- Email: [email protected]
Macrophage migration inhibitory factor interacts with HBx and inhibits its apoptotic activity
BBRC Biochemical and Biophysical Research Communications 342 (2006) 671–679 www.elsevier.com/locate/ybbrc
Macrophage migration inhibitory factor interacts with HBx and inhibits its apoptotic activity Shimeng Zhang, Ruxian Lin, Zhe Zhou, Siyuan Wen, Li Lin, Suhong Chen, Yajun Shan, Yuwen Cong, Shengqi Wang * Beijing Institute of Radiation Medicine, No.27 Taiping Road, Beijing 100850, PR China Received 24 January 2006 Available online 13 February 2006
Abstract HBx, a transcriptional transactivating protein of hepatitis B virus (HBV), is required for viral infection and has been implicated in virus-mediated liver oncogenesis. However, the precise molecular mechanism remains largely elusive. We used the yeast two-hybrid system to identify that HBx interacts with MIF directly. Macrophage migration inhibitory factor (MIF) is implicated in the regulation of inflammation, cell growth, and even tumor formation. The interaction between HBx and MIF was verified with co-immunoprecipitation, GST pull-down, and cellular colocalization. The expression of MIF was up-regulated in HBV particle producing cell 2.2.15 compared with HepG2 cell. Both HBx and MIF cause HepG2 cell G0/G1 phase arrest, proliferation inhibition, and apoptosis. However, MIF can counteract the apoptotic effect of HBx. These results may provide evidence to explain the link between HBV infection and hepatocellular carcinoma. 2006 Elsevier Inc. All rights reserved. Keywords: MIF; HBx; Apoptosis
Many studies link chronic infection of hepatitis B virus (HBV) in human to the development of hepatocellular carcinoma (HCC). HBx, a 17 kDa protein encoded by the virus, is thought to play an important role in the development of HBV-associated HCC. But transgenic mice studies provide conflicting results. Some HBx transgenic mice develop liver cancer [14,29], while others do not [18]. However, HBx can serve as a cofactor for HCC in those transgenic mice that do not develop spontaneous tumor. The precise mechanism of HBx involvement remains elusive, but several studies have suggested a possible role for HBx protein in the process of liver carcinogenesis. HBx is a promiscuous transactivator and it has been shown to activate a wide variety of viral and cellular targets, including host genes for acute inflammatory response, cell proliferation, and housekeeping.
*
Corresponding author. Fax: +86 10 66932211. E-mail address: [email protected] (S. Wang).
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.01.180
Identification of cellular HBx-interactive proteins would provide insights into the mechanism of HBV cellular effects. It is reported that HBx can bind basal transcription factors such as RNA polymerase subunit RPB5 [7] and act as a transcription cofactor. HBx can also interact with other factors, including SMAD4 [19] and NF-AT in TNFa signaling [17], P53 [10,20], and HIV Tat-binding protein (Tbp1) [3]. In addition to the described factors related to transcription, PMSA1 and PMSA7 [31], subunits of proteosome, are also found to interact with HBx. Our previous work reported that HBx can form a complex with mitochondrial HSP60 and HSP70 [30]. In this study, we attempt to discover new HBx interacting proteins using yeast two-hybrid screen. The screen resulted in the isolation of a new HBx interacting protein macrophage migration inhibitory factor (MIF). Macrophage migration inhibitory factor (MIF) was first described in 1966 as a cytokine, derived from activated lymphocytes, preventing random macrophage migration at the site of inflammation [4,8]. Subsequent studies of MIF action in
672
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
vivo have demonstrated a contributing role for MIF in the development of pathologies associated with several acute and chronic inflammatory disease processes. Examples include acute respiratory distress syndrome [9], rheumatoid arthritis [23], septic shock [6], glomerulonephritis [15,16], glucocorticoid-induced cytokine production [5], and allograft rejection [15,16]. Recent studies indicated that MIF play an important role in the tumor formation [12,25,26]. In this study, the interaction between HBx and MIF was confirmed in vitro and in vivo, and the interaction domain of MIF was located at 44–65 amino acids. Further studies revealed that both HBx and MIF could cause the HepG2 cell G0/G1 phase arrest, proliferation inhibition, and apoptosis. But MIF suppress the apoptotic effect of HBx through direct interaction. This may provide another mechanistic link between HBV chronic inflammation and hepatocellular carcinoma. Materials and methods Yeast two-hybrid screen. To identify proteins that interact with the HBx, the standard yeast two-hybrid screen was performed in the following manner. First, the bait plasmid was generated by inserting a PCRamplified DNA fragment encoding the HBx sequence into the NdeI–EcoRI restriction sites of pGBKT7 (Clontech), resulting in an in-frame fusion with the GAL4 DBD. Second, the resulting plasmid, pGBKT7-HBx was transformed into Saccharomyces cerevisiae strain AH109 and then mated with human pretransformed liver cDNA library (Clontech) according to the manufacturer’s protocol (Clontech). Mating mixtures were plated on synthetic medium lacking tryptophan, leucine, adenine, and histidine but containing 1 mM 3-aminotriazole. Approximately 1 · 107 clones were screened. The candidate clones were rescued from the yeast cells and reintroduced back to the same yeast strain to verify the interaction between the candidates and the HBx bait. Reverse transcription-PCR analysis. Total RNA was isolated using TRIzol Reagent according to the manufacturer’s instructions (Invitrogen). First-strand cDNA was reverse transcribed from 1.0 lg total RNA with oligo(dT) primers using AMV reverse transcriptase as recommended by the supplier (Promega). One microliter of the synthesized cDNA was used for PCR amplification in a total volume of 50 ll. The oligonucleotides P1 5 0 ATGCCGATGTTCATCGTAAAC3 0 and P2 5 0 CTAGGCGAAGG TGGAGTTG3 0 were used for amplification of the 348-bp coding sequence of MIF. PCR amplifications were performed for 30 cycles using the following cycling parameters: 94 C for 1 min, 55 C for 1 min, and 72 C for 1 min. The PCR for glyceraldehyde 3-phosphatase dehydrogenase (GAPDH) was used as an internal control. Co-immunoprecipitation. 293T cells were transfected using Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, cells were washed twice with phosphate-buffered saline and lysed in 0.5 ml lysis buffer (50 mM Tris at pH 8.0, 150 mM NaCl, 0.1% NP-40, 1 mM DTT, and protease inhibitor tablets from Roche). After brief sonication, the lysate was centrifuged at 14,000 rpm for 15 min at 4 C. The supernatant was used for subsequent co-immunoprecipitation. Five micrograms of anti-MIF antibody (Santa Cruz) and 40 ll of 50% slurry of the rProtein A agarose beads (Pharmacia) were used in each immunoprecipitation. Immunoprecipitation was performed overnight at 4 C. The beads were centrifuged at 3000 rpm for 2 min and washed once with the lysis buffer and three times with washing buffers, with each wash lasting at least 30 min. For determination of specificity of interaction between HBx and MIF, the washing buffer (50 mM Tris at pH 8.0, 250 mM NaCl, 1% NP-40, 1 mM DTT, and protease inhibitor tablets from Roche) was used. The precipitates were then eluted in 2· SDS–PAGE sample buffer and loaded on SDS–polyacrylamide, followed by Western blotting according to the standard procedures. Five microliters of the input crude
extract was used for detecting protein expression levels. The myc-tagged HBx was detected using an anti-myc monoclonal antibody (Santa Cruz). The endogenous MIF protein was detected using an anti-MIF antibody (Santa Cruz). GST pull-down assay. GST and GST fusion proteins were expressed and purified according to the manufacturer’s protocol (Amersham Pharmacia), with the induction of protein expression performed at 28 C for 3 h. The expressed MIF was incubated with 10 lg of GST derivatives bound to glutathione–Sepharose beads in 0.5 ml binding buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.3 mM dithiothreitol (DTT), 0.1% NP-40, and protease inhibitor tablets from Roche). The binding reaction was performed at 4 C overnight and the beads were subsequently washed four times with the washing buffer (the same as the binding buffer). The beads were eluted in 10 ll of 2· SDS–PAGE sample buffer and protein interactions were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) followed by Western blotting. Confocal microscopy of expression plasmids. The hepG2 cells were transfected with plasmid DNA using calcium phosphate transfection protocol. At 48 h after transfection, cells on glass coverslips were rinsed with PBS, subjected to fixation using 4% (v/v) paraformaldehyde for 30 min, and permeabilized with 0.2% (v/v) Triton X-100. Fluorescence antibody staining was performed through incubation cells with appropriate antibody for 1 h, followed by TRITC-labeled or FITC-labeled secondary antibody for 30 min. Then the nucleus was stained with Hoechst 33258. Images were viewed and collected with a confocal fluorescent microscope connected to a Bio-Rad Radiance2100 laser scanner. Western blotting analysis. The protein samples were run on 12% SDS– PAGE and transferred to PVDF membrane. The membrane was blocked in 5% non-fat milk in TBS-T (20 mM Tris–HCl, 137 mM NaCl, and 0.1% (v/v) Tween 20) and detected with anti-MIF antibody (Santa Cruz), antimyc antibody (Santa Cruz), and peroxidase-conjugated secondary antibody. Bound antibodies were detected with enhanced ECL Western blotting kit (Santa Cruz). Control experiments were carried out with blank vector or with normal mouse IgG antibody. Cell cycle analysis. The HrepG2 cells were seeded in a 6-well plate 24 h before transfection. Forty-eight hours post-transfection, cells were harvested, washed in PBS, and fixed in 0.5% paraformaldehyde for 10 min and then in 70% ethanol at 4 C overnight. Fluorescence antibody staining was performed through incubation cells with appropriate antibody for 1 h, followed by PE-labeled or FITC-labeled secondary antibody for 30 min. Then, the cells were incubated with RNase (1 mg/ml, Amersco) and PI (Sigma) or 7-AAD (BD Biosciences) according to the transfected gene. Cell cycle distributions (PI, red fluorescence; 7AAD, blue fluorescence) were analyzed on a FACSCalibur flow cytometer (Becton-Dickinson, UK). Ten thousand events were acquired per sample and data were analyzed using CellQuest software (Becton-Dickinson, UK). For further analysis, the transfected cell populations (GFP positive and FITC positive, green fluorescence; PE positive, red fluorescence) were ‘gated’ and their cell cycle distribution analyzed. Cell proliferation assays. Cell proliferation was measured with a CellTiter 96 (Promega, USA) colorimetric assay, utilizing an MTS tetrazolium compound, as per the manufacturer’s instructions. In brief, HepG2 cells were plated in 96-well microtiter plates at a concentration of 1 · 104 cells per well and incubated overnight in DMEM containing 10% serum. The cells were transfected with HA-MIF and myc-HBx both or separately. Cell viability was assessed at 48 h after transfection. Cell apoptosis analysis. The effect of MIF and HBx on HepG2 cell apoptosis was assessed with Annexin V using the Annexin V-FITC apoptosis detection kit (Biosea, China), following the protocol of manufacturer. Briefly, HepG2 cells were transfected with HA-MIF and mycHBx both or separately and harvested 48 h after transfection. Both the suspension and adherent cells were collected and washed with cold (4 C) PBS. After being suspended with binding buffer, 10 ll annexin V (20 lg/ ml) and 5 ll PI (50 lg/ml) were added to the cell suspension. Cell apoptosis was analyzed using FACSCalibur flow cytometer (Becton-Dickinson, UK) 15 min later.
