yin; the Natural Science Foundation of Jiangsu Province (BK20131389) to Haiyan Lin; the National Natural Science Foundation of China (81670703). References [1] K. Qureshi, G.A. Abrams, Metabolic liver disease of obesity and role of adipose tissue in the pathogenesis of nonalcoholic fatty liver disease, World J. Gastroenterol. WJG 13 (2007) 3540e3553. [2] N. Chalasani, Z. Younossi, J.E. Lavine, A.M. Diehl, E.M. Brunt, K. Cusi, M. Charlton, A.J. Sanyal, The diagnosis and management of non-alcoholic fatty liver disease: practice guideline by the american association for the study of liver diseases, american college of gastroenterology, and the american gastroenterological association, Hepatology 55 (2012) 2005e2023. [3] C. Postic, J. Girard, The role of the lipogenic pathway in the development of hepatic steatosis, Diabetes Metab. 34 (2008) 643e648. [4] K.L. Donnelly, C.I. Smith, S.J. Schwarzenberg, J. Jessurun, M.D. Boldt, E.J. Parks, Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease, J. Clin. Investig. 115 (2005) 1343e1351. [5] D.B. Savage, C.S. Choi, V.T. Samuel, Z.X. Liu, D. Zhang, A. Wang, X.M. Zhang, G.W. Cline, X.X. Yu, J.G. Geisler, S. Bhanot, B.P. Monia, G.I. Shulman, Reversal of diet-induced hepatic steatosis and hepatic insulin resistance by antisense oligonucleotide inhibitors of acetyl-CoA carboxylases 1 and 2, J. Clin. Investig. 116 (2006) 817e824. [6] G. Jiang, Z. Li, F. Liu, K. Ellsworth, Q. Dallas-Yang, M. Wu, J. Ronan, C. Esau, C. Murphy, D. Szalkowski, R. Bergeron, T. Doebber, B.B. Zhang, Prevention of obesity in mice by antisense oligonucleotide inhibitors of stearoyl-CoA desaturase-1, J. Clin. Investig. 115 (2005) 1030e1038. [7] J.D. Horton, Y. Bashmakov, I. Shimomura, H. Shimano, Regulation of sterol regulatory element binding proteins in livers of fasted and refed mice, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 5987e5992. [8] G. Liang, J. Yang, J.D. Horton, R.E. Hammer, J.L. Goldstein, M.S. Brown, Diminished hepatic response to fasting/refeeding and liver X receptor agonists in mice with selective deficiency of sterol regulatory element-binding protein-1c, J. Biol. Chem. 277 (2002) 9520e9528. [9] J.J. Repa, G. Liang, J. Ou, Y. Bashmakov, J.M. Lobaccaro, I. Shimomura, B. Shan, M.S. Brown, J.L. Goldstein, D.J. Mangelsdorf, Regulation of mouse sterol regulatory element-binding protein-1c gene (SREBP-1c) by oxysterol receptors, LXRalpha and LXRbeta, Genes Dev. 14 (2000) 2819e2830. [10] N. Zelcer, P. Tontonoz, Liver X receptors as integrators of metabolic and inflammatory signaling, J. Clin. Investig. 116 (2006) 607e614. [11] M. Korach-Andre, J.A. Gustafsson, Liver X receptors as regulators of metabolism, Biomol. Concepts 6 (2015) 177e190. [12] S.W. Beaven, A. Matveyenko, K. Wroblewski, L. Chao, D. Wilpitz, T.W. Hsu, J. Lentz, B. Drew, A.L. Hevener, P. Tontonoz, Reciprocal regulation of hepatic and adipose lipogenesis by liver X receptors in obesity and insulin resistance, Cell Metab. 18 (2013) 106e117. [13] S.M. Ulven, K.T. Dalen, J.A. Gustafsson, H.I. Nebb, LXR is crucial in lipid metabolism, Prostagl. Leukot. Essent. Fat. Acids 73 (2005) 59e63. [14] J.M. Lehmann, S.A. Kliewer, L.B. Moore, T.A. Smith-Oliver, B.B. Oliver, J.L. Su,
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101
Y. Yin et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
