Magnitude of Therapeutic STING Activation Determines CD8+ T Cell-Mediated Anti-tumor Immunity

Article

Magnitude of Therapeutic STING Activation Determines CD8+ T Cell-Mediated Anti-tumor Immunity Graphical Abstract

Authors Kelsey E. Sivick, Anthony L. Desbien, Laura Hix Glickman, ..., Andrea van Elsas, Thomas W. Dubensky, Jr., Sarah M. McWhirter

Correspondence [email protected]

In Brief Intratumoral STING pathway activation is a promising therapeutic approach to treat cancer. While high doses of STING agonist are effective at clearing injected tumors, Sivick et al. find that lower doses of STING agonist are optimal for generating robust systemic tumorspecific T cell responses and durable anti-tumor immunity.

Highlights d

Dose of intratumoral STING agonist dictates expansion of tumor-specific T cells

d

Lower immunogenic dosing regimens elicit durable tumor control via CD8+ T cells

d

Higher tumor ablative dosing regimens compromise durable anti-tumor immunity

d

Immunogenic dosing is ideal for checkpoint inhibitor combination therapy

Sivick et al., 2018, Cell Reports 25, 3074–3085 December 11, 2018 ª 2018 Aduro Biotech, Inc. https://doi.org/10.1016/j.celrep.2018.11.047

Cell Reports

Article Magnitude of Therapeutic STING Activation Determines CD8+ T Cell-Mediated Anti-tumor Immunity Kelsey E. Sivick,1,8 Anthony L. Desbien,1,8 Laura Hix Glickman,1,4,8 Gabrielle L. Reiner,1,8 Leticia Corrales,1 Natalie H. Surh,1 Thomas E. Hudson,1,5 Uyen T. Vu,1,6 Brian J. Francica,1 Tamara Banda,1 George E. Katibah,1 David B. Kanne,1 Justin J. Leong,1 Ken Metchette,1 Jacob R. Bruml,1 Chudi O. Ndubaku,1 Jeffrey M. McKenna,2 Yan Feng,2 Lianxing Zheng,2 Steven L. Bender,3 Charles Y. Cho,3 Meredith L. Leong,1 Andrea van Elsas,1 Thomas W. Dubensky, Jr.,1,7,9 and Sarah M. McWhirter1,9,10,* 1Aduro

Biotech, Inc., Berkeley, CA 94710, USA Institutes for BioMedical Research, Cambridge, MA 02139, USA 3Genomics Institute of the Novartis Research Foundation, San Diego, CA 92121, USA 4Present address: Actym Therapeutics, Inc., Berkeley, CA 94710, USA 5Present address: Gilead Sciences, Inc., Foster City, CA 94404, USA 6Present address: Touro University Nevada, Henderson, NV 89014, USA 7Present address: Tempest Therapeutics, San Francisco, CA 94104, USA 8These authors contributed equally 9These authors contributed equally 10Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.celrep.2018.11.047 2Novartis

SUMMARY

Intratumoral (IT) STING activation results in tumor regression in preclinical models, yet factors dictating the balance between innate and adaptive anti-tumor immunity are unclear. Here, clinical candidate STING agonist ADU-S100 (S100) is used in an IT dosing regimen optimized for adaptive immunity to uncover requirements for a T cell-driven response compatible with checkpoint inhibitors (CPIs). In contrast to highdose tumor ablative regimens that result in systemic S100 distribution, low-dose immunogenic regimens induce local activation of tumor-specific CD8+ effector T cells that are responsible for durable anti-tumor immunity and can be enhanced with CPIs. Both hematopoietic cell STING expression and signaling through IFNAR are required for tumor-specific T cell activation, and in the context of optimized T cell responses, TNFa is dispensable for tumor control. In a poorly immunogenic model, S100 combined with CPIs generates a survival benefit and durable protection. These results provide fundamental mechanistic insights into STING-induced anti-tumor immunity. INTRODUCTION Induction of tumor-specific CD8+ T cell responses can limit tumor progression; however, CD8+ T cell responses are often evaded or otherwise suppressed, leading to tumor outgrowth (Sharma et al., 2017). The use of checkpoint inhibitors (CPIs) such as cytotoxic T lymphocyte-associated protein 4 (CTLA4) or programmed death protein 1 (PD-1) can incite tumor regression and durable responses in patients (Ribas and Wolchok,

2018; Sharma and Allison, 2015). Nevertheless, many patients are refractory to or eventually relapse after checkpoint immunotherapy, necessitating the search for new strategies to boost anti-tumor T cell responses. Stimulator of interferon genes (STING) is required for the spontaneous generation of tumor-specific T cell responses (Corrales et al., 2016). Natural engagement of STING occurs downstream of cytoplasmic DNA recognition via cyclic guanosine monophosphate (GMP)-AMP (cGAMP) synthetase (cGAS) and generation of the cyclic dinucleotide (CDN) STING ligand 20 30 cGAMP. After CDN binding by STING, IRF3- and nuclear factor kB (NF-kB)dependent cytokines are induced (Chen et al., 2016). Based on the critical role of the STING pathway in the induction of anti-tumor immunity, CDNs are being explored as a cancer therapy (Corrales et al., 2016; Ng et al., 2018). The STING agonist dithio-(RP, RP)-[cyclic[A(20 ,50 )pA(30 ,50 )p]] (also known as ML RRS2 CDA, MIW815, or ADU-S100 [S100]) was developed with rational chemical modifications of natural STING ligands to enhance stability and facilitate activation of all five common human STING alleles (Corrales et al., 2015; Yi et al., 2013), differentiating this compound from others prevalent in the literature. As a single agent, intratumoral (IT) injection of S100 shows potent anti-tumor effects in multiple syngeneic mouse tumor models (Corrales et al., 2015; Foote et al., 2017; Francica et al., 2018) and is under clinical investigation (NCT: NCT02675439 and NCT03172936). Prior preclinical studies investigating STING-mediated antitumor response reported tumor necrosis factor alpha (TNFa)mediated injected tumor clearance (Baird et al., 2016; Francica et al., 2018). Using the clinical compound S100, we explore the mechanistic basis for CD8+ T cell-dependent tumor eradication mediated by IT CDN therapy. We report that the dose of STING agonist affects local activation and systemic expansion of tumor-specific CD8+ T cells in implanted flank mouse models. By exploring different dosing regimens, we establish that repetitive and/or relatively high doses of S100, while effective in