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
HBx and HA-tagged MIF. The cell lysates were then immunoprecipitated with the anti-MIF antibody and subsequently immunoblotted with an anti-myc antibody. Consistent with the GST pull-down results, MIF specifically interact with myc-HBx. A reciprocal co-immunoprecipitation experiment using anti-myc antibody also showed the physical interaction between MIF and HBx Fig. 1.
Result Identification of the HBx interacting protein Since HBx is a multifunctional protein that plays an important role during infection of HBV, a prey pre-transformed human liver cDNA library was used in the yeast two-hybrid screen to identify proteins that interact with HBx, with the HBx as bait. One of the positive clones containing a cDNA encoding almost the entire open reading frame of MIF with N-terminal 10 amino acid residues lost was selected. The full-length cDNA was cloned from HepG2 cells.
Mapping the HBx binding domain of MIF
B
DBD-HBx
GST
To confirm the interaction of HBx and MIF, GST pulldown experiments were performed in which MIF was incubated with GST-HBx or GST alone. Consistent with the yeast two-hybrid results, MIF specifically bound to GSTHBx, but not GST. To further assess the binding specificity of MIF to HBx in vivo, 293T cells were cotransfected with myc-tagged
GSTX
For a more precise mapping of the region on MIF that interact with HBx, we constructed different deletants according to possible function domain, secondary and tertiary structure of MIF. These variants as well as full-length MIF were subjected to yeast hybrid assay. Briefly, the different prey plasmids containing MIF deletants were cotransformed with HBx bait plasmid or control plasmid containing laminin. The co-transformants were grown in SD/LeuTrp plate, and then transferred onto SD/ LeuTrpHisAde plate, which were all cultured at 30 C for 2 days. As shown in Fig. 2B, the full-length MIF and all the mutants except M4 and M7 transformed
Interaction of HBx and MIF in vivo and in vitro
A
673
97kD
IB:anti-myc
66kD
GST
Input
GSTX
43kD
C
31kD
MIF
D
Input
20kD
+ +
– +
HA-MIF myc-HBx
+ +
– +
myc-HBx HA-MIF
IP:anti-MIF
IP:anti-myc
IB:anti-myc
IB:anti-MIF Input
Input IB:anti-MIF
IB:anti-myc
Fig. 1. Interaction analysis of HBx and MIF in vitro and in vivo. (A) The HBx bait protein fused with DNA binding domain (DBD-HBx) was expressed in yeast. (B) The fusion protein of GSTX was expressed. The fusion protein and GST alone were analyzed by SDS–PAGE followed by staining with Coomassie brilliant blue. The molecular mass markers are indicated on the right. (C) GST pull-down analysis in vitro. The sonicated supernatant of HA-MIF was incubated with GST and GSTX bound to glutathione–Sepharose beads. The bound MIF was eluted together with GSTX. The interaction was determined by SDS–PAGE, transferred to PVDF, and analyzed by immunoblot using rabbit polyclonal anti-MIF antibody. As a positive control, small amount of HA-MIF used for the pull-down was loaded directly onto the gel. (D) Interaction analysis by immunoprecipitation. 293 cells were transfected transiently with myc-HBx and HA-MIF. Whole cell lysates were prepared and immunoprecipitated with the rabbit polyclonal anti-MIF antibody (left) or monoclonal anti-myc antibody (right). Immunocomplexes were analyzed by Western blotting with monoclonal anti-myc antibody (left) or rabbit polyclonal anti-MIF antibody (right). Input means that small amount of cellular extract used for the immunoprecipitation was loaded directly onto the gel. Cells transfected with only myc-HBx (left) or HA-MIF (right) served as negative control. The lower panel shows the expression of HA-MIF (left) and myc-HBx (right) protein in transfected cells.
674
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
β1
A
α1
β2
β3
α2
β4
F M1 M2 M3 M4 M5 M6 M7 44
B
C
5
4
65
44
6 3 7 2 8 65
1
D
HBx(bait) growth
9
1 F Y
2 M1 Y
3 M2 Y
4 M3 Y
5 M4 N
6 M5 Y
7 M6 Y
8 M7 N
9 lami N
Fig. 2. Mapping the region of MIF that interacts with HBx. (A) Schematic representation of the constructs used in this study. F means the full-length of MIF. M means the different mutants of MIF. b means b sheet and a means a helix of the secondary structure of MIF. (B) Yeast two-hybrid to identify the interaction domain of MIF. Yeast AH109 cotransfected with HBx bait and different MIF mutant prey were plated onto SD/LeuTrpHisAde plate and cultured at 30 C for 2 days. White colony indicates that the reporter gene Ade was activated and the yeast grows normally, while red colony means the reporter gene Ade was not activated and the yeast cannot grow normally. (C) Three-dimensional structure of MIF. The arrows indicate the interaction domain. (D) Summary of the yeast two-hybrid. Y means the colony can grow normally and N means the colony cannot grow normally. Number 9 is the laminin protein which plays as the negative control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this paper.)
yeast can grow on a SD/LeuTrpHisAde plate, in which the white colony means positive and red colony means negative. As negative control, the laminin cannot interact with full-length MIF. Then, the colonies were tested for the lacZ gene expression using x-a-gal and the result coincided with the white and red colony test (data not shown). These results indicated that the amino acids from 44 to 65 of MIF are very important for the interaction with HBx. Similar experiment was conducted to map the region on HBx that interacted with MIF but failed. The reason was presumed that the mutants of HBx were not designed according to its secondary and tertiary structure which destroyed the functional domain of HBx. Although they failed to map the interaction region of HBx, the results indicated that the C-terminus is the probable interaction region (data not shown).
Cellular localization of HBx and MIF HBx and MIF full-length genes were inserted into expression vector that allows the production of myc, HA, EGFP or RFP fusion proteins. The cellular localization of different proteins was tested by fluorescence confocal microscopy. The plasmids of myc-HBx, HBx-EGFP, HBx-RFP, and MIF-EGFP were transfected into HepG2 cells separately or both. At 48 h after transfection, cells were fixed and then stained with Hoechst 33258 to visualize nuclear DNA. As shown in Fig. 4A, a merged image was shown on the right, which represented the regions of overlap between the EGFP (green) and Hoechst 33258 stained (blue) image. Most of the HBx-EGFP fusion protein was located in the cytoplasm and a very small part of it in the nucleus. Furthermore, with a monoclonal antibody
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
against myc, the fluorescent distribution of myc-HBx detected by an anti-mouse antibody conjugated to tetramethylrhodamine (TRITC) was similar to that of HBxEGPF. With a polyclonal antibody against MIF, the fluorescent distribution of MIF detected by an anti-rabbit antibody conjugated to FITC was similar to that of MIF-EGFP (Figs. 4C and D). To confirm the spatial interaction in cells, the colocalization of HBx-RFP and MIF-EGFP was performed. The cells cotransfected with plasmids HBx-RFP and MIFEGFP were fixed and the nuclear DNA was stained with Hoechst 33258. The merged image represented the region of overlap between the HBx-RFP and MIF-EGFP. As shown in Fig. 4B, the HBx-RFP and part of MIF-EGFP were located in the same region in the cytoplasm. The results provided evidence and that HBx protein associated with MIF within HepG2 cells. Expression of MIF in HepG2 and 2.2.15 cells The results given above show that HBx interacted with MIF. We next examined whether MIF expression was involved in Hepatitis B virus infection. A Western blot analysis was carried out using HepG2 cell and 2.2.15 cell lysate. The 2.2.15 cell derived from HepG2 cell which transfected with full-length HBV genome and can secrete the virus particle. As shown in Fig. 3A, the expression of MIF was up-regulated at least threefold in HBV producing cell 2.2.15 compared to HepG2 cell. To further examine if HBx can up-regulate the expression of MIF, HepG2 cells were transfected with myc-HBx of void plasmid. As shown in Fig. 3B, transient HBx transfection cannot influence the A
HepG2
2.2.15
B
HepG2 HepG2-X
IB:anti-MIF
IB:anti-Actin
C
2.2.15
HepG2
Maker
GAPDH MIF
Fig. 3. Expression of MIF in HepG2 and 2.2.15 cells. (A) The expression of MIF in 2.2.15 cell is up-regulated. (B) HBx transfection cannot influence the expression of MIF. (C) mRNA of MIF is up-regulated in 2.2.15 cell compared with HepG2 cell.
