Macromolecular Assembly of the Transition State Regulator AbrB in Its Unbound and Complexed States Probed by Microelectrospray Ionization Mass Spectrometry

Analytical Biochemistry 306, 222–227 (2002) doi:10.1006/abio.2002.5704

Macromolecular Assembly of the Transition State Regulator AbrB in Its Unbound and Complexed States Probed by Microelectrospray Ionization Mass Spectrometry Linda M. Benson,* Jeffrey L. Vaughn,† Mark A. Strauch,‡ Benjamin G. Bobay,§ Richele Thompson,§ Stephen Naylor,* ,1,2 and John Cavanagh§ ,1 *Biomedical Mass Spectrometry & Functional Proteomics Facility, Mayo Clinic/Foundation, Rochester, Minnesota 55905; †Department of Chemistry, University of Indiana, Bloomington, Indiana 47405; ‡OCBS Department, Dental School, University of Maryland at Baltimore, 666 W. Baltimore Street, Baltimore, Maryland 21201; and §Department of Molecular & Structural Biochemistry, North Carolina State University, Raleigh, North Carolina 27695

Received November 21, 2001; published online June 18, 2002

The Bacillus subtilis global transition-state regulator AbrB specifically recognizes over 60 different DNA regulatory regions of genes expressed during cellular response to suboptimal environments. Most interestingly the DNA regions recognized by AbrB share no obvious consensus base sequence. To more clearly understand the functional aspects of AbrB activity, microelectrospray ionization mass spectrometry has been employed to resolve the macromolecular assembly of unbound and DNA-bound AbrB. Analysis of the N-terminal DNA binding domain of AbrB (AbrBN53, residues 1–53) demonstrates that AbrBN53 is a stable dimer, showing no apparent exchange with a monomeric form as a function of pH, ionic strength, solvent, or protein concentration. AbrBN53 demonstrates a capacity for DNA binding, underscoring the role of the N-terminal domain in both DNA recognition and dimerization. Full-length AbrB is shown to exist as a homotetramer. An investigation of the binding of AbrBN53 and AbrB to the natural DNA target element sinIR shows that AbrBN53 binds as a dimer and AbrB binds as a tetramer. This study represents the first detailed characterization of the stoichiometry of a transition-state regulator binding to one of its target promoters. © 2002 Elsevier Science (USA)

1 To whom correspondence should be addressed. E-mail: [email protected] or [email protected]. 2 Current address: Beyond Genomics, 40 Bear Hill Road, Waltham, MA 02451.

222

Key Words: AbrB; transition-state regulator; macromolecular assembly; mass spectrometry.

Bacillus subtilis encounters many different environments during its life span, ranging from those amenable to exponential growth to those that compromise survival. If environmental conditions become too hostile, the cell protects itself by endospore formation. Therefore B. subtilis must constantly assess and respond to the environment, deciding whether sporulation or reversion to vegetative growth is warranted. This period of assessment is referred to as the transition state. During this time alternative metabolic processes required for growth and survival are activated (1). Regulatory proteins necessary for redirecting cellular metabolism during the transition-state period are referred to as transition-state regulators and are emerging as a novel and important family of DNAbinding proteins. Although much effort has resulted in broad genetic characterization of transition-state regulators in B. subtilis, little is known about their molecular mechanisms of action (2, 3). Responsive gene expression during the B. subtilis transition state is conferred in large part by the transition-state regulator protein AbrB (2, 4 – 6). AbrB controls the expression of over 60 different genes, including those with protein products responsible for dipeptide transport, arginine synthesis, competence, antibiotic production, and cellular differentiation (2, 3). The functional form of AbrB is known to be a mul0003-2697/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