3074 Cell Reports 25, 3074–3085, December 11, 2018 ª 2018 Aduro Biotech, Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Figure 1. IT STING Activation Can Be Modulated to Induce Local versus Systemic Immune Activation (A) Mice bearing a single-flank 4T1 tumor received three IT injections of vehicle alone or 50, 100, or 500 mg S100. Seven days after the third injection, peripheral blood mononuclear cells (PBMCs) were stimulated with AH1 peptide and assessed by IFNg enzyme-linked immunospot (ELISPOT). (B) Mice bearing a single-flank 4T1 tumor received one (13), two (23), or three (33) IT injections of vehicle alone or 50 mg S100 on day 8. Seven days after the last injection in each group (day 15 [13], 17 [23], or 21 [33]), splenocytes were stimulated with AH1 peptide and assessed by IFNg ELISPOT. (C and D) Mice bearing a single-flank 4T1 tumor received one IT injection of vehicle alone or 1, 10, 100, or 500 mg S100 (arrow). (C) Mean injected tumor growth over time with the fraction of cured mice indicated in the legend.

(legend continued on next page)

Cell Reports 25, 3074–3085, December 11, 2018 3075

clearing the injected tumor, can diminish tumor-specific T cell responses, negatively affecting durable immunity. Data herein propose a paradigm for STING-driven anti-tumor immunity that necessitates fine-tuning of tumoral STING activation to facilitate interferon (IFN)-driven T cell activation that can synergize with CPIs. RESULTS IT STING Activation Can Be Modulated to Induce Local versus Systemic Immune Activation To optimize the immune response to IT administration of S100, the impact of dose level on the generation of tumor-specific T cells was investigated. Mice bearing a single 4T1 mammary carcinoma flank tumor were treated intratumorally with different doses of S100 three times over the course of one week. Seven days after the third injection, mice treated with 50 mg demonstrated significantly increased tumor-specific T cell responses in peripheral blood, whereas mice treated with vehicle, 100 mg, or 500 mg S100 did not (p = 0.0006) (Figure 1A). Because we and others have used multiple-injection STING agonist dosing regimens to achieve tumor clearance (Baird et al., 2016, 2017; Corrales et al., 2015; Demaria et al., 2015; Deng et al., 2014; Foote et al., 2017; Francica et al., 2018), the impact of dose frequency on induction of tumor-specific T cell responses was also tested. A single 50 mg dose elicited the highest T cell response, while dosing mice repeatedly resulted in significantly lower responses (p = 0.0008 versus 23, p < 0.0001 versus 33) (Figure 1B). Thus, in mice bearing a single 4T1 tumor, induction of tumor-specific T cells inversely correlated with S100 dose level. To refine the relationship between the dose of S100 and the antitumor response, we titrated the dose of a single S100 IT injection in tumor-bearing mice, comparing acute serum cytokine levels, systemic T cell responses, and primary tumor clearance. Serum cytokine levels and primary tumor clearance correlated with dose level, while the frequency of tumor-specific T cells was highest at the 10 mg dose of S100 and was diminished with higher doses (Figures 1C, 1D, and S1A). This pattern was recapitulated in the B16.SIY model (Figure S1B) (data not shown). While the relationship between dose and cytokine production

or injected tumor clearance was roughly linear, the relationship between dose and tumor-specific T cell responses yielded a bell-shaped curve, suggesting that engaging STING with the primary goal of injected tumor clearance leads to selecting a higher-dose regimen than is optimal for the formation of T cell responses. Because IT treatment of STING agonist controls both injected and non-injected tumors (Ager et al., 2017; Corrales et al., 2015; Demaria et al., 2015; Foote et al., 2017), we next investigated the effect of dose on immune activation at injected and distal sites. A fundamental question associated with distal tumor activity of STING agonists in mice is whether efficacy in non-injected tumors is attributable to adaptive-mediated immune processes initiated in the injected tumor or to systemic spread of compound that then acts directly in distal tumors. 1 hr after IT administration, we analyzed tumor-resident immune cells for responses to S100. Monocytes from the injected tumor were the predominant cell type producing prototypical STING pathway cytokines TNFa and IFNb (Figure 1E). As the dose of S100 increased, so did the frequency of cytokine-positive monocytes and the diversity of responding cell types in the injected tumor (Figures 1E and S1C). This pattern of cytokine responsiveness is consistent with monocytic cells being more sensitive to STING activation when compared to lymphocyte subsets, correlating with the level of STING expression in these subsets (Heng et al., 2008; Sivick et al., 2017; Wu et al., 2009). In addition, we found that the 500 mg S100 dose produced increased frequencies of TNFa+ (p < 0.0001) and IFNb+ (p = 0.0108) monocytes in distal tumors (Figure 1E). The rapidity with which non-injected tumor cells responded to the 500 mg dose suggests that S100 was directly accessing distal sites. Pharmacokinetic (PK) analyses by mass spectrometry at 30 min after dosing confirmed that significant amounts of S100 were found in distal tumors at the 500 mg dose (134.2 ng/mL ± 29.62), reaching a concentration on the same order of magnitude as tumors injected with 10 mg (923.8 ng/mL ± 371.4) (Figure 1F). Thus, administration of low-dose S100 caused local STING activation primarily in monocytic cell lineages and a lack of detectable compound in non-injected tumors, whereas administration of high-dose