675
expression of MIF. This result indicated that MIF expression was up-regulated by HBV infection but not HBx transfection alone. Inhibition of HepG2 cell proliferation by HBx and MIF The effects of HBx and MIF on HepG2 cell proliferation were investigated through transient transfection with either HBx, MIF, both HBx and MIF or vector alone (control). The cell viability was measured 48 or 72 h after transfection. Comparison of HBx transfected HepG2 cells with those transfected with vector (control) alone indicated that the proliferation of HBx transfected cells was inhibited (Fig. 6A). Similarly, MIF transfection can also inhibit the HepG2 cell proliferation but its effectiveness was lower compared with that of HBx. In addition, HBx and MIF cotransfection resulted in growth suppression compared to controls, but the degree of growth suppression was relieved compared to cells transfected with HBx alone. These results indicated that both HBx and MIF could suppress the growth of HepG2 cells separately, but MIF could counteract the growth suppressive effect of HBx when cotransfected with it. HBx and MIF transfection causes G0/G1 phase arrest of HepG2 cell To examine whether the reduction of proliferation caused by HBx and MIF was due to an effect on the cell cycle, the DNA content of transfected cell was analyzed using or 7-AAD staining and flow cytometric analysis. The fluorescence antibody staining of myc-HBx and HA-MIF separately transfected HepG2 cells was performed through incubation cells with monoclonal mouse anti-myc antibody and polyclonal rabbit anti-HA antibody for 1 h, respectively, followed by FITC-labeled secondary antibody for 30 min and nuclear staining with propidium iodide (PI). The fluorescence antibody staining of mycHBx and HA-MIF cotransfected HepG2 cells was performed through incubation cells with anti-myc and anti-HA antibody, followed by PE-labeled and FITClabeled secondary antibody and nuclear staining with 7-AAD. Cells transfected with vector alone were set as control. As shown in Fig. 5A, transfection of myc-HBx and HA-MIF, respectively, resulted in an increase in G0/G1 population cells and a decrease in the number of cells myc or HA positive in both S and G2/M phases of the cell cycle. Cotransfection of myc-HBx and HA-MIF also resulted in an increase in G0/G1 population cells and a decrease in the number of cells myc and HA double positive in both S and G2/M phases of the cell cycle. But the percentage of G0/G1 population cells is lower than that of myc positive only. This experiment was conducted three times and obtained a similar result each time. These results indicated that both HBx and MIF could increase in G0/G1 population cells but MIF could not enhance the effect of HBx but counteract it through direct interaction.
676
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
A
HBx-EGFP
Hoechst 33258
Merge
B
Myc-HBx
Hoechst 33258
Merge
C
MIF antibody
Hoechst 33258
Merge
MIF-EGFP
Hoechst 33258
HBx-RFP
Merge 1
Merge2
D
Fig. 4. Localization of HBx and MIF proteins. (A) Localization attribute of HBx-EGFP: HepG2 cells were transfected transiently with HBx-EGFP and myc-HBx plasmid separately. Localization of the protein was observed by fluorescent confocal microscopy. Green fluorescence came from expressed HBxEGFP fusion protein. (B) Localization attribute of myc-HBx: red fluorescence was detected by a monoclonal myc-antibody and then by an anti-mouseconjugated TRITC secondary antibody label. (C) Localization attribute of MIF: green fluorescence was detected by polyclonal MIF-antibody and then by an anti-rabbit conjugated FITC secondary antibody label. The nuclear DNA was stained with Hoechst 33258 (blue image). The merged image represents overlapping green or red and blue fluorescence. All three panels of a row had the same field of view. (D) Co-localization analysis between HBx-RFP and MIF-EGFP. HepG2 cells were co-transfected with HBx-RFP and MIF-EGFP. Red and green fluorescence came from expressed HBx-RFP and MIFEGFP fusion protein. The nuclear DNA was stained with Hoechst 33258. The merged image represents the region of overlap between the HBx-RFP (red) and MIF-EGFP (green) image. All four panels of row had the same field of view. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this paper.)
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
HA– myc–
A
HA+ myc–
G1
67.0%
G1
78.8%
S
31.1%
S
18.6%
G2+M 1.9%
A
677
2.5 2 1.5
G2+M 2.6%
1 0.5
1
HA-myc- HA+myc- HA-myc+ HA+myc+
HA+myc+
HA– myc+
B
G1
93.8%
G1
85.3%
S
6.2%
S
14.4%
G2+M 0.0%
2.64%
4.39%
G2+M 0.3%
4
3
B
0
2
100% S
7.06%
5.62%
G2 +M G1
75%
50%
25%
0%
HA-myc-
HA+myc-
HA-myc+ HA+myc+
Fig. 5. Flow cytometric analyses of HA-MIF and myc-HBx cotransfected HepG2 cells. (A) Cell cycle analysis of HA positive or negative and myc positive or negative cells, respectively. (B) Experiments were performed in triplicate and a representative result shown.
Fig. 6. Influence of HBx and MIF on the proliferation and apoptosis of HepG2 cells. (A) HepG2 cells were transfected with HA-MIF and mycHBx alone or both of them. Vector plasmid was transfected as control. Cell proliferation was measured with a CellTiter 96 (Promega, USA) colorimetric assay. (B) HepG2 cells were transfected with HA-MIF and myc-HBx alone or both of them. Vector plasmid was transfected as control. The effect of MIF and HBx on HepG2 cell apoptosis was assessed with Annexin V using the Annexin V-FITC apoptosis detection kit (Biosea, China).
Effect of HBx and MIF on apoptosis of HepG2 cells Since many genes induce apoptosis in concert with an induction of cell cycle arrest, the effects of HBx and MIF on the level of apoptosis were analyzed. The level of apoptosis following transfection was measured with Annexin V assay and flow cytometry. The incidence of apoptosis either or both of HBx and MIF transfected cells was elevated compared with cells transfected with vector plasmid. MIF transfection just increases the incidence of apoptosis slightly. However, HBx and MIF cotransfection can decrease the incidence of apoptosis compared with HBx transfection alone (Fig. 6). These results implied that both HBx and MIF increase the incidence of apoptosis while MIF suppresses the apoptotic effect of HBx through direct interaction. Discussion Here, we demonstrate for the first time that HBx interacts with macrophage migration inhibition factor (MIF).
The physical interaction has been validated by a number of in vitro and in vivo assays. First, the nucleotide sequence of MIF was isolated from the positive transformants of yeast two-hybrid. Second, the repeated yeast two-hybrid assay and GST pull-down all verified that HBx is physically associated with MIF. The interacting domains of MIF and HBx were also located through yeast two-hybrid. Third, full-length MIF was co-immunoprecipitated with HBx from cell lysate of 293 cells and HepG2 cells. Fourth, confocal assay further confirmed the interaction between HBx and MIF in transfected cells. HBx has been the focus of much attention in the past few years since its role is strongly implicated in hepatocarcinogenesis. More and more HBx interacting proteins were identified, including factors related to transcription [7,19, 17,3], proteasome subunit [31], mitochondrial proteins [28], and so on. Several kinase signal pathways were also reported to be modulated by HBx, either directly through HBx-associated factors, or indirectly. However, the precise role of HBx remained elusive, some results even controver-
678
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
sial. This may reflect the properties of HBx itself which means it is a multifunctional protein. The role of HBx in cell death pathways has been addressed in many systems and varying results were reported depending on different cell types. The apoptotic effect of HBx was reported dependent on the cellular status of p53 [1] or independent of it [27]. Here, we demonstrated the apoptotic effects of HBx on HepG2 cell, but its dependence on p53 was not verified. Migration inhibitory factor (MIF), classically defined as an inflammatory cytokine, has recently begun to be thought of as a pro-tumorigenic factor [24]. Its overexpression has been reported in various tumors, including hepatocellular carcinoma [22,13,21,2]. Furthermore, overexpression of MIF induces angiogenesis and deteriorates prognosis after resection for hepatocellular carcinoma [12]. The mechanism of MIF was reported that it can inhibit the function of p53 and thus suppress cell apoptosis in macrophage [25]. MIF also interferes with the Rb-E2F signal pathway [26]. Our work also revealed the expression of MIF in HepG2 cells and was up-regulated in 2.2.15 cells producing HBV particles while HBx transfection cannot up-regulate MIF. HepG2 cells transfected with MIF resulted in G0/G1 phase arrest, decreased cell viability, and increased cell apoptosis (Figs. 5 and 6). These results indicated that MIF is involved in other signal pathways or its function depends on different cell types. The subcellular localization of HBx has been controversial, but the general consensus is that most HBx is in cytoplasm, with a small fraction in the nucleus, especially when HBx is expressed ecotropically in cells [11]. In this paper, HBx was fused with EGFP, RFP, and myc to study the influence of the different tag on the cellular localization. As shown in Fig. 4, myc-HBx, HBx-EGFP, and HBxRFP distribute similarly in HepG2 cells, which meant that different tags do not influence the cellular localization of HBx. MIF-EGFP localized almost in all parts of the cell which is consistent with fluorescence staining. Our study found the new HBx interaction protein MIF and it can suppress the apoptotic effect of HBx. This can be explained in two aspects according to the dual effects of HBx, apoptotic and proliferation stimulation. First, HBx stimulates the cell proliferation through direct interaction with MIF to counteract its apoptotic effect. This apoptotic effect of HBx was initiated through direct interaction with other molecules, such as p53 [10]. Second, the apoptotic effect of HBx was suppressed by interacting with MIF. The interaction between HBx and MIF competitively inhibits the apoptotic domain of HBx. As mentioned above, the apoptotic effect of HBx relates to p53 [1,27] and MIF also participate in Rb-E2F [26] and p53 [25] signal pathway. The most possible pathway is that HBx interfere with p53 and Rb-E2F signal pathway through interaction with MIF. But this should be elucidated in later work. Since hepatocellular carcinoma formation has been associated with HBV chronic inflammatory conditions, the relationship between the inflammation and tumor development remains largely obscure at a molecular level.