PROTEIN ASSEMBLY PROBED BY MICROELECTROSPRAY IONIZATION MS

timer consisting of identical 94-residue monomer subunits (7). Previous studies have shown that each monomer can be subdivided into a carboxy-terminal (Cterminus) domain that is known to be involved in homomeric multimerization (residues 54 –94) and an amino-terminal (N-terminus) domain, referred to as AbrBN53, that binds DNA (residues 1–53) (8, 9). However, analysis of AbrB macromolecular assembly yields conflicting data on the exact stoichiometry of the native solution state (7, 10, 11). With this in mind it is not surprising that the stoichiometry of AbrB–DNA binding remains elusive. It is noteworthy that electrospray ionization mass spectrometry is finding increased usage in the analyses of noncovalent multimeric complexes (12–19). It is a technique that makes use of multiply charged ions via evaporation of a supersonic jet of nebulized solvent droplets containing analytes. Furthermore, since the process produces gas-phase ions ⬍1 eV above their ground state, on the picosecond time scale (20), most noncovalent complexes survive and are subsequently detected in the mass spectrometer (12). We have utilized such an approach, in particular microelectrospray ionization mass spectrometry (␮ESI-MS), 3 to determine the metal binding stoichiometry of the DNAbinding domains of the vitamin D receptor (21), as well as to investigate the effects of ligands (22) and metal ions (23) on transcription complex formation. In this work we present a detailed study of the multimerization properties of AbrBN53 and AbrB using electrospray ionization mass spectrometry. In addition we determine DNA binding stoichiometries for both AbrBN53 and AbrB with sinIR, one of its target DNA sequences. METHODS

AbrB protein expression and purification. The AbrB vector constructs used to overexpress AbrB and AbrBN53 have been described (9, 24). DNA was isolated using a Wizard prep kit from Promega. The plasmids were transformed into competent Escherichia coli JM109 purchased from Stratagene. One liter LB broth containing 50 ␮g/ml carbenicillin was inoculated and grown at 37°C, 190 rpm to an optical density A 600 of about 0.700. Isopropyl-␤-D-thiogalactopyranoside was added to 1 mM concentration and the incubation continued for about 2–3 h. The cells were pelleted by centrifugation and resuspended with 10 mM Tris–HCl (pH 8.3 at 4°C or pH 7.9 at room temperature), 1 mM EDTA, 0.1 mM MgCl 2, 10 mM KCl, 10 mM ␤-mercaptoethanol (␤ME) and 0.25 mM 4-(2-aminoethyl) benze3 Abbreviations used: ␮ESI-MS, microelectrospray ionization mass spectrometry; ␤ME, ␤-mercaptoethanol; DTT, dithiothreitol; SELC, size-exclusion liquid chromatography; TFE, trifluoroethanol.

223

nesulfonyl fluoride hydrochloride. All subsequent steps were preformed at 4°C. The cells were sonicated for five cycles of 45-s bursts/2-min rests. The resulting suspension was again centrifuged at 17,000 rpm for 25 min. The supernatant was removed and saved as the crude extract. The crude extract was dialyzed into 10 mM Tris–HCl (pH 8.3 at 4°C or pH 7.9 at room temperature) and 10 mM KCl. Any residual DNA and RNA was removed by incubating with S7 nuclease for 15–30 min at room temperature and the reaction quenched by dialyzing into EDTA. Solid ammonium sulfate was added slowly to the supernatant to a final concentration of 55%. This was allowed to sit for 30 min and was recentrifuged at 17,000 rpm and the pellet checked for protein and subsequently discarded. The supernatant was dialyzed in to 10 mM Tris–HCl (pH 8.3 at 4°C or pH 7.9 at room temperature), 1 mM EDTA, 0.1 mM MgCl 2, 10 mM KCl, 10 mM ␤ME. The dialyzed supernatant containing AbrB was purified via column chromatography using DEAE–Trisacryl; AbrB did not bind and eluted off during the wash. The fractions were pooled and dialyzed into the aforementioned buffer. The protein was then loaded on to a heparin-agarose column and eluted using a 0 –200 mM KCl gradient. Fractions containing AbrB were pooled and dialyzed in to 20 mM KHPO 4 at pH 5.8, 15 mM KCl, 0.1 mM MgCl 2, 2 mM DTT, 0.02% NaN 3. The AbrB was then further purified (Sephacryl S-100 26/60). The fractions containing pure protein were pooled and concentrated and again dialyzed into 20 mM KHPO 4 at pH 5.8, 15 mM KCl, 0.1 mM MgCl 2, 0.02% NaN 3. Throughout the protocol the presence of AbrB was monitored by 12% tricine gel electrophoresis. AbrBN53 protein expression and purification. The plasmids for AbrBN53 were transformed into competent E. coli BL(21)DE3 and encoded for 50 ␮g/ml kanamycin resistance. AbrBN53 expression and purification steps were identical to those of the expression and purification of AbrB. Size-exclusion liquid chromatography. Size-exclusion liquid chromatography (SELC) was performed on AbrBN53 using cytochrome c (Sigma) and aprotinin (Sigma) as size standards. All protein samples were at ⬃1 mM. Analysis was performed at room temperature with a 30-cm Superdex 30 (Pharmacia) column on a Pharmacia P-500 system with a flow rate of 1 ml/min and monitored at 280 nm. SELC protein samples were exchanged into potassium phosphate buffers using preequilibrated G-25 resin (Pharmacia) under the following conditions: (i) for pH 5.8, 15 mM, 125 mM, 400 mM, and 1 M KCl; (ii) for pH 4.6, 125 mM KCl; (iii) for pH 5.8, 125 mM KCl and 20% ethanol. HPLC. HPLC was performed with a Waters 600 and 900 using a Waters PAK 125 column on 1 mM protein samples in buffer A, buffer A ⫹ 20% trifluoro-