(D) Seven days post-injection, PBMCs from each mouse were assessed for the frequency of CD8+ H-2Ld-AH1 Tetramer+ (AH1+) cells by flow cytometry. Shown are the dot plots of CD90.2+ CD8+ T cells stained for AH1 and Ki-67 (top) and data quantitation for the bulk AH1+ population (bottom). (E–J) Mice bearing dual-flank 4T1 tumors received one IT injection (in the right flank tumor) with vehicle alone or indicated doses of S100. (E) 1 hr post-injection , both tumors were dissociated and incubated for an additional 4 hr in the presence of Golgi inhibitors for intracellular cytokine staining (ICS) and flow cytometry. Shown are the dot plots of CD11b+Ly-6Chi monocytes stained for TNFa and IFNb (top) and data quantitation (bottom). (F) 30 min post-injection, S100 levels in the injected and distal tumors were quantitated by liquid chromatography-tandem mass spectrometry (LC-MS/MS). The gray dashed line represents the lower limit of detection multiplied by a dilution factor of five (5 ng/mL). (G–I) Three days post-injection, TDLN cells from the injected and distal sides were stained and interrogated by flow cytometry. (G) Dot plots of AH1+ T cells stained for CD25 and Ki-67 (top) and data quantitation (bottom). (H) CD11c-, granzyme B (GrzB)-, or Tbet-positive frequencies on CD8+AH1+ cells in the TDLN of mice injected with vehicle or 10 mg S100. (I) Total numbers of bulk CD8+ T cells in the injected TDLN. (J) One day post-injection, TDLNs from the injected and distal sides were mounted and stained with Hematoxylin and Eosin (H&E) for histopathological characterization or cleaved caspase-3 (CC3) by IHC. Shown are representative H&E images (top) and automated quantitation of CC3 IHC staining (bottom) (n = 4–5 nodes/group). Vehicle: (A) apoptosis in germinal center within normal levels; 10 mg S100: (A) minimal increased apoptosis in germinal center; 500 mg S100: (A) increased apoptosis, (D) decreased cellularity, and (H) increased histiocytes; scale bar, 200 mm. Data are representative of at least two independent experiments, with n = 5–8 animals/group. Error lines or bars represent the mean ± SEM, and each symbol in bar graphs represents an individual animal. Unless indicated otherwise, significance shown above each bar is compared to vehicle control. ns, not significant; V, vehicle; SFC, spot-forming cells; TDLN, tumor-draining lymph node. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S1.

3076 Cell Reports 25, 3074–3085, December 11, 2018

S100 resulted in the presence of CDN and cellular activation at distal sites. To expand our analysis of local versus systemic immune stimulation, T cell activation in both injected and distal tumor-draining lymph nodes (TDLNs) was analyzed three days after IT injection of 10, 100, or 500 mg S100. Activated tumor-specific T cells were found in the injected-side TDLN of mice treated with 10 mg (p = 0.0011) or 100 mg (p = 0.0022) S100, as shown by CD25 and Ki-67 staining on CD8+AH1+ T cells (Figures 1G and S1D). Tumor-specific CD8+ T cells increased expression of CD11c, granzyme B (GrzB), and Tbet (p < 0.001) (Figures 1H and S1D)—activation markers matching the profile of effector T cells (Pauken et al., 2016). Consistent with the observed pattern of immunogenicity at day 7 in the blood, there was a lack of T cell activation in the injected TDLN of mice treated with 500 mg S100 (p = not significant [ns]) and a reduction in the total number of CD8+ T cells (p = 0.0034) (Figures 1G and 1I). Meanwhile, activated T cells were detected in the non-injected TDLN of mice treated with 500 mg S100 (p < 0.0001), consistent with an immunogenic dose reaching distal sites (Figure 1G). Because the mouse-specific STING agonist DMXAA has been characterized as a vascular disrupting agent (Baguley and Ching, 1997), one hypothesis for the lack of local T cell activation with higher doses of S100 is that hyperactivation of STING results in tissue damage that prevents T cell trafficking and activation. As an alternative or in addition, cell death could be playing a role, because there are several reports regarding STING activation in connection with various anti-proliferative pathways (Cerboni et al., 2017; Chandra et al., 2014; Gaidt et al., 2017; Gulen et al., 2017; Larkin et al., 2017; Tang et al., 2016; Wu et al., 2014). To characterize the circumstances leading to dose-dependent inhibition of T cell responses, TDLNs were subjected to immunohistochemical (IHC) and histopathological analyses 24 hr post-IT injection with 10 or 500 mg S100. Injected-side TDLN from mice treated with 10 mg S100 exhibited minimal apoptosis in follicle germinal centers (Figure 1J). Conversely, injected-side TDLN from mice treated with 500 mg S100 had moderate to marked increases in apoptosis and decreases in cellularity in different regions of the node, accompanied by increased macrophages in the medullary and paracortical sinus. IHC for cleaved caspase-3 (CC3) showed a dramatic increase in staining in injected TDLN from mice receiving IT injections of 500 mg S100, but not in distal TDLN or TDLN from mice injected with 10 mg S100 (Figures 1J and S1E). The dramatic reduction in cellularity and increased CC3 positivity were confirmed by flow cytometry (Figure S1E). These results imply that in a mouse with a single-flank tumor, the absence of T cell expansion with either comparatively high or repetitive doses of S100 was due to a lack of T cell activation in the TDLN, presumably due to overt cell death and a compromised infrastructure. Henceforth, we will refer to IT STING activation that can elicit T cell expansion in a single-flank setting as ‘‘immunogenic’’ and IT STING activation that can collapse injected tumors but poorly expand T cells as ‘‘ablative.’’ These experiments also suggest that in a scenario in which immunogenic doses are distributed to a distal, noninjected tumor site, systemic T cell responses would be preserved during ablative dosing, which is indeed the case (p < 0.0001) (Figure S1F).