To find a novel thing is better than to deepen the finding. Our study may shed some light on this formidable problem. Acknowledgments This work is supported by a grant from the National Basic Research Program of China (2004CB518904, 2005CB522902) and a grant from the National Nature Science Foundation of China (No.30530650). References [1] J.Y. Ahn, E.Y. Jung, H.J. Kwun, C.W. Lee, Y.C. Sung, K.L. Jang, Dual effects of hepatitis B virus X protein on the regulation of cellcycle control depending on the status of cellular p53, J. Gen. Virol. 83 (2002) 2765–2772. [2] S.M. Akbar, M. Abe, H. Murakami, K. Tanimoto, T. Kumagi, Y. Yamashita, et al., Macrophage migration inhibitory factor in hepatocellular carcinoma and liver cirrhosis; relevance to pathogenesis, Cancer Lett. 171 (2001) 125–132. [3] O. Barak, A. Aronheim, Y. Shaul, HBV X protein targets HIV Tatbinding protein 1, Virology 283 (2001) 110–120. [4] B.R. Bloom, B. Bennett, Mechanism of a reaction in vitro associated with delayed-type hypersensitivity, Science 153 (1966) 80–82. [5] T. Calandra, J. Bernhagen, C.N. Metz, L.A. Spiegel, M. Bacher, T. Donnelly, et al., MIF as a glucocorticoid-induced modulator of cytokine production, Nature 377 (1995) 68–71. [6] T. Calandra, B. Echtenacher, D.L. Roy, J. Pugin, C.N. Metz, L. Hultner, et al., Protection from septic shock by neutralization of macrophage migration inhibitory factor, Nat. Med. 6 (2000) 164–170. [7] J.H. Cheong, M. Yi, Y. Lin, S. Murakami, Human RPB5, a subunit shared by eukaryotic nuclear RNA polymerases, binds human hepatitis B virus X protein and may play a role in X transactivation, EMBO J. 14 (1995) 143–150. [8] J.R. David, Delayed hypersensitivity in vitro: its mediation by cellfree substances formed by lymphoid cell-antigen interaction, Proc. Natl. Acad. Sci. USA 56 (1966) 72–77. [9] S.C. Donnelly, C. Haslett, P.T. Reid, I.S. Grant, W.A. Wallace, C.N. Metz, et al., Regulatory role for macrophage migration inhibitory factor in acute respiratory distress syndrome, Nat. Med. 3 (1997) 320–323. [10] L.W. Elmore, A.R. Hancock, S.F. Chang, X.W. Wang, S. Chang, C.P. Callahan, et al., Hepatitis B virus X protein and p53 tumor suppressor interactions in the modulation of apoptosis, Proc. Natl. Acad. Sci. USA 94 (1997) 14707–14712. [11] F. Henkler, J. Hoare, N. Waseem, R.D. Goldin, M.J. McGarvey, R. Koshy, et al., Intracellular localization of the hepatitis B virus HBx protein, J. Gen. Virol. 82 (2001) 871–882. [12] E. Hira, T. Ono, D.K. Dhar, O.N. El-Assal, Y. Hishikawa, A. Yamanoi, et al., Overexpression of macrophage migration inhibitory factor induces angiogenesis and deteriorates prognosis after radical resection for hepatocellular carcinoma, Cancer 103 (2005) 588–598. [13] A. Kamimura, M. Kamachi, J. Nishihira, S. Ogura, H. Isobe, H. Dosaka-Akita, et al., Intracellular distribution of macrophage migration inhibitory factor predicts the prognosis of patients with adenocarcinoma of the lung, Cancer 89 (2000) 334–341. [14] C.M. Kim, K. Koike, I. Saito, T. Miyamura, G. Jay, HBx gene of hepatitis B virus induces liver cancer in transgenic mice, Nature 351 (1991) 317–320. [15] H.Y. Lan, M. Bacher, N. Yang, W. Mu, D.J. Nikolic-Paterson, C. Metz, et al., The pathogenic role of macrophage migration inhibitory factor in immunologically induced kidney disease in the rat, J. Exp. Med. 185 (1997) 1455–1465.
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679 [16] H.Y. Lan, N. Yang, C. Metz, W. Mu, Q. Song, D.J. NikolicPaterson, et al., TNF-alpha up-regulates renal MIF expression in rat crescentic glomerulonephritis, Mol. Med. 3 (1997) 136–144. [17] E. Lara-Pezzi, A.L. Armesilla, P.L. Majano, J.M. Redondo, M. Lopez-Cabrera, The hepatitis B virus X protein activates nuclear factor of activated T cells (NF-AT) by a cyclosporin A-sensitive pathway, EMBO J. 17 (1998) 7066–7077. [18] T.H. Lee, M.J. Finegold, R.F. Shen, J.L. DeMayo, S.L. Woo, J.S. Butel, Hepatitis B virus transactivator X protein is not tumorigenic in transgenic mice, J. Virol. 64 (1990) 5939–5947. [19] S.W. Lee, Y.M. Lee, S.K. Bae, S. Murakami, Y. Yun, K.W. Kim, Human hepatitis B virus X protein is a possible mediator of hypoxiainduced angiogenesis in hepatocarcinogenesis, Biochem. Biophys. Res. Commun. 268 (2000) 456–461. [20] Y. Lin, T. Nomura, T. Yamashita, D. Dorjsuren, H. Tang, S. Murakami, The transactivation and p53-interacting functions of hepatitis B virus X protein are mutually interfering but distinct, Cancer Res. 57 (1997) 5137–5242. [21] J.M. Markert, C.M. Fuller, G.Y. Gillespie, J.K. Bubien, L.A. McLean, R.L. Hong, et al., Differential gene expression profiling in human brain tumors, Physiol. Genomics 5 (2001) 21–33. [22] K. Meyer-Siegler, P.B. Hudson, Enhanced expression of macrophage migration inhibitory factor in prostatic adenocarcinoma metastases, Urology 48 (1996) 448–452. [23] A. Mikulowska, C.N. Metz, R. Bucala, R. Holmdahl, Macrophage migration inhibitory factor is involved in the pathogenesis of collagen type II-induced arthritis in mice, J. Immunol. 158 (1997) 5514–5517.
679
[24] R.A. Mitchell, R. Bucala, Tumor growth-promoting properties of macrophage migration inhibitory factor (MIF), Semin. Cancer Biol. 10 (2000) 359–366. [25] R.A. Mitchell, H. Liao, J. Chesney, G. Fingerle-Rowson, J. Baugh, J. David, et al., Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory function by inhibiting p53: regulatory role in the innate immune response, Proc. Natl. Acad. Sci. USA 99 (2002) 345–350. [26] O. Petrenko, U.M. Moll, Macrophage migration inhibitory factor MIF interferes with the Rb-E2F pathway, Mol. Cell 17 (2005) 225–236. [27] Y. Shintani, H. Yotsuyanagi, K. Moriya, H. Fujie, T. Tsutsumi, Y. Kanegae, et al., Induction of apoptosis after switch-on of the hepatitis B virus X gene mediated by the Cre/loxP recombination system, J. Gen. Virol. 80 (1999) 3257–3265. [28] S. Takada, Y. Shirakata, N. Kaneniwa, K. Koike, Association of hepatitis B virus X protein with mitochondria causes mitochondrial aggregation at the nuclear periphery, leading to cell death, Oncogene 18 (1999) 6965–6973. [29] Y. Wang, F. Cui, Y. Lv, C. Li, X. Xu, C. Deng, et al., HBsAg and HBx knocked into the p21 locus causes hepatocellular carcinoma in mice, Hepatology 39 (2004) 318–324. [30] S.M. Zhang, D.C. Sun, S.K. Lou, X.C. Bo, Z. Lu, X.H. Qian, et al., HBx protein of hepatitis B virus (HBV) can form complex with mitochondrial HSP60 and HSP70, Arch. Virol. 150 (2005) 179–190. [31] Z. Zhang, N. Torii, A. Furusaka, N. Malayaman, Z. Hu, T.J. Liang, Structural and functional characterization of interaction between hepatitis B virus X protein and the proteasome complex, J. Biol. Chem. 275 (2000) 15157–15165.