224

BENSON ET AL.

ethanol, and buffer B (10 mM Tris, pH 8.3, 1 mM EDTA, 10 mM MgCl 2, 10 mM KCl, 10 mM ␤ME). Samples were monitored at 210, 215, 250, 260, and 280 nm. Protein standards used were aprotinin, cytochrome c, carbonic anhydrase, and bovine serum albumin (Sigma). Curve fitting of standards data and molecular weight calculations were completed with Kaleidograph 3.0 (Abelbeck Software). Mass spectrometry. All mass spectrometry analyses were performed on a Finnigan-MAT 900 (Bremen, Germany) instrument. A modified Finnigan electrospray source was used as previously described (25) to allow microflow delivery rates of protein complexes in aqueous solutions. ␮ESI measurements were acquired in both positive and negative modes. Sulfur hexafluoride (SF 6) gas was used in all experiments to decrease corona discharge and enhance the signal-to-noise ratio. The ionization source and heated capillary were set at 120°C. The electrospray voltage was set at 3.5–3.8 kV. The instrument was scanned from mass to charge (m/z) 1000 to 5000 or 600 to 4000 at a scan rate of 20 s/decade, using an instrument resolution of 1200. The position-and-time resolved ion counter array detector was used for ion detection. Multiple scans were collected and summed, and the multiply charged spectra were transformed into a calculated molecular weight using Finnigan software supplied with the instrument. Typically under such instrument conditions employing the software algorithm, a mass accuracy of ⫾0.001% is readily achievable. Stock protein solutions in 20 mM KHPO 4, pH 5.8, 15 mM KCl, 0.1 mM MgCl 2, 0.02% NaN 3 were exchanged by a P-6 gel-filtration spin column (Bio-Rad, Hercules, CA) into a mass-spectrometer-compatible buffer of 10 mM NH 4HCO 3, pH 8.0. Ammonium bicarbonate-buffered AbrBN53 and AbrB proteins were diluted to 16 and 30 ␮M concentrations, respectively, and infused into the ␮ESI source at 300 nl/min. The following oligonucleotide and its complementary strand were synthesized in the Molecular Biology Core Facility at the Mayo Clinic: sinIR 5⬘ CTAGATTTAATGGCAAATGACTTCCAGAGA 3⬘. The oligonucleotide was annealed in 100 mM NH 4HCO 3 by heating to 100°C for 10 min and slowly cooling to room temperature. All protein–DNA complexes were combined at a 2:1 protein:DNA ratio (40 ␮M AbrBN53:16 ␮M sinIR or 30 ␮M AbrB:15 ␮M sinIR) and incubated at 4°C for 24 h. RESULTS

Figure 1 shows typical results of SELC of AbrBN53, aprotinin, and horse cytochrome c. AbrBN53 eluted at time points identical to those of cytochrome c, indicating an apparent solution size of approximately 12 kDa. In an attempt to force the apparent equilibrium toward