CD8+ T Cells Are Necessary and Sufficient for Antitumor Immunity Elicited by Immunogenic Doses of S100 To determine the role of S100-induced CD8+ T cells in tumor control afforded by immunogenic or ablative dosing, mice bearing 4T1 dual-flank tumors were depleted of CD8+ T cells before and after IT injection with S100 (Figure S2A). CD8+ T cell depletion prevented the control of injected tumors afforded by an immunogenic dose of S100 (45.7% difference in mean tumor reduction in 10 mg isotype versus aCD8-treated mice, p = 0.0009) (Figures 2A and S2B). Consistent with our hypothesis that an ablative dose of S100 would eradicate injected tumors independent of cytotoxic T cells, CD8+ T cells were largely dispensable for injected tumor control following ablative dosing (14.6% difference in mean tumor reduction in 500 mg isotype versus aCD8-treated mice, p = ns) (Figures 2A and S2B). In keeping with systemic compound distribution (Figure 1F) and relocation of CD8+ T cell activation to the lymph node (LN) draining the non-injected tumor during ablative dosing, CD8+ T cells significantly contributed to distal tumor control after injection of 500 mg S100 (61.7% difference in mean tumor reduction in 500 mg isotype versus aCD8-treated mice, p < 0.0001) (Figures 2A and S2B). To investigate whether S100 could elicit durable tumorspecific T cell responses, we rechallenged mice that were cured of their primary tumor with S100 treatment. Mice were given aCD8-depleting or isotype control antibodies, followed by rechallenge with 4T1 tumor cells. In this experiment, a 1 3 100 mg dose was used to increase the cure rate while maintaining some immunogenicity (Figure 1D). Compared to naive mice, S100-cured mice were significantly protected from tumor rechallenge, and this protection depended on CD8+ T cells (p < 0.0001) (Figure 2B). To examine the effect of dose on protection from rechallenge, mice bearing single- or dual-flank 4T1 tumors were injected with different dosing regimens. Consistent with our findings that ablative dose regimens inhibit tumorspecific T cell responses, mice that cured single-flank tumors with the highest dosing regimen (3 3 500 mg S100) had significantly less protection from rechallenge than mice that received lower dosing regimens (p < 0.0001 versus 3 3 50 mg or 3 3 100 mg) (Figure 2C). Mice cured of dual-flank 4T1 tumors by a 3 3 500 mg treatment regimen were protected from rechallenge (8/8 cures), consistent with distribution of immunogenic S100 doses that can elicit durable T cell immunity (p < 0.0001 versus 3 3 500 mg SF) (Figure S1F). An appreciable number of mice (6/8) curing primary tumors after 1 3 500 mg S100 were also protected from rechallenge (p < 0.0001 versus naive), though clearance appeared delayed compared to lower dosing regimens (Figures 2C and S2C). We attribute protection in the ablative dosing groups to the preexisting pool of tumor-specific T cells resulting from implantation of highly immunogenic 4T1 tumor cells (Figures 1A, 1B, and 1D, vehicle groups). Consistent with this rationale, we have observed that resection of 4T1 tumors treated with vehicle alone in a survival surgery setting resulted in significant protection against rechallenge (6/8 in one experiment) (data not shown). Protective immunity afforded by immunogenic or ablative doses of S100 was also tested in an adoptive transfer setting. Supporting the hypothesis that 4T1 tumor-bearing mice harbor

Cell Reports 25, 3074–3085, December 11, 2018 3077

Figure 2. CD8+ T Cells Are Necessary and Sufficient for Anti-tumor Immunity Elicited by Immunogenic Doses of S100 (A) Mice bearing dual-flank 4T1 tumors were injected via the intraperitoneal (IP) route with 100 mg aCD8 (right) or isotype control (left) on days 6, 8, 10, 14, and 17, with one IT injection (in the right flank tumor) of vehicle alone or indicated doses of S100 (arrow). Shown is the mean injected (top) or distal (bottom) tumor growth over time (significance on day 21). (B) Mice bearing a single-flank 4T1 tumor received one IT injection of vehicle alone or 100 mg S100 on day 12. Along with naive controls, mice that cured their primary tumors were injected via the IP route with 100 mg aCD8 (n = 12) or isotype control (n = 11) on days 4 and 2 before implantation with 5 3 105 4T1 tumor cells. Shown is the mean rechallenge tumor growth over time (significance on day 25), with the fraction of cured mice indicated in the legend. (C) Mice bearing single- or dual-flank 4T1 tumors received one (13) or three (33) IT injections of 50, 100, or 500 mg S100. Along with naive controls, mice that cured their primary tumors were implanted with 1 3 106 4T1 tumor cells. Shown is the mean rechallenge tumor growth over time (significance on day 21), with the fraction of cured mice indicated in the legend. (D) Donor mice bearing a single-flank 4T1 tumor received one IT injection of vehicle alone or 10, 50, or 500 mg S100 on day 9. Seven days post-IT injection, bulk splenocytes or negatively enriched CD8+ cells from donor mice were transferred to naive recipients. Certain cohorts of donor mice were injected via the IP route with 100 mg aCD8 on day 2 and 1 before spleen harvest. One day post-adoptive transfer, naive recipients (n = 5) were implanted with 5 3 105 4T1 cells. Shown is the mean tumor growth in recipient mice over time (significance on day 26 on left or day 22 on right), with the fraction of cured mice indicated in the legend. Except for the 500 mg groups in (D), data are representative of at least two independent experiments, with n = 8 animals/group unless indicated otherwise. Error lines represent the mean ± SEM. Unless indicated otherwise, significance is compared to naive control. ns, not significant; SF, single flank; DF, dual flank. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S2.

3078 Cell Reports 25, 3074–3085, December 11, 2018

to protective anti-tumor immunity, as these data reveal that both immunogenic and ablative dosing can delay tumor growth independent of CD8+ T cells (Figures 2B and 2D). Nonetheless, these results show that a predominant amount of protective immunity afforded by an immunogenic dose of S100 is driven by CD8+ T cells, and this protection can be compromised by excessive IT STING activation.