Macrophage migration inhibitory factor interacts with HBx and inhibits its apoptotic activity Shimeng Zhang, Ruxian Lin, Zhe Zhou, Siyuan Wen, Li Lin, Suhong Chen, Yajun Shan, Yuwen Cong, Shengqi Wang * Beijing Institute of Radiation Medicine, No.27 Taiping Road, Beijing 100850, PR China Received 24 January 2006 Available online 13 February 2006
Abstract HBx, a transcriptional transactivating protein of hepatitis B virus (HBV), is required for viral infection and has been implicated in virus-mediated liver oncogenesis. However, the precise molecular mechanism remains largely elusive. We used the yeast two-hybrid system to identify that HBx interacts with MIF directly. Macrophage migration inhibitory factor (MIF) is implicated in the regulation of inflammation, cell growth, and even tumor formation. The interaction between HBx and MIF was verified with co-immunoprecipitation, GST pull-down, and cellular colocalization. The expression of MIF was up-regulated in HBV particle producing cell 2.2.15 compared with HepG2 cell. Both HBx and MIF cause HepG2 cell G0/G1 phase arrest, proliferation inhibition, and apoptosis. However, MIF can counteract the apoptotic effect of HBx. These results may provide evidence to explain the link between HBV infection and hepatocellular carcinoma. 2006 Elsevier Inc. All rights reserved. Keywords: MIF; HBx; Apoptosis
Many studies link chronic infection of hepatitis B virus (HBV) in human to the development of hepatocellular carcinoma (HCC). HBx, a 17 kDa protein encoded by the virus, is thought to play an important role in the development of HBV-associated HCC. But transgenic mice studies provide conflicting results. Some HBx transgenic mice develop liver cancer [14,29], while others do not [18]. However, HBx can serve as a cofactor for HCC in those transgenic mice that do not develop spontaneous tumor. The precise mechanism of HBx involvement remains elusive, but several studies have suggested a possible role for HBx protein in the process of liver carcinogenesis. HBx is a promiscuous transactivator and it has been shown to activate a wide variety of viral and cellular targets, including host genes for acute inflammatory response, cell proliferation, and housekeeping.
*
Corresponding author. Fax: +86 10 66932211. E-mail address: [email protected] (S. Wang).
0006-291X/$ - see front matter 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.01.180
Identification of cellular HBx-interactive proteins would provide insights into the mechanism of HBV cellular effects. It is reported that HBx can bind basal transcription factors such as RNA polymerase subunit RPB5 [7] and act as a transcription cofactor. HBx can also interact with other factors, including SMAD4 [19] and NF-AT in TNFa signaling [17], P53 [10,20], and HIV Tat-binding protein (Tbp1) [3]. In addition to the described factors related to transcription, PMSA1 and PMSA7 [31], subunits of proteosome, are also found to interact with HBx. Our previous work reported that HBx can form a complex with mitochondrial HSP60 and HSP70 [30]. In this study, we attempt to discover new HBx interacting proteins using yeast two-hybrid screen. The screen resulted in the isolation of a new HBx interacting protein macrophage migration inhibitory factor (MIF). Macrophage migration inhibitory factor (MIF) was first described in 1966 as a cytokine, derived from activated lymphocytes, preventing random macrophage migration at the site of inflammation [4,8]. Subsequent studies of MIF action in
672
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
vivo have demonstrated a contributing role for MIF in the development of pathologies associated with several acute and chronic inflammatory disease processes. Examples include acute respiratory distress syndrome [9], rheumatoid arthritis [23], septic shock [6], glomerulonephritis [15,16], glucocorticoid-induced cytokine production [5], and allograft rejection [15,16]. Recent studies indicated that MIF play an important role in the tumor formation [12,25,26]. In this study, the interaction between HBx and MIF was confirmed in vitro and in vivo, and the interaction domain of MIF was located at 44–65 amino acids. Further studies revealed that both HBx and MIF could cause the HepG2 cell G0/G1 phase arrest, proliferation inhibition, and apoptosis. But MIF suppress the apoptotic effect of HBx through direct interaction. This may provide another mechanistic link between HBV chronic inflammation and hepatocellular carcinoma. Materials and methods Yeast two-hybrid screen. To identify proteins that interact with the HBx, the standard yeast two-hybrid screen was performed in the following manner. First, the bait plasmid was generated by inserting a PCRamplified DNA fragment encoding the HBx sequence into the NdeI–EcoRI restriction sites of pGBKT7 (Clontech), resulting in an in-frame fusion with the GAL4 DBD. Second, the resulting plasmid, pGBKT7-HBx was transformed into Saccharomyces cerevisiae strain AH109 and then mated with human pretransformed liver cDNA library (Clontech) according to the manufacturer’s protocol (Clontech). Mating mixtures were plated on synthetic medium lacking tryptophan, leucine, adenine, and histidine but containing 1 mM 3-aminotriazole. Approximately 1 · 107 clones were screened. The candidate clones were rescued from the yeast cells and reintroduced back to the same yeast strain to verify the interaction between the candidates and the HBx bait. Reverse transcription-PCR analysis. Total RNA was isolated using TRIzol Reagent according to the manufacturer’s instructions (Invitrogen). First-strand cDNA was reverse transcribed from 1.0 lg total RNA with oligo(dT) primers using AMV reverse transcriptase as recommended by the supplier (Promega). One microliter of the synthesized cDNA was used for PCR amplification in a total volume of 50 ll. The oligonucleotides P1 5 0 ATGCCGATGTTCATCGTAAAC3 0 and P2 5 0 CTAGGCGAAGG TGGAGTTG3 0 were used for amplification of the 348-bp coding sequence of MIF. PCR amplifications were performed for 30 cycles using the following cycling parameters: 94 C for 1 min, 55 C for 1 min, and 72 C for 1 min. The PCR for glyceraldehyde 3-phosphatase dehydrogenase (GAPDH) was used as an internal control. Co-immunoprecipitation. 293T cells were transfected using Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, cells were washed twice with phosphate-buffered saline and lysed in 0.5 ml lysis buffer (50 mM Tris at pH 8.0, 150 mM NaCl, 0.1% NP-40, 1 mM DTT, and protease inhibitor tablets from Roche). After brief sonication, the lysate was centrifuged at 14,000 rpm for 15 min at 4 C. The supernatant was used for subsequent co-immunoprecipitation. Five micrograms of anti-MIF antibody (Santa Cruz) and 40 ll of 50% slurry of the rProtein A agarose beads (Pharmacia) were used in each immunoprecipitation. Immunoprecipitation was performed overnight at 4 C. The beads were centrifuged at 3000 rpm for 2 min and washed once with the lysis buffer and three times with washing buffers, with each wash lasting at least 30 min. For determination of specificity of interaction between HBx and MIF, the washing buffer (50 mM Tris at pH 8.0, 250 mM NaCl, 1% NP-40, 1 mM DTT, and protease inhibitor tablets from Roche) was used. The precipitates were then eluted in 2· SDS–PAGE sample buffer and loaded on SDS–polyacrylamide, followed by Western blotting according to the standard procedures. Five microliters of the input crude
extract was used for detecting protein expression levels. The myc-tagged HBx was detected using an anti-myc monoclonal antibody (Santa Cruz). The endogenous MIF protein was detected using an anti-MIF antibody (Santa Cruz). GST pull-down assay. GST and GST fusion proteins were expressed and purified according to the manufacturer’s protocol (Amersham Pharmacia), with the induction of protein expression performed at 28 C for 3 h. The expressed MIF was incubated with 10 lg of GST derivatives bound to glutathione–Sepharose beads in 0.5 ml binding buffer (50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.3 mM dithiothreitol (DTT), 0.1% NP-40, and protease inhibitor tablets from Roche). The binding reaction was performed at 4 C overnight and the beads were subsequently washed four times with the washing buffer (the same as the binding buffer). The beads were eluted in 10 ll of 2· SDS–PAGE sample buffer and protein interactions were analyzed by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) followed by Western blotting. Confocal microscopy of expression plasmids. The hepG2 cells were transfected with plasmid DNA using calcium phosphate transfection protocol. At 48 h after transfection, cells on glass coverslips were rinsed with PBS, subjected to fixation using 4% (v/v) paraformaldehyde for 30 min, and permeabilized with 0.2% (v/v) Triton X-100. Fluorescence antibody staining was performed through incubation cells with appropriate antibody for 1 h, followed by TRITC-labeled or FITC-labeled secondary antibody for 30 min. Then the nucleus was stained with Hoechst 33258. Images were viewed and collected with a confocal fluorescent microscope connected to a Bio-Rad Radiance2100 laser scanner. Western blotting analysis. The protein samples were run on 12% SDS– PAGE and transferred to PVDF membrane. The membrane was blocked in 5% non-fat milk in TBS-T (20 mM Tris–HCl, 137 mM NaCl, and 0.1% (v/v) Tween 20) and detected with anti-MIF antibody (Santa Cruz), antimyc antibody (Santa Cruz), and peroxidase-conjugated secondary antibody. Bound antibodies were detected with enhanced ECL Western blotting kit (Santa Cruz). Control experiments were carried out with blank vector or with normal mouse IgG antibody. Cell cycle analysis. The HrepG2 cells were seeded in a 6-well plate 24 h before transfection. Forty-eight hours post-transfection, cells were harvested, washed in PBS, and fixed in 0.5% paraformaldehyde for 10 min and then in 70% ethanol at 4 C overnight. Fluorescence antibody staining was performed through incubation cells with appropriate antibody for 1 h, followed by PE-labeled or FITC-labeled secondary antibody for 30 min. Then, the cells were incubated with RNase (1 mg/ml, Amersco) and PI (Sigma) or 7-AAD (BD Biosciences) according to the transfected gene. Cell cycle distributions (PI, red fluorescence; 7AAD, blue fluorescence) were analyzed on a FACSCalibur flow cytometer (Becton-Dickinson, UK). Ten thousand events were acquired per sample and data were analyzed using CellQuest software (Becton-Dickinson, UK). For further analysis, the transfected cell populations (GFP positive and FITC positive, green fluorescence; PE positive, red fluorescence) were ‘gated’ and their cell cycle distribution analyzed. Cell proliferation assays. Cell proliferation was measured with a CellTiter 96 (Promega, USA) colorimetric assay, utilizing an MTS tetrazolium compound, as per the manufacturer’s instructions. In brief, HepG2 cells were plated in 96-well microtiter plates at a concentration of 1 · 104 cells per well and incubated overnight in DMEM containing 10% serum. The cells were transfected with HA-MIF and myc-HBx both or separately. Cell viability was assessed at 48 h after transfection. Cell apoptosis analysis. The effect of MIF and HBx on HepG2 cell apoptosis was assessed with Annexin V using the Annexin V-FITC apoptosis detection kit (Biosea, China), following the protocol of manufacturer. Briefly, HepG2 cells were transfected with HA-MIF and mycHBx both or separately and harvested 48 h after transfection. Both the suspension and adherent cells were collected and washed with cold (4 C) PBS. After being suspended with binding buffer, 10 ll annexin V (20 lg/ ml) and 5 ll PI (50 lg/ml) were added to the cell suspension. Cell apoptosis was analyzed using FACSCalibur flow cytometer (Becton-Dickinson, UK) 15 min later.