FIG. 1. Size-exclusion chromatography of AbrBN53, horse heart cytochrome c, and aprotinin. Signal intensity and elution time points are in arbitrary units; higher molecular weight species elute at lower time points. The earliest elution peak in the AbrBN53 sample was in the void volume and did not contain AbrBN53 as determined with SDS–PAGE analysis. The void volume peak corresponds to low concentrations of high-molecular-weight impurities indistinguishable by SDS–PAGE analysis.

a larger monomeric population, AbrBN53 in several variations of buffer differing in pH, salt concentration, ethanol, or trifluoroethanol (TFE) content was examined with HPLC or SELC. Under all chemical conditions tested, AbrBN53 exclusively eluted at time points indicative of a dimeric solution size. Exchanging AbrBN53 into sample buffer with 20% TFE resulted in protein precipitation and a 25% decrease in dimer signal intensity without the appearance of a monomer elution peak (data not shown). AbrBN53 was placed in a buffer of 10 mM ammonium bicarbonate buffer at pH 8.0 to allow for the preservation of multimeric protein complexes for ␮ESIMS study. Analysis with positive-ion ␮ESI-MS showed that the AbrBN53 ion species included both monomers and dimers (Fig. 2). Monomeric AbrBN53 showed a m/z ion series of ⫹8 to ⫹3 (m/z values of 872 to 2034) which, upon transformation, affords a relative molecular mass (M r) of 6098 Da (⫾0.001%, expected 6100 Da). Dimeric AbrBN53 showed a m/z ion series of ⫹8 to ⫹6 (m/z values of 1525.5 to 2034) corresponding to a mass of 12,197 Da. (⫾0.001%, expected 12,198 Da). Some salt was necessary for dimer formation in solution; however, once formed the dimers appeared to be very stable. However, it should be noted that the electrospray ionization process does induce some dissociation of complex in the source region, and this has been discussed in detail elsewhere (21).

PROTEIN ASSEMBLY PROBED BY MICROELECTROSPRAY IONIZATION MS

FIG. 2. ␮ESI mass spectrum of AbrBN53. Positive ion spectrum of 16 ␮M AbrBN53 in 10 mM ammonium bicarbonate buffer, pH 8.0. Peaks shown with M or D correspond to monomeric or dimeric species, respectively. Charge states are as indicated. Monomeric species most likely arise as artifacts of the ionization process or the solution state to gas phase transition that result in the elimination of a stable dimer interface in the N-terminal DNA-binding domain— see text for discussion and molecular weight analysis.

The aggregate state of full-length AbrB was also investigated in a similar manner. Masses determined with ␮ESI-MS of full-length AbrB revealed the presence of monomeric, dimeric, and tetrameric species with the ion series m/z values between 1000 and 3500 and the m/z states of ⫹10 to ⫹4 for the monomer (“M”), ⫹11 to ⫹7 for the dimer (“D”), and ⫹15 to ⫹12 for the tetramer (“T”), corresponding to molecular masses of 10,492, 20,993, and 41,985 Da, respectively, compared to the expected molecular masses of 10,494, 20,988, and 41,972 Da, respectively (Fig. 3). Complexes appeared stable over time under the optimal ␮ESI conditions stated and also under conditions with increased source energy and higher heated capillary temperatures (up to 200°C). ␮ESI-MS was also used to examine complexes between the 30-bp promoter element sinIR and both AbrB and AbrBN53. The MS experiments were performed in both positive and negative ion modes. In the positive ion mode, signals corresponding to the protein, double-stranded DNA, and protein–DNA complexes were seen. The protein signal in positive ion mode can easily be assigned a molecular weight, as the charge states are well defined. However, the DNA and protein–DNA complex signals are broad due to the affinity of the DNA for cations present in the system. In the negative ion mode the protein peaks were not always detected, but both single-stranded and doublestranded DNA ion series were seen. When in negative ion mode, the protein–DNA complex signals tended to

225

FIG. 3. ␮ESI mass spectrum of AbrB. Positive ion spectrum of 30 ␮M AbrB in 10 mM ammonium bicarbonate buffer, pH 8.0. Peaks shown with M, D, or T correspond to monomeric, dimeric, or tetrameric species, respectively. Charge states are as indicated. Monomeric and dimeric species likely arise as artifacts of the ionization process—see text for discussion and molecular weight analysis.