Figure 3. Role of Hematopoietic versus Non-hematopoietic Cells in Anti-tumor and Cytokine Responses Bone marrow cells from wild-type (WT) C57BL/6 or goldenticket (Gt) mice lacking functional STING were transferred into irradiated WT or Gt recipient mice, resulting in four sets of bone marrow chimeric mice: WT/WT (circles), Gt/WT (triangles), WT/Gt (inverted triangles), and Gt/Gt (squares). Following reconstitution, recipient mice bearing a single B16.SIY STING/ flank tumor received one IT injection with vehicle alone or 1 mg S100 on day 8. (A) Seven days post-injection, splenocytes were stimulated with SIY peptide and assessed by IFNg ELISPOT. (B) 6 hr post-injection, serum cytokines were measured. Error bars represent the mean ± SEM, and each symbol represents an individual animal. Data are representative of two independent experiments, with n = 10 animals/group. ns, not significant; V, vehicle; SFC, spot-forming cells. **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S3.

an appreciable population of tumor-specific T cells, naive recipient mice receiving CD8+-enriched cells from vehicle-treated donor animals exhibited a significant delay in tumor growth, although all mice eventually grew tumors (p % 0.001 versus no transfer) (Figure 2D). Transfers of either CD8+-enriched or bulk splenocytes depleted of CD8+ T cells from donor mice given an immunogenic dose of S100 demonstrated CD8+ T celldependent prevention of tumors (S100 50 mg CD8+ enriched: p = 0.0072 versus vehicle CD8+ enriched, 4/5 mice tumor free; S100 10 mg + isotype [iso]: p < 0.0001 versus vehicle + iso, p = 0.0052 versus S100 10 mg + aCD8) (Figure 2D). Conversely, splenocytes transferred from donor mice given ablative doses of S100 did not (p = 0.0002 versus vehicle + iso, p = ns versus S100 500 mg + aCD8) (Figure 2D). Multiple mechanisms can contribute

Role of Hematopoietic versus Non-hematopoietic Cells in Anti-tumor and Cytokine Responses To understand the contribution of the hematopoietic and stromal compartments in formation of CD8+ T cell anti-tumor immunity driven by immunogenic doses of S100, bone marrow chimeric mice were generated using wild-type (WT) C57BL/6 and goldenticket (Gt) animals that lack functional STING (Sauer et al., 2011), creating WT marrow/WT mice, Gt marrow/WT mice, WT marrow/Gt mice, and Gt marrow/Gt mice. At 13 weeks post-transplant, chimerism in recipient mice approached 100% for CD11b+ cells and 80%–90% for CD4+ and CD8+ T cells (Figure S3A). The resulting sets of mice were implanted with autologous B16.SIY tumor cells lacking STING (B16.SIY STING/, to negate any contribution of tumor-associated STING signaling) and treated with an immunogenic dose of S100 (Figures S1B and S3B). At seven days post-IT, WT/WT mice had significantly increased numbers of SIY-specific IFNg-secreting cells compared to vehicle controls (p = 0.0004) (Figure 3A). T cell responses in Gt/WT mice injected with S100 were low, similar to those of Gt/Gt mice, while responses in WT/Gt mice were similar to those of WT/WT animals (Figure 3A). Proinflammatory serum cytokine responses detected 6 hr after injection also largely depended on STING signaling in the hematopoietic compartment, though radio-resistant cells appeared to contribute, because WT/Gt mice did not fully recapitulate TNFa and MCP1 levels observed in WT/WT mice (p < 0.0001) (Figure 3B). Thus, STING signaling in the hematopoietic compartment contributes to the acute serum cytokine response and is sufficient for S100-mediated boosting of the tumor-specific T cell response. Type I IFN, but Not TNFa, Is Required for Optimal Antitumor Immune Responses in an Immunogenic Setting CDN IT injection induces both local and systemic cytokines (Figures 1E and S1A), but the cytokine contribution toward immunogenicity is unclear. To explore the role of TNFa, mice bearing established B16.SIY tumors were dosed with TNFa-neutralizing or isotype control antibodies before IT treatment with an immunogenic dose of S100. As expected, treatment with TNFa-neutralizing antibody resulted in a significant reduction in systemic levels of TNFa, but it also showed a reduction in MCP1 and interleukin-6 (IL-6) (p < 0.0001) (Figure S4A). In contrast to tumor models in which repeated dosing of IT STING agonist is required for tumor ablation in a TNFa-dependent manner (Baird et al., 2016; Francica et al., 2018), blocking TNFa here did not affect tumor clearance (Figure 4A). To determine the contribution of type I IFN during immunogenic S100 treatment, mice bearing B16.SIY flank tumors were subjected to treatment with anti-interferon-a/b receptor (aIFNAR) before and during immunogenic S100 IT injection. Neutralizing

Cell Reports 25, 3074–3085, December 11, 2018 3079

Figure 4. Type I IFN, but Not TNFa, Is Required for Optimal Anti-tumor Immune Responses in an Immunogenic Setting (A) Mice bearing a single B16.SIY flank tumor were injected via the IP route with 200 mg of TNFa or isotype control on days 4, 7, 10, and 14, with one IT injection of vehicle alone or 10 mg S100 (arrow). Shown is the mean injected tumor growth over time (significance on day 31), with the fraction of cured mice indicated in the legend. (B and C) Mice bearing a single B16.SIY STING/ flank tumor were injected via the IP route with 200 mg of aIFNAR or isotype control on days 7 and 12, with one IT injection of vehicle alone or 2 mg S100 (arrow). (B) Mean injected tumor growth over time (significance on day 30), with the fraction of cured mice indicated in the legend. (C) Three days post-injection, TDLN cells from the injected side were stained and interrogated by flow cytometry. Shown are the SIY tetramer counts and Ki-67-, CD11c-, CXCR3-, GrzB-, and Tbet-positive frequencies on CD8+ T cells. Error lines or bars represent the mean ± SEM, and each symbol in bar graphs represents an individual animal. Data are representative of at least two independent experiments, with n = 8 animals/group unless indicated otherwise. ns, not significant; V, vehicle; Iso, isotype. *p < 0.05, **p < 0.01, ****p < 0.0001. See also Figure S4.