S.S. Sundseth, D.A. Winegar, D.E. Blanchard, T.A. Spencer, T.M. Willson, Activation of the nuclear receptor LXR by oxysterols defines a new hormone response pathway, J. Biol. Chem. 272 (1997) 3137e3140. N. Mitro, P.A. Mak, L. Vargas, C. Godio, E. Hampton, V. Molteni, A. Kreusch, E. Saez, The nuclear receptor LXR is a glucose sensor, Nature 445 (2007) 219e223. J.W. Chisholm, J. Hong, S.A. Mills, R.M. Lawn, The LXR ligand T0901317 induces severe lipogenesis in the db/db diabetic mouse, J. lipid Res. 44 (2003) 2039e2048. S. Jang, K.W. Kelley, R.W. Johnson, Luteolin reduces IL-6 production in microglia by inhibiting JNK phosphorylation and activation of AP-1, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 7534e7539. G.K. Harris, Y. Qian, S.S. Leonard, D.C. Sbarra, X. Shi, Luteolin and chrysin differentially inhibit cyclooxygenase-2 expression and scavenge reactive oxygen species but similarly inhibit prostaglandin-E2 formation in RAW 264.7 cells, J. Nutr. 136 (2006) 1517e1521. M.C. Yu, J.H. Chen, C.Y. Lai, C.Y. Han, W.C. Ko, Luteolin, a non-selective competitive inhibitor of phosphodiesterases 1-5, displaced [3H]-rolipram from high-affinity rolipram binding sites and reversed xylazine/ketamineinduced anesthesia, Eur. J. Pharmacol. 627 (2010) 269e275. N. Xu, L. Zhang, J. Dong, X. Zhang, Y.G. Chen, B. Bao, J. Liu, Low-dose diet supplement of a natural flavonoid, luteolin, ameliorates diet-induced obesity and insulin resistance in mice, Mol. Nutr. Food Res. 58 (2014) 1258e1268. L. Ding, D. Jin, X. Chen, Luteolin enhances insulin sensitivity via activation of PPARgamma transcriptional activity in adipocytes, J. Nutr. Biochem. 21 (2010) 941e947. E.Y. Kwon, U.J. Jung, T. Park, J.W. Yun, M.S. Choi, Luteolin attenuates hepatic steatosis and insulin resistance through the interplay between the liver and adipose tissue in mice with diet-induced obesity, Diabetes 64 (2015) 1658e1669. H.O. Lyon, E.K. Schulte, P. Prento, M.R. Barer, M.C. Bene, Standardized staining
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
7
methods: feulgen-rossenbeck reaction for desoxyribonucleic acid and periodic acid-schiff (PAS) procedure, Biotech. Histochem. Off. Publ. Biol. Stain Comm. 77 (2002) 121e125. X. Han, Y. Sun, S. Scott, D. Bleich, Tissue inhibitor of metalloproteinase-1 prevents cytokine-mediated dysfunction and cytotoxicity in pancreatic islets and beta-cells, Diabetes 50 (2001) 1047e1055. Z.X. Meng, J.X. Sun, J.J. Ling, J.H. Lv, D.Y. Zhu, Q. Chen, Y.J. Sun, X. Han, Prostaglandin E2 regulates Foxo activity via the Akt pathway: implications for pancreatic islet beta cell dysfunction, Diabetologia 49 (2006) 2959e2968. X. Wang, R. Sato, M.S. Brown, X. Hua, J.L. Goldstein, SREBP-1, a membranebound transcription factor released by sterol-regulated proteolysis, Cell 77 (1994) 53e62. M.S. Choi, U.J. Jung, J. Yeo, M.J. Kim, M.K. Lee, Genistein and daidzein prevent diabetes onset by elevating insulin level and altering hepatic gluconeogenic and lipogenic enzyme activities in non-obese diabetic (NOD) mice, Diabetes Metab. Res. Rev. 24 (2008) 74e81. N. Palanisamy, P. Viswanathan, C.V. Anuradha, Effect of genistein, a soy isoflavone, on whole body insulin sensitivity and renal damage induced by a high-fructose diet, Ren. Fail. 30 (2008) 645e654. G. Pagano, G. Pacini, G. Musso, R. Gambino, F. Mecca, N. Depetris, M. Cassader, E. David, P. Cavallo-Perin, M. Rizzetto, Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome: further evidence for an etiologic association, Hepatology 35 (2002) 367e372. G. Marchesini, M. Brizi, G. Bianchi, S. Tomassetti, E. Bugianesi, M. Lenzi, A.J. McCullough, S. Natale, G. Forlani, N. Melchionda, Nonalcoholic fatty liver disease: a feature of the metabolic syndrome, Diabetes 50 (2001) 1844e1850. N. Higuchi, M. Kato, Y. Shundo, H. Tajiri, M. Tanaka, N. Yamashita, M. Kohjima, K. Kotoh, M. Nakamuta, R. Takayanagi, M. Enjoji, Liver X receptor in cooperation with SREBP-1c is a major lipid synthesis regulator in nonalcoholic fatty liver disease, Hepatol. Res. Off. J. Jpn. Soc. Hepatol. 38 (2008) 1122e1129.
Please cite this article in press as: Y. Yin, et al., Luteolin improves non-alcoholic fatty liver disease in db/db mice by inhibition of liver X receptor activation to down-regulate expression of sterol regulatory element binding protein 1c, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.11.101