be better defined and are thus presented here. The mass assignment on these peaks is an average number obtained using the reconstruction software of the instrument and is used as an estimate of molecular weight. Mass-to-charge values for AbrBN53 and sinIR mixed in a ratio of 2:1 correspond to unbound DNA and a protein–DNA molecular complex of 30.6 kDa (Fig. 4). This result indicates that a single AbrBN53 dimer is bound to the sinIR DNA sequence (theoretical mass 30,607 Da). Peaks shown with an asterisk correspond

FIG. 4. ␮ESI mass spectrum of AbrBN53 incubated with the natural target DNA promoter sequence from the sinIR gene. Negative ion spectrum of 40 ␮M AbrBN53 incubated with 16 ␮M sinIR DNA promoter sequence. Peaks correspond to fully complexed dimeric AbrBN53 ⫹ DNA (C N53). Peaks marked with an asterisk correspond to unbound double-stranded DNA. Charge states are as indicated— see text for discussion and molecular weight analysis.

226

BENSON ET AL.

FIG. 5. ␮ESI mass spectrum of AbrB incubated with the natural target DNA promoter sequence from the sinIR gene. Negative ion spectrum of 32 ␮M AbrB incubated with 16 ␮M sinIR DNA promoter sequence. Peaks correspond to fully complexed tetrameric AbrB ⫹ DNA (C WT). Peaks marked with an asterisk correspond to unbound double-stranded DNA. Charge states are as indicated—see text for discussion and molecular weight analysis.

to unbound DNA. The negative ion ␮ESI-MS spectrum (Fig. 5) of AbrB incubated with the sinIR promoter sequence shows a m/z ion series corresponding to tetrameric AbrB bound to the DNA fragment (60.5 kDa; theoretical mass 60,381 Da). Peaks shown with an asterisk correspond to unbound DNA. DISCUSSION

Solution-state analysis with SELC and ␮ESI-MS shows that the N-terminus of AbrB (AbrBN53) is dimeric. Size-exclusion chromatography experiments on AbrBN53 gave no indication that dimer formation at the N-terminus is an equilibrium process dependent upon pH, solvent, ionic strength, or concentration. Moreover, size determination of AbrBN53 in 20% TFE resulted in precipitation (lower concentrations of TFE had no apparent effect) and loss of dimer signal without a concomitant gain in monomer signal, suggesting an inherent structural instability of the monomeric form of the N-terminal domain. The observed stability of the N-terminal dimerization interface may be an essential feature for functioning as a DNA-binding domain, as the intact dimer is the smallest structural assembly found to bind natural target DNA (see below). Monomeric AbrBN53 identified with mass spectrometry techniques is most likely the result of known artifacts in the liquid to gas phase transition or ionization of the protein sample during the ␮ESI-MS process (11, 13). Similarly, AbrB monomers and dimers detected with ␮ESI-MS are likely an experimental artifact. The proposed N- and C-terminal dimer interfaces fail to remain completely intact for all molecules dur-