antibody binding to IFNAR in vivo was confirmed by ex vivo staining and flow cytometry (Figure S4B). IFNAR blockade lowered IFNg, IL-6, and MCP1 serum levels, while TNFa was not affected (Figure S4C). In this model, signaling through IFNAR was required for tumor control by immunogenic S100 IT therapy (p = 0.0013) (Figure 4B), consistent with previous reports using different STING agonists, dose levels, or regimens (Corrales et al., 2015; Demaria et al., 2015). To probe the IFNAR requirement, CD8+ T cells in the injected-side TDLN were examined 3 days after treatment. In the context of IFNAR blockade, significantly fewer SIY+ T cells were detected compared to isotype controls (p = 0.0022), and analysis of the bulk CD8+ T cell population revealed decreased frequencies of Ki-67-, CD11c-, CXCR3-, GrzB-, and Tbet-positive cells (Figure 4C). These data reveal that signaling through IFNAR, but not by TNFa, is required for optimal activation and/or differentiation of T cells to an effector phenotype following immunogenic IT dosing of S100. S100 and aPD-1 Synergize to Control Distal Tumors Although both immunogenic and ablative doses of S100 elicited a robust tumor-specific CD8+ T cell response in the dual-flank setting (Figure S1F), ablative doses could control non-injected tumors, while immunogenic doses could not (Figure 2A). This result suggested that local STING activation facilitates CD8+ T cell function by modulating the tumor microenvironment

3080 Cell Reports 25, 3074–3085, December 11, 2018

(TME). In the absence of systemic drug distribution, we hypothesized that distal tumor control by immunogenic dosing could be potentiated with TME modulation by CPIs. In the 4T1 dual-flank tumor model, aPD-1 exhibited some single-agent activity but did not cure tumors (p = 0.0403) (Figure 5A). Combining an immunogenic dose of S100 with systemic aPD-1 elicited near-complete clearance of injected and non-injected tumors (p < 0.005) that depended on CD8+ T cells (p < 0.0001) (Figures 5A and 5B). Thus, combining STING-dependent local T cell priming with aPD-1 resulted in CD8+ T cell-mediated control of distal tumors. Parallel studies were performed to characterize changes in T cell responses caused by S100, aPD-1, or combination treatment. At day 12 post-IT injection, mice treated with only S100 had trending increases in tumor-specific T cells in the periphery that did not reach significance above that of vehicle-treated mice (Figure S5). However, when combined with aPD-1, the frequency, function (IFNg+ TNFa+), and activation status (CD11c+) of peripheral AH1+ T cells elicited by S100 were increased (p < 0.05) (Figure S5). Analysis of the distal tumor revealed additional correlates of anti-tumor activity; logically, treatment with aPD-1 decreased PD-1 staining on distal tumor AH1+ T cells (p < 0.0001). S100 alone ostensibly changed the composition and/or activity of tumor-specific T cells, as demonstrated by increases in CD11c and GrzB on CD8+AH1+ T cells (p < 0.0001) and production of cytokines by CD8+ T cells after

Figure 5. S100 and aPD-1 Synergize to Control Distal Tumors (A and C) Mice bearing 4T1 dual-flank tumors were injected via the IP route with 200 mg of aPD-1 or isotype control on day 8 or 10 and twice weekly thereafter, with one IT injection (in the right flank tumor) of vehicle alone or 10 mg S100 (arrow). (A) Mean injected and distal tumor growth over time (significance on day 25). (B) Mice bearing dual-flank 4T1 tumors were injected via the IP route with 200 mg of aPD-1 or isotype control on day 8 and twice weekly thereafter; with 100 mg aCD8 or isotype control on days 6, 8, 10, 14, and 17; and with one IT injection (in the right flank tumor) of vehicle alone or 10 mg S100 (arrow). Shown is the mean injected and distal tumor growth over time (significance on day 25). (C) 12 days post-IT injection, distal tumors were dissociated and either left untreated or stimulated with AH1 peptide in the presence of Golgi inhibitors for subsequent staining and interrogation by flow cytometry. Shown are the IFNg+TNFa+ frequencies on bulk CD8+ T cells with CD11c-positive frequency, GrzB median fluorescence intensity (MFI), and PD-1 MFI on AH1+ T cells. Error lines or bars represent the mean ± SEM, and each symbol in bar graphs represents an individual animal. Unless indicated otherwise, significance shown is compared to vehicle control. Data are representative of at least two independent experiments, with n = 8–10 animals/group. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. See also Figure S5.

AH1 peptide stimulation (p = 0.0007) (Figure 5C). These results suggest that S100 activated and expanded tumor-specific T cells, while aPD-1 potentiated the functionality of these cells in the distal TME. S100, aPD-1, and aCTLA4 Synergize to Elicit Durable Immunity to CPI-Resistant B16 Tumors To explore durability of immune responses afforded by immunogenic versus ablative dosing regimens in a poorly immunogenic model, mice bearing single-flank B16 tumors refractory to CPI therapy (Lechner et al., 2013) received IT injections with either an immunogenic regimen (1 3 10 mg S100 + aPD-1 + aCTLA4) or an ablative regimen (3 3 100 mg S100). The S100 + aPD-1 + aCTLA4 triple combination elicited significant increases in IFNg-secreting tumor-specific T cells (p % 0.0003 versus S100 + isotype or vehicle + aPD-1 + aCTLA4), while the 3 3 100 mg S100 regimen did not (Figure 6A). Survival gains were demonstrated with either immunogenic S100 or CPIs alone compared to vehicle + isotype (p % 0.0005), while the triple combination had a significantly improved survival benefit (p < 0.0001 versus S100 + isotype or vehicle + aPD-1 + aCTLA4) (Figure 6B).

Perhaps not surprisingly, the 3 3 100 mg S100 ablative regimen was superior to the triple combination in primary tumor clearance survival (p = 0.0223) (Figure 6B). Despite this enticing survival benefit, mice cured using the ablative regimen were not resistant to rechallenge (1/14 cures; p = ns versus naive; Fisher’s exact test), while mice curing primary tumors as a result of the triple combination were significantly protected (9/12 cures; p = 0.0013 versus naive, p = 0.0245 versus 3 3 100 mg S100; Fisher’s exact test) (Figure 6C). In summary, S100 can render poorly immunogenic tumors sensitive to CPI therapy, and combining CPIs with immunogenic doses of S100 resulted in enhancement of tumor-specific T cells and durable anti-tumor immunity. DISCUSSION Prior preclinical studies investigating STING-mediated antitumor immunity often focused on dosing regimens that drove TNFa-mediated injected tumor clearance (Baird et al., 2016; Francica et al., 2018) or elicited suboptimal T cell induction and likely did not facilitate true abscopal immunity but instead facilitated systemic distribution of STING agonist (Corrales