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
HBx and HA-tagged MIF. The cell lysates were then immunoprecipitated with the anti-MIF antibody and subsequently immunoblotted with an anti-myc antibody. Consistent with the GST pull-down results, MIF specifically interact with myc-HBx. A reciprocal co-immunoprecipitation experiment using anti-myc antibody also showed the physical interaction between MIF and HBx Fig. 1.
Result Identification of the HBx interacting protein Since HBx is a multifunctional protein that plays an important role during infection of HBV, a prey pre-transformed human liver cDNA library was used in the yeast two-hybrid screen to identify proteins that interact with HBx, with the HBx as bait. One of the positive clones containing a cDNA encoding almost the entire open reading frame of MIF with N-terminal 10 amino acid residues lost was selected. The full-length cDNA was cloned from HepG2 cells.
Mapping the HBx binding domain of MIF
B
DBD-HBx
GST
To confirm the interaction of HBx and MIF, GST pulldown experiments were performed in which MIF was incubated with GST-HBx or GST alone. Consistent with the yeast two-hybrid results, MIF specifically bound to GSTHBx, but not GST. To further assess the binding specificity of MIF to HBx in vivo, 293T cells were cotransfected with myc-tagged
GSTX
For a more precise mapping of the region on MIF that interact with HBx, we constructed different deletants according to possible function domain, secondary and tertiary structure of MIF. These variants as well as full-length MIF were subjected to yeast hybrid assay. Briefly, the different prey plasmids containing MIF deletants were cotransformed with HBx bait plasmid or control plasmid containing laminin. The co-transformants were grown in SD/LeuTrp plate, and then transferred onto SD/ LeuTrpHisAde plate, which were all cultured at 30 C for 2 days. As shown in Fig. 2B, the full-length MIF and all the mutants except M4 and M7 transformed
Interaction of HBx and MIF in vivo and in vitro
A
673
97kD
IB:anti-myc
66kD
GST
Input
GSTX
43kD
C
31kD
MIF
D
Input
20kD
+ +
– +
HA-MIF myc-HBx
+ +
– +
myc-HBx HA-MIF
IP:anti-MIF
IP:anti-myc
IB:anti-myc
IB:anti-MIF Input
Input IB:anti-MIF
IB:anti-myc
Fig. 1. Interaction analysis of HBx and MIF in vitro and in vivo. (A) The HBx bait protein fused with DNA binding domain (DBD-HBx) was expressed in yeast. (B) The fusion protein of GSTX was expressed. The fusion protein and GST alone were analyzed by SDS–PAGE followed by staining with Coomassie brilliant blue. The molecular mass markers are indicated on the right. (C) GST pull-down analysis in vitro. The sonicated supernatant of HA-MIF was incubated with GST and GSTX bound to glutathione–Sepharose beads. The bound MIF was eluted together with GSTX. The interaction was determined by SDS–PAGE, transferred to PVDF, and analyzed by immunoblot using rabbit polyclonal anti-MIF antibody. As a positive control, small amount of HA-MIF used for the pull-down was loaded directly onto the gel. (D) Interaction analysis by immunoprecipitation. 293 cells were transfected transiently with myc-HBx and HA-MIF. Whole cell lysates were prepared and immunoprecipitated with the rabbit polyclonal anti-MIF antibody (left) or monoclonal anti-myc antibody (right). Immunocomplexes were analyzed by Western blotting with monoclonal anti-myc antibody (left) or rabbit polyclonal anti-MIF antibody (right). Input means that small amount of cellular extract used for the immunoprecipitation was loaded directly onto the gel. Cells transfected with only myc-HBx (left) or HA-MIF (right) served as negative control. The lower panel shows the expression of HA-MIF (left) and myc-HBx (right) protein in transfected cells.
674
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
β1
A
α1
β2
β3
α2
β4
F M1 M2 M3 M4 M5 M6 M7 44
B
C
5
4
65
44
6 3 7 2 8 65
1
D
HBx(bait) growth
9
1 F Y
2 M1 Y
3 M2 Y
4 M3 Y
5 M4 N
6 M5 Y
7 M6 Y
8 M7 N
9 lami N
Fig. 2. Mapping the region of MIF that interacts with HBx. (A) Schematic representation of the constructs used in this study. F means the full-length of MIF. M means the different mutants of MIF. b means b sheet and a means a helix of the secondary structure of MIF. (B) Yeast two-hybrid to identify the interaction domain of MIF. Yeast AH109 cotransfected with HBx bait and different MIF mutant prey were plated onto SD/LeuTrpHisAde plate and cultured at 30 C for 2 days. White colony indicates that the reporter gene Ade was activated and the yeast grows normally, while red colony means the reporter gene Ade was not activated and the yeast cannot grow normally. (C) Three-dimensional structure of MIF. The arrows indicate the interaction domain. (D) Summary of the yeast two-hybrid. Y means the colony can grow normally and N means the colony cannot grow normally. Number 9 is the laminin protein which plays as the negative control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this paper.)
yeast can grow on a SD/LeuTrpHisAde plate, in which the white colony means positive and red colony means negative. As negative control, the laminin cannot interact with full-length MIF. Then, the colonies were tested for the lacZ gene expression using x-a-gal and the result coincided with the white and red colony test (data not shown). These results indicated that the amino acids from 44 to 65 of MIF are very important for the interaction with HBx. Similar experiment was conducted to map the region on HBx that interacted with MIF but failed. The reason was presumed that the mutants of HBx were not designed according to its secondary and tertiary structure which destroyed the functional domain of HBx. Although they failed to map the interaction region of HBx, the results indicated that the C-terminus is the probable interaction region (data not shown).
Cellular localization of HBx and MIF HBx and MIF full-length genes were inserted into expression vector that allows the production of myc, HA, EGFP or RFP fusion proteins. The cellular localization of different proteins was tested by fluorescence confocal microscopy. The plasmids of myc-HBx, HBx-EGFP, HBx-RFP, and MIF-EGFP were transfected into HepG2 cells separately or both. At 48 h after transfection, cells were fixed and then stained with Hoechst 33258 to visualize nuclear DNA. As shown in Fig. 4A, a merged image was shown on the right, which represented the regions of overlap between the EGFP (green) and Hoechst 33258 stained (blue) image. Most of the HBx-EGFP fusion protein was located in the cytoplasm and a very small part of it in the nucleus. Furthermore, with a monoclonal antibody
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
against myc, the fluorescent distribution of myc-HBx detected by an anti-mouse antibody conjugated to tetramethylrhodamine (TRITC) was similar to that of HBxEGPF. With a polyclonal antibody against MIF, the fluorescent distribution of MIF detected by an anti-rabbit antibody conjugated to FITC was similar to that of MIF-EGFP (Figs. 4C and D). To confirm the spatial interaction in cells, the colocalization of HBx-RFP and MIF-EGFP was performed. The cells cotransfected with plasmids HBx-RFP and MIFEGFP were fixed and the nuclear DNA was stained with Hoechst 33258. The merged image represented the region of overlap between the HBx-RFP and MIF-EGFP. As shown in Fig. 4B, the HBx-RFP and part of MIF-EGFP were located in the same region in the cytoplasm. The results provided evidence and that HBx protein associated with MIF within HepG2 cells. Expression of MIF in HepG2 and 2.2.15 cells The results given above show that HBx interacted with MIF. We next examined whether MIF expression was involved in Hepatitis B virus infection. A Western blot analysis was carried out using HepG2 cell and 2.2.15 cell lysate. The 2.2.15 cell derived from HepG2 cell which transfected with full-length HBV genome and can secrete the virus particle. As shown in Fig. 3A, the expression of MIF was up-regulated at least threefold in HBV producing cell 2.2.15 compared to HepG2 cell. To further examine if HBx can up-regulate the expression of MIF, HepG2 cells were transfected with myc-HBx of void plasmid. As shown in Fig. 3B, transient HBx transfection cannot influence the A
HepG2
2.2.15
B
HepG2 HepG2-X
IB:anti-MIF
IB:anti-Actin
C
2.2.15
HepG2
Maker
GAPDH MIF
Fig. 3. Expression of MIF in HepG2 and 2.2.15 cells. (A) The expression of MIF in 2.2.15 cell is up-regulated. (B) HBx transfection cannot influence the expression of MIF. (C) mRNA of MIF is up-regulated in 2.2.15 cell compared with HepG2 cell.