ing the course of the ionization process or liquid to gas phase transition, resulting in the degeneration of tetramers into dimers and then into monomers. These characterizations support a structural model in which a dimerization region is present in both the N-terminal and the C-terminal domains. To elucidate the nature of AbrB binding to a cognate DNA sequence, ␮ESI-MS experiments on AbrB and AbrBN53 complexed to the sinIR native DNA target site were completed. We have found that AbrBN53 binds solely as a dimer to the sinIR promoter region, indicating that elements for DNA recognition are present in the N-terminal dimer domain. The lack of monomeric AbrBN53 bound to target DNA supports the argument that the dimeric topology of the DNA binding domain is a minimum structural requirement for DNA recognition. ␮ESI-MS experiments on the AbrB–sinIR complex indicate that binding occurs to this promoter region as a tetramer. No evidence of monomeric or dimeric AbrB binding to this particular target DNA was observed. Certainly our studies on full-length AbrB did not reveal any multimers of higher order than a tetramer. Based on the apparent dissociation of some AbrBN53 dimers into monomers during the electrospray process we suspect that the full-length AbrB dimers and monomers are artifactual and that the natural state of AbrB is a homotetramer. However, we cannot completely rule out that the AbrB dimers we detect may have some functional value. Perhaps, as a dimer, AbrB targets a different promoter. Gene regulation occurring as a function of macromolecular assembly could be advantageous to the cell. The additional degree of conformational freedom provided to a regulatory protein through multimerization can effectively increase the number of target sites. This may result in a more efficient response to environmental changes because of many genes being differentially and specifically regulated by one central protein. We are currently exploring this possibility and these results will be presented elsewhere. Strauch and co-workers hypothesized that AbrB binding activity depended upon recognition of a DNA sequence approximating a general spatial configuration (18, 19) of an idealized, in vitro-selected DNA recognition sequence (20). In this work we have shown conclusively that AbrB’s DNA recognition for the sinIR natural promoter relies on a generalized DNA conformation recognition process initiated or stabilized by a tetrameric state of protein macromolecular assembly. In addition we offer strong supporting evidence that the N-terminal domain of AbrB contains a dimer interface and that this dimeric domain constitutes the AbrB DNA recognition motif.

PROTEIN ASSEMBLY PROBED BY MICROELECTROSPRAY IONIZATION MS

ACKNOWLEDGMENTS The authors thank Dr. Rick Cunningham (SUNY Albany) for assistance with chromatographic methods. This work was supported by NIH grants to J.C. (GM55769) and M.A.S. (GM467000).

15.

REFERENCES

16.

1. Sonenshein, A. L., Losick, R., and Hoch, J. A., Eds. (1993) Bacillus subtilis and Other Gram-Positive Bacteria. Am. Soc. Microbiol., Washington, DC. 2. Strauch, M. A. (1993) Regulation of Bacillus subtilis gene expression during the transition from exponential growth to stationary phase. Prog. Nucleic Acids Res. Mol. Biol. 46, 121–153. 3. Strauch, M. A., and Hoch, J. A. (1993) Transition-state regulators: Sentinels of Bacillus subtilis post-exponential gene expression. Mol. Microbiol. 7, 337–342. 4. Robertson, J. B., Gocht, M., Maraheil, M. A., and Zuber, P. (1989) AbrB, a regulator of gene expression in Bacillus, interacts with the transcription initiation regions of a sporulation gene and an antibiotic synthesis gene. Proc. Natl. Acad. Sci. USA 86, 8457– 8461. 5. Furbass, R., and Marahiel, M. A. (1991) Mutant analysis interaction of the Bacillus subtilis transcription regulator AbrB with the antibiotic biosynthesis gene tycA. FEBS Lett. 287, 153–160. 6. Fisher, S. H., Strauch, M. A., Atkinson, M. R., and Wray, L. V., Jr. (1994) Modulation of Bacillus subtilis catabolite repression by transition state regulatory protein AbrB. J. Bacteriol. 176, 1903–1912. 7. Strauch, M. A., Perego, M., Burbulys, D., and Hoch, J. (1989) The transition state transcription regulator AbrB of Bacillus subtilis is autoregulated during vegetative growth. Mol. Microbiol. 3, 1203–1209. 8. Xu, K., Clark, D., and Strauch, M. A. (1996) Analysis of abrB mutations, mutant proteins, and why abrb does not utilize a perfect consensus in the ⫺35 regions of its ␴ A promoter. J. Biol. Chem. 271, 2621–2626. 9. Xu, K., and Strauch, M. A. (2001) DNA-binding activity of aminoterminal domains of the Bacillus subtilis AbrB protein. J. Bacteriol. 183, 4094 – 4098. 10. Klein, W., Winkelmann, D., Hahn, M., Weber, T., and Marahiel, M. A. (2000) Molecular characterization of the transition state regulator AbrB from Bacillus stearothermophilus. Biochim. Biophys. Acta 1493, 82–90. 11. Vaughn, J. L., Feher, V., Naylor, S., Strauch, M. A., and Cavanagh, J. (2000) Novel DNA binding domain and genetic regulation model of Bacillus subtilis transition state regulator AbrB. Nat. Struct. Biol. 7, 1139 –1146. 12. Loo, J. A. (1997) Studying non-covalent protein complexes by electrospray ionization mass spectrometry. Mass Spectrom. Rev. 16, 1–23. 13. Veenstra, T. D. (1999) Electrospray ionization mass spectrometry in the study of biomolecular non-covalent interactions. Biophys. Chem. 79, 63–79. 14. van Berkel, W. J., van den Heuvel, R. H., Versluis, C., and Heck, A. J. (2000) Detection of intact megadalton protein assemblies of