Cell Reports 25, 3074–3085, December 11, 2018 3081

Figure 6. S100, aPD-1, and aCTLA4 Synergize to Elicit Durable Immunity to CPIResistant B16 Tumors Mice bearing B16 single-flank tumors received one IT injection of vehicle alone or 10 mg S100 or three (33) IT injections of vehicle alone or 100 mg S100 over the course of one week. IT injections were given in the right flank tumor starting on day 10. Indicated cohorts were injected via the IP route with 200 mg of isotype control or aPD-1 and aCTLA4 combined on day 10 and twice weekly thereafter. (A) Seven days after the first (left) or third (right) IT injection, PBMCs from a cohort of mice (n = 2–15) were stimulated with p15E peptide and assessed by IFNg ELISPOT. Error bars represent the mean ± SEM, and each symbol represents an individual animal. Data are representative of two independent experiments. (B) Kaplan-Meier curves showing the percentage of survival through day 50, with n indicated in the legend. Unless indicated otherwise, significance is compared to vehicle + isotype control. (C) Along with naive controls, 10 mg S100 + aPD-1 + aCTLA4 or 3 3 100 mg S100 mice that cured their primary tumors were implanted with 2 3 105 B16 tumor cells. Shown is the rechallenge tumor growth for individual animals over time, with the fraction of cured mice indicated in the legend. For (B) and (C), data are the combination of two (3 3 100 mg) or three (remaining groups) independent experiments. *p < 0.05, ***p < 0.001, ****p < 0.0001.

et al., 2015). We find that a single relatively low dose of IT-administered STING agonist produced the most tumor-specific T cells. In this immunogenic use of STING agonist, T cell responses could be facilitated by STING expression in the hematopoietic compartment, and tumor control was type I IFN dependent, but not TNFa dependent. IFNAR-dependent T cell activation signatures in the TDLN that correlated with protective immune responses in the monotherapy setting were enhanced in the presence of CPIs. Finally, curing tumors by an immunogenic dosing regimen resulted in durable immunity, whereas TNFa-driven tumor ablation did not. With these results, we have developed a working model for IT STING-driven anti-tumor immunity in mice. We found that intensive dosing regimens ablated injected tumors largely without the help of CD8+ T cells (Figure 2). Non-CD8+ T cell-mediated tumor clearance may involve innate or cytotoxic mechanisms such as cytokine-mediated cytotoxicity, antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), complement, and/or direct tumor killing. While innate, cytotoxic, and adaptive mechanisms are not mutually exclusive in either the immunogenic or the ablative setting, the balance among these mechanisms is contextual. For instance, we found that mice curing 4T1 single-flank tumors by the 3 3 100 mg regimen to be resistant to rechallenge, whereas similarly treated mice with B16.F10 tumors were not, perhaps because of differences in immunogenicity of implantation within the tumor models. Additional features of the tumor that may affect IT CDN therapy

3082 Cell Reports 25, 3074–3085, December 11, 2018

include protein expression (i.e., STING, neoantigen, checkpoint proteins, and major histocompatibility complex [MHC]), TME infiltration and composition, and tumor size (or overall burden). In addition, aspects of the STING agonist beyond dosing regimen, such as potency, stability, cellular uptake, and affinity for different STING alleles, can influence the outcome of STING activation. While reactogenicity and host cell death can be mitigated and improvements in T cell activation can be made by regimen adjustments (Ager et al., 2017; Chandra et al., 2014), compounds like S100 that exhibit low intrinsic reactogenicity (Corrales et al., 2015) may provide a broader therapeutic index, considering we observed T cell immunogenicity across a 100-fold dose range in a single 4T1 tumor-bearing animal (Figure 1D). Understanding STING activation in the context of tumor promotion, as well as regression, is also critical for optimal implementation of CDN treatment (Bose, 2017; He et al., 2017; Ng et al., 2018), because it was found that chronic STING activation in tumor cells was associated with non-canonical NF-kB pathway activation and metastasis (Bakhoum et al., 2018). Experiments shown and referenced here demonstrate that IT CDN therapy results in pulsatile STING activation that upregulates canonical NF-kB and IRF3 pathways in host cells and suppresses tumor outgrowth. Thus, rather than promoting metastasis, the net effect of IT therapeutic application of STING agonists is tumor clearance. While the contribution of factors beyond dose are the subject of further investigation, we establish a precedence for achieving durable anti-tumor immunity in which STING activation needs to be tempered to yield maximal

T cell responses, rather than exploited to collapse the primary injected tumor. Experiments using bone marrow chimeric mice revealed that STING signaling in the hematopoietic compartment is sufficient to drive S100-mediated tumor-specific T cell responses (Figure 3). This result is seemingly in disagreement with Demaria et al. (2015), who claim that endothelial cells are the main producers of IFNb following IT injection of CDN. One experimental difference that may address this discrepancy is that Demaria et al. (2015) delivered CDN with lipofectamine that presumably facilitates uptake in cell types that may otherwise respond poorly, thereby altering the cellular response profile. Upon ex vivo stimulation of sorted TME cell types, the findings of Corrales et al. (2015) were consistent with myeloid populations, not CD31+ endothelial cells, producing the most IFNb following STING activation. While STING signaling in the stroma was dispensable for the formation of tumor-specific T cell responses in our models, serum cytokines in the WT/Gt mice were significantly lower than those in the WT/WT animals, suggesting that the stromal compartment could contribute to acute cytokine responses. In support of this, chimeric experiments have demonstrated that radio-resistant stromal cells are a key source of TNFa that contributes to collapse of injected tumor in B16.F10 melanoma treated repetitively with 100 mg S100 (Francica et al., 2018). Consequently, while broad cellular targeting or enhanced induction of NF-kB-dependent cytokines may promote innate-mediated tumor clearance, such conditions may not be ideal for the formation of adaptive anti-tumor responses, because (1) T cell responses in WT/Gt mice trended higher compared to WT/WT mice (Figure 3A) and (2) TNFa was dispensable for sustained tumor control when using an immunogenic regimen of S100 (Figure 4). Future studies will dissect the role of STING signaling in different cellular subsets to further delineate populations responsible for promoting adaptive antitumor immune responses. In addition to STING agonists, activators of alternative innate immune receptors are undergoing clinical evaluation (Corrales et al., 2016). Because of the broad cellular expression profile and fundamental role in immune cancer surveillance (Woo et al., 2014), STING may offer advantages as a target for IT therapy. In addition, given the effectiveness by which STING activation can lead to clearance of the injected tumor, one may reason that the clinical objective for IT CDN therapy should be to administer sufficiently ablative doses of CDN to regress injected tumors. For example, oncologists often use chemotherapy to shrink the liver metastases to reduce the tumor burden, which could improve outcomes or make patients eligible for resection (Le´vi et al., 2016). In this instance, ablative dosing of STING agonist could be an alternative approach for de-bulking and facilitate systemic spread of immunogenic doses to distal tumors. In addition, systemic delivery approaches are attractive when considering the distinct antigenic repertoires between lesions within the same patient. While there is precedence for systemic administration of CDNs in mice (Chandra et al., 2014; Curran et al., 2016), due to the differences in body size and tolerance to systemic immune activation, distal tumor efficacy achieved through systemic compound distribution and/or very high systemic cytokines in mice is unlikely to translate to hu-