675
expression of MIF. This result indicated that MIF expression was up-regulated by HBV infection but not HBx transfection alone. Inhibition of HepG2 cell proliferation by HBx and MIF The effects of HBx and MIF on HepG2 cell proliferation were investigated through transient transfection with either HBx, MIF, both HBx and MIF or vector alone (control). The cell viability was measured 48 or 72 h after transfection. Comparison of HBx transfected HepG2 cells with those transfected with vector (control) alone indicated that the proliferation of HBx transfected cells was inhibited (Fig. 6A). Similarly, MIF transfection can also inhibit the HepG2 cell proliferation but its effectiveness was lower compared with that of HBx. In addition, HBx and MIF cotransfection resulted in growth suppression compared to controls, but the degree of growth suppression was relieved compared to cells transfected with HBx alone. These results indicated that both HBx and MIF could suppress the growth of HepG2 cells separately, but MIF could counteract the growth suppressive effect of HBx when cotransfected with it. HBx and MIF transfection causes G0/G1 phase arrest of HepG2 cell To examine whether the reduction of proliferation caused by HBx and MIF was due to an effect on the cell cycle, the DNA content of transfected cell was analyzed using or 7-AAD staining and flow cytometric analysis. The fluorescence antibody staining of myc-HBx and HA-MIF separately transfected HepG2 cells was performed through incubation cells with monoclonal mouse anti-myc antibody and polyclonal rabbit anti-HA antibody for 1 h, respectively, followed by FITC-labeled secondary antibody for 30 min and nuclear staining with propidium iodide (PI). The fluorescence antibody staining of mycHBx and HA-MIF cotransfected HepG2 cells was performed through incubation cells with anti-myc and anti-HA antibody, followed by PE-labeled and FITClabeled secondary antibody and nuclear staining with 7-AAD. Cells transfected with vector alone were set as control. As shown in Fig. 5A, transfection of myc-HBx and HA-MIF, respectively, resulted in an increase in G0/G1 population cells and a decrease in the number of cells myc or HA positive in both S and G2/M phases of the cell cycle. Cotransfection of myc-HBx and HA-MIF also resulted in an increase in G0/G1 population cells and a decrease in the number of cells myc and HA double positive in both S and G2/M phases of the cell cycle. But the percentage of G0/G1 population cells is lower than that of myc positive only. This experiment was conducted three times and obtained a similar result each time. These results indicated that both HBx and MIF could increase in G0/G1 population cells but MIF could not enhance the effect of HBx but counteract it through direct interaction.
676
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
A
HBx-EGFP
Hoechst 33258
Merge
B
Myc-HBx
Hoechst 33258
Merge
C
MIF antibody
Hoechst 33258
Merge
MIF-EGFP
Hoechst 33258
HBx-RFP
Merge 1
Merge2
D
Fig. 4. Localization of HBx and MIF proteins. (A) Localization attribute of HBx-EGFP: HepG2 cells were transfected transiently with HBx-EGFP and myc-HBx plasmid separately. Localization of the protein was observed by fluorescent confocal microscopy. Green fluorescence came from expressed HBxEGFP fusion protein. (B) Localization attribute of myc-HBx: red fluorescence was detected by a monoclonal myc-antibody and then by an anti-mouseconjugated TRITC secondary antibody label. (C) Localization attribute of MIF: green fluorescence was detected by polyclonal MIF-antibody and then by an anti-rabbit conjugated FITC secondary antibody label. The nuclear DNA was stained with Hoechst 33258 (blue image). The merged image represents overlapping green or red and blue fluorescence. All three panels of a row had the same field of view. (D) Co-localization analysis between HBx-RFP and MIF-EGFP. HepG2 cells were co-transfected with HBx-RFP and MIF-EGFP. Red and green fluorescence came from expressed HBx-RFP and MIFEGFP fusion protein. The nuclear DNA was stained with Hoechst 33258. The merged image represents the region of overlap between the HBx-RFP (red) and MIF-EGFP (green) image. All four panels of row had the same field of view. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this paper.)
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
HA– myc–
A
HA+ myc–
G1
67.0%
G1
78.8%
S
31.1%
S
18.6%
G2+M 1.9%
A
677
2.5 2 1.5
G2+M 2.6%
1 0.5
1
HA-myc- HA+myc- HA-myc+ HA+myc+
HA+myc+
HA– myc+
B
G1
93.8%
G1
85.3%
S
6.2%
S
14.4%
G2+M 0.0%
2.64%
4.39%
G2+M 0.3%
4
3
B
0
2
100% S
7.06%
5.62%
G2 +M G1
75%
50%
25%
0%
HA-myc-
HA+myc-
HA-myc+ HA+myc+
Fig. 5. Flow cytometric analyses of HA-MIF and myc-HBx cotransfected HepG2 cells. (A) Cell cycle analysis of HA positive or negative and myc positive or negative cells, respectively. (B) Experiments were performed in triplicate and a representative result shown.
Fig. 6. Influence of HBx and MIF on the proliferation and apoptosis of HepG2 cells. (A) HepG2 cells were transfected with HA-MIF and mycHBx alone or both of them. Vector plasmid was transfected as control. Cell proliferation was measured with a CellTiter 96 (Promega, USA) colorimetric assay. (B) HepG2 cells were transfected with HA-MIF and myc-HBx alone or both of them. Vector plasmid was transfected as control. The effect of MIF and HBx on HepG2 cell apoptosis was assessed with Annexin V using the Annexin V-FITC apoptosis detection kit (Biosea, China).
Effect of HBx and MIF on apoptosis of HepG2 cells Since many genes induce apoptosis in concert with an induction of cell cycle arrest, the effects of HBx and MIF on the level of apoptosis were analyzed. The level of apoptosis following transfection was measured with Annexin V assay and flow cytometry. The incidence of apoptosis either or both of HBx and MIF transfected cells was elevated compared with cells transfected with vector plasmid. MIF transfection just increases the incidence of apoptosis slightly. However, HBx and MIF cotransfection can decrease the incidence of apoptosis compared with HBx transfection alone (Fig. 6). These results implied that both HBx and MIF increase the incidence of apoptosis while MIF suppresses the apoptotic effect of HBx through direct interaction. Discussion Here, we demonstrate for the first time that HBx interacts with macrophage migration inhibition factor (MIF).
The physical interaction has been validated by a number of in vitro and in vivo assays. First, the nucleotide sequence of MIF was isolated from the positive transformants of yeast two-hybrid. Second, the repeated yeast two-hybrid assay and GST pull-down all verified that HBx is physically associated with MIF. The interacting domains of MIF and HBx were also located through yeast two-hybrid. Third, full-length MIF was co-immunoprecipitated with HBx from cell lysate of 293 cells and HepG2 cells. Fourth, confocal assay further confirmed the interaction between HBx and MIF in transfected cells. HBx has been the focus of much attention in the past few years since its role is strongly implicated in hepatocarcinogenesis. More and more HBx interacting proteins were identified, including factors related to transcription [7,19, 17,3], proteasome subunit [31], mitochondrial proteins [28], and so on. Several kinase signal pathways were also reported to be modulated by HBx, either directly through HBx-associated factors, or indirectly. However, the precise role of HBx remained elusive, some results even controver-
678
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679
sial. This may reflect the properties of HBx itself which means it is a multifunctional protein. The role of HBx in cell death pathways has been addressed in many systems and varying results were reported depending on different cell types. The apoptotic effect of HBx was reported dependent on the cellular status of p53 [1] or independent of it [27]. Here, we demonstrated the apoptotic effects of HBx on HepG2 cell, but its dependence on p53 was not verified. Migration inhibitory factor (MIF), classically defined as an inflammatory cytokine, has recently begun to be thought of as a pro-tumorigenic factor [24]. Its overexpression has been reported in various tumors, including hepatocellular carcinoma [22,13,21,2]. Furthermore, overexpression of MIF induces angiogenesis and deteriorates prognosis after resection for hepatocellular carcinoma [12]. The mechanism of MIF was reported that it can inhibit the function of p53 and thus suppress cell apoptosis in macrophage [25]. MIF also interferes with the Rb-E2F signal pathway [26]. Our work also revealed the expression of MIF in HepG2 cells and was up-regulated in 2.2.15 cells producing HBV particles while HBx transfection cannot up-regulate MIF. HepG2 cells transfected with MIF resulted in G0/G1 phase arrest, decreased cell viability, and increased cell apoptosis (Figs. 5 and 6). These results indicated that MIF is involved in other signal pathways or its function depends on different cell types. The subcellular localization of HBx has been controversial, but the general consensus is that most HBx is in cytoplasm, with a small fraction in the nucleus, especially when HBx is expressed ecotropically in cells [11]. In this paper, HBx was fused with EGFP, RFP, and myc to study the influence of the different tag on the cellular localization. As shown in Fig. 4, myc-HBx, HBx-EGFP, and HBxRFP distribute similarly in HepG2 cells, which meant that different tags do not influence the cellular localization of HBx. MIF-EGFP localized almost in all parts of the cell which is consistent with fluorescence staining. Our study found the new HBx interaction protein MIF and it can suppress the apoptotic effect of HBx. This can be explained in two aspects according to the dual effects of HBx, apoptotic and proliferation stimulation. First, HBx stimulates the cell proliferation through direct interaction with MIF to counteract its apoptotic effect. This apoptotic effect of HBx was initiated through direct interaction with other molecules, such as p53 [10]. Second, the apoptotic effect of HBx was suppressed by interacting with MIF. The interaction between HBx and MIF competitively inhibits the apoptotic domain of HBx. As mentioned above, the apoptotic effect of HBx relates to p53 [1,27] and MIF also participate in Rb-E2F [26] and p53 [25] signal pathway. The most possible pathway is that HBx interfere with p53 and Rb-E2F signal pathway through interaction with MIF. But this should be elucidated in later work. Since hepatocellular carcinoma formation has been associated with HBV chronic inflammatory conditions, the relationship between the inflammation and tumor development remains largely obscure at a molecular level.