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

227

vanillylalcohol oxidase by mass spectrometry. Protein Sci. 9, 345–349. Zhang, Z., Krutchinsky, A., Endicott, S., Realini, C., Rechsteiner, M., and Standing, K. G. (1999) Proteasome activator 11S REG or PA28: Recombinant REG alpha/REG beta hetero-oligomers are heptamers. Biochemistry 38, 5651–5658. Rostom, A. A., Fucini, P., Benjamin, D. R., Juenemann, R., Nierhaus, K. H., Hartl, F. U., Dobson, C. M., and Robinson, C. V. (2000) Detection and selective dissociation of intact ribosome in a mass spectrometer. Proc. Natl. Acad. Sci. USA 97, 5185–5190. Hernandez, H., and Robinson, C. V. (2001) Dynamic protein complexes: Insights from mass spectrometry. J. Biol. Chem. 276, 46685– 46688. Tito, M. A., Miller, J., Walker, N., Griffin, K. F., Williamson, E. D., Despeyroux-Hill, D., Titball, R. W., and Robinson, C. V. (2001) Probing molecular interactions in intact antibody:antigen complexes, an electrospray time-of-flight mass spectrometry approach. Biophys. J. 81, 3503–3509. Elviri, L., Zagnoni, I., Careri, M., Cavazzini, D., and Rossi, G. L. (2001) Non-covalent binding of endogenous ligands to recombinant cellular retinal-binding proteins studied by mass spectrometric techniques. Rapid Commun. Mass Spectrom. 15, 2186 – 2192. Kebarle, P., and Tang, L. (1993) From ions in solution to ions in the gas phase: The mechanism of electrospray mass spectrometry. Anal. Chem. 65, 972A–986A. Veenstra, T. D., Benson, L. M., Craig, T. A., Tomlinson, A. J., Kumar, R., and Naylor, S. (1998) Metal mediated sterol receptor–DNA complex association and dissociation determined by electrospray ionization mass spectrometry. Nat. Biotech. 16, 262–266. Craig, T. A., Benson, L. M., Tomlinson, A. J., Veenstra, T. D., Naylor, S., and Kumar, R. (1999) Analysis of transcription complexes and effects of ligands by microelectrospray ionization mass spectrometry. Nat. Biotech. 17, 1214 –1218. Craig, T. A., Benson, L. M., Naylor, S., and Kumar, R. (2001) Modulation effects of zinc on the formation of vitamin D receptor and retinoid X receptor alpha-DNA transcription complexes: Analysis by microelectrospray mass spectrometry. Rapid Commun. Mass Spectrom. 15, 1011–1016. Strauch, M. A., Spiegelman, G. B., Perego, M., Johnson, W. C., Burbulys, D., and Hoch, J. A. (1989) The transition state transcription regulator abrB of Bacillus subtilis is a DNA binding protein. EMBO J. 8, 1615–1621. Strauch, M. A. (1995) In vitro binding affinity of the Bacillus subtilis AbrB protein to six different DNA target regions. J. Bacteriol. 177, 6727– 6731. Xu, K., and Strauch, M. A. (1996) In vitro selection of optimal AbrB-binding sites: Comparison to known in vivo sites indicates flexibility in AbrB binding and recognition of three-dimensional DNA structures. Mol. Microbiol. 19, 145–158 Johnson, K. L., Veenstra, T. D., Tomlinson, A. J., Kumar, R., and Naylor, S. (1997) Determination of non-covalent metal ion/protein interactions using a microflow electrospray ionization mass spectrometry interface. Rapid Commun. Mass Spectrom. 11, 939 –942.