To find a novel thing is better than to deepen the finding. Our study may shed some light on this formidable problem. Acknowledgments This work is supported by a grant from the National Basic Research Program of China (2004CB518904, 2005CB522902) and a grant from the National Nature Science Foundation of China (No.30530650). References [1] J.Y. Ahn, E.Y. Jung, H.J. Kwun, C.W. Lee, Y.C. Sung, K.L. Jang, Dual effects of hepatitis B virus X protein on the regulation of cellcycle control depending on the status of cellular p53, J. Gen. Virol. 83 (2002) 2765–2772. [2] S.M. Akbar, M. Abe, H. Murakami, K. Tanimoto, T. Kumagi, Y. Yamashita, et al., Macrophage migration inhibitory factor in hepatocellular carcinoma and liver cirrhosis; relevance to pathogenesis, Cancer Lett. 171 (2001) 125–132. [3] O. Barak, A. Aronheim, Y. Shaul, HBV X protein targets HIV Tatbinding protein 1, Virology 283 (2001) 110–120. [4] B.R. Bloom, B. Bennett, Mechanism of a reaction in vitro associated with delayed-type hypersensitivity, Science 153 (1966) 80–82. [5] T. Calandra, J. Bernhagen, C.N. Metz, L.A. Spiegel, M. Bacher, T. Donnelly, et al., MIF as a glucocorticoid-induced modulator of cytokine production, Nature 377 (1995) 68–71. [6] T. Calandra, B. Echtenacher, D.L. Roy, J. Pugin, C.N. Metz, L. Hultner, et al., Protection from septic shock by neutralization of macrophage migration inhibitory factor, Nat. Med. 6 (2000) 164–170. [7] J.H. Cheong, M. Yi, Y. Lin, S. Murakami, Human RPB5, a subunit shared by eukaryotic nuclear RNA polymerases, binds human hepatitis B virus X protein and may play a role in X transactivation, EMBO J. 14 (1995) 143–150. [8] J.R. David, Delayed hypersensitivity in vitro: its mediation by cellfree substances formed by lymphoid cell-antigen interaction, Proc. Natl. Acad. Sci. USA 56 (1966) 72–77. [9] S.C. Donnelly, C. Haslett, P.T. Reid, I.S. Grant, W.A. Wallace, C.N. Metz, et al., Regulatory role for macrophage migration inhibitory factor in acute respiratory distress syndrome, Nat. Med. 3 (1997) 320–323. [10] L.W. Elmore, A.R. Hancock, S.F. Chang, X.W. Wang, S. Chang, C.P. Callahan, et al., Hepatitis B virus X protein and p53 tumor suppressor interactions in the modulation of apoptosis, Proc. Natl. Acad. Sci. USA 94 (1997) 14707–14712. [11] F. Henkler, J. Hoare, N. Waseem, R.D. Goldin, M.J. McGarvey, R. Koshy, et al., Intracellular localization of the hepatitis B virus HBx protein, J. Gen. Virol. 82 (2001) 871–882. [12] E. Hira, T. Ono, D.K. Dhar, O.N. El-Assal, Y. Hishikawa, A. Yamanoi, et al., Overexpression of macrophage migration inhibitory factor induces angiogenesis and deteriorates prognosis after radical resection for hepatocellular carcinoma, Cancer 103 (2005) 588–598. [13] A. Kamimura, M. Kamachi, J. Nishihira, S. Ogura, H. Isobe, H. Dosaka-Akita, et al., Intracellular distribution of macrophage migration inhibitory factor predicts the prognosis of patients with adenocarcinoma of the lung, Cancer 89 (2000) 334–341. [14] C.M. Kim, K. Koike, I. Saito, T. Miyamura, G. Jay, HBx gene of hepatitis B virus induces liver cancer in transgenic mice, Nature 351 (1991) 317–320. [15] H.Y. Lan, M. Bacher, N. Yang, W. Mu, D.J. Nikolic-Paterson, C. Metz, et al., The pathogenic role of macrophage migration inhibitory factor in immunologically induced kidney disease in the rat, J. Exp. Med. 185 (1997) 1455–1465.
S. Zhang et al. / Biochemical and Biophysical Research Communications 342 (2006) 671–679 [16] H.Y. Lan, N. Yang, C. Metz, W. Mu, Q. Song, D.J. NikolicPaterson, et al., TNF-alpha up-regulates renal MIF expression in rat crescentic glomerulonephritis, Mol. Med. 3 (1997) 136–144. [17] E. Lara-Pezzi, A.L. Armesilla, P.L. Majano, J.M. Redondo, M. Lopez-Cabrera, The hepatitis B virus X protein activates nuclear factor of activated T cells (NF-AT) by a cyclosporin A-sensitive pathway, EMBO J. 17 (1998) 7066–7077. [18] T.H. Lee, M.J. Finegold, R.F. Shen, J.L. DeMayo, S.L. Woo, J.S. Butel, Hepatitis B virus transactivator X protein is not tumorigenic in transgenic mice, J. Virol. 64 (1990) 5939–5947. [19] S.W. Lee, Y.M. Lee, S.K. Bae, S. Murakami, Y. Yun, K.W. Kim, Human hepatitis B virus X protein is a possible mediator of hypoxiainduced angiogenesis in hepatocarcinogenesis, Biochem. Biophys. Res. Commun. 268 (2000) 456–461. [20] Y. Lin, T. Nomura, T. Yamashita, D. Dorjsuren, H. Tang, S. Murakami, The transactivation and p53-interacting functions of hepatitis B virus X protein are mutually interfering but distinct, Cancer Res. 57 (1997) 5137–5242. [21] J.M. Markert, C.M. Fuller, G.Y. Gillespie, J.K. Bubien, L.A. McLean, R.L. Hong, et al., Differential gene expression profiling in human brain tumors, Physiol. Genomics 5 (2001) 21–33. [22] K. Meyer-Siegler, P.B. Hudson, Enhanced expression of macrophage migration inhibitory factor in prostatic adenocarcinoma metastases, Urology 48 (1996) 448–452. [23] A. Mikulowska, C.N. Metz, R. Bucala, R. Holmdahl, Macrophage migration inhibitory factor is involved in the pathogenesis of collagen type II-induced arthritis in mice, J. Immunol. 158 (1997) 5514–5517.
679
[24] R.A. Mitchell, R. Bucala, Tumor growth-promoting properties of macrophage migration inhibitory factor (MIF), Semin. Cancer Biol. 10 (2000) 359–366. [25] R.A. Mitchell, H. Liao, J. Chesney, G. Fingerle-Rowson, J. Baugh, J. David, et al., Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory function by inhibiting p53: regulatory role in the innate immune response, Proc. Natl. Acad. Sci. USA 99 (2002) 345–350. [26] O. Petrenko, U.M. Moll, Macrophage migration inhibitory factor MIF interferes with the Rb-E2F pathway, Mol. Cell 17 (2005) 225–236. [27] Y. Shintani, H. Yotsuyanagi, K. Moriya, H. Fujie, T. Tsutsumi, Y. Kanegae, et al., Induction of apoptosis after switch-on of the hepatitis B virus X gene mediated by the Cre/loxP recombination system, J. Gen. Virol. 80 (1999) 3257–3265. [28] S. Takada, Y. Shirakata, N. Kaneniwa, K. Koike, Association of hepatitis B virus X protein with mitochondria causes mitochondrial aggregation at the nuclear periphery, leading to cell death, Oncogene 18 (1999) 6965–6973. [29] Y. Wang, F. Cui, Y. Lv, C. Li, X. Xu, C. Deng, et al., HBsAg and HBx knocked into the p21 locus causes hepatocellular carcinoma in mice, Hepatology 39 (2004) 318–324. [30] S.M. Zhang, D.C. Sun, S.K. Lou, X.C. Bo, Z. Lu, X.H. Qian, et al., HBx protein of hepatitis B virus (HBV) can form complex with mitochondrial HSP60 and HSP70, Arch. Virol. 150 (2005) 179–190. [31] Z. Zhang, N. Torii, A. Furusaka, N. Malayaman, Z. Hu, T.J. Liang, Structural and functional characterization of interaction between hepatitis B virus X protein and the proteasome complex, J. Biol. Chem. 275 (2000) 15157–15165.