mans. Thus, in abscopal response studies in mice, it is necessary to assess whether an effect on a distal lesion is due to systemic drug distribution or a bona fide adaptive response incited by STING activation in the injected tumor. With this in mind, the use of ablative dosing here was intended not to model systemic effects in mice but to probe the consequences of different concentrations of CDN in the tumor, where we believe localized induction of CD8+ T cells may be the most relevant objective. The goal of cancer immunotherapy is to harness the host immune system to destroy tumor cells and elicit durable immunity. CPIs fail in many patients and mouse models, perhaps due to insufficient numbers or inadequate reactivation of tumorspecific T cells. IT STING agonist delivery alters the TME, promoting cellular activation, maturation, and cytokine secretion that results in the expansion of CD8+ T cells (Corrales and Gajewski, 2015; Ng et al., 2018). Our finding that CDN-checkpoint combinations are beneficial is supported by other groups (Ager et al., 2017; Demaria et al., 2015; Foote et al., 2017; Moore et al., 2016; Wang et al., 2017). Here, we enrich these findings by showing that distal anti-tumor efficacy elicited by S100 and aPD-1 combination depends on CD8+ T cells and identifying tumor-resident cellular markers that correlate with combination therapy activity (Figure 5). In addition, the finding that mice cured from B16 melanoma by an intensive TNFa-dependent regimen of S100 (Francica et al., 2018) were unable to resist tumor rechallenge suggests that IT injection of ablative doses of STING agonist is detrimental to the formation of immunological memory (Figure 6). Based on these findings, there is a logical case to combine immunogenic IT CDN therapy with CPIs to drive efficacious anti-tumor CD8+ T cell responses, and clinical trials combining IT S100 or other STING agonists with aPD-1 are under way (NCT: NCT03172936 and NCT03010176). Collectively, these results establish important principles for application of IT STING agonist therapy and highlight the potential of CPI-STING agonist combinations for the treatment of cancer. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODELS AND SUBJECT DETAILS B Mice B Cell Culture and Cellular Assays METHOD DETAILS B Flow Cytometry B Enzymatic Digestion of LNs B Tumor Growth B Adoptive Cell Transfer B In vivo Immunotherapy B In Vivo Antibody Depletions and Blockade B Ex vivo Restimulation Assays B Cytometric Bead Array (CBA) B Bone Marrow Chimeric Experiments / B Generation of STING Tumor Cell Lines

Cell Reports 25, 3074–3085, December 11, 2018 3083

B

Detection of S100 Histopathology and Immunohistochemistry (IHC) QUANTIFICATION AND STATISTICAL ANALYSIS B

d

SUPPLEMENTAL INFORMATION Supplemental Information includes five figures and can be found with this article online at https://doi.org/10.1016/j.celrep.2018.11.047. ACKNOWLEDGMENTS We thank Yusup Chang, Ruben Flores, and Gonzalo Barajas for their skill and efforts in contributing to animal studies. We also thank members of the Greg Barton laboratory for assistance with the chimera studies. This work benefited from data assembled by the ImmGen consortium. This research was funded by Aduro Biotech, Inc. AUTHOR CONTRIBUTIONS K.E.S., A.L.D., L.H.G., G.L.R., L.C., G.E.K., T.W.D., and S.M.M. conceived and/or designed experiments. K.E.S., A.L.D., L.H.G., G.L.R., L.C., N.H.S., T.E.H., U.T.V., B.J.F., and T.B. performed experiments. K.E.S., A.L.D., G.L.R., L.C., and S.M.M. wrote and revised the manuscript. K.E.S., A.L.D., L.H.G., G.L.R., L.C., B.J.F., J.M.M., Y.F., L.Z., S.L.B., C.Y.C., M.L.L., A.v.E., T.W.D., and S.M.M. reviewed and/or edited the manuscript. D.B.K., J.J.L., K.M., and C.O.N. developed methods for synthesis and synthesized S100. S.M.M. and T.W.D. conceived and supervised the entire project. DECLARATION OF INTERESTS K.E.S., A.L.D., L.H.G., G.L.R., L.C., N.H.S., B.J.F., T.B., G.E.K., D.B.K., J.J.L., K.M., C.O.N., M.L.L., A.v.E., T.W.D., and S.M.M. are all current or former employees of Aduro Biotech, Inc., and hold stock and/or intellectual property in the company. J.M.M., Y.F., L.Z., S.L.B., and C.Y.C. are employed by Novartis and hold stock and/or intellectual property in the company. Received: April 11, 2018 Revised: September 19, 2018 Accepted: November 9, 2018 Published: December 11, 2018 REFERENCES Ager, C.R., Reilley, M.J., Nicholas, C., Bartkowiak, T., Jaiswal, A.R., and Curran, M.A. (2017). Intratumoral STING activation with T-cell checkpoint modulation generates systemic antitumor immunity. Cancer Immunol. Res. 5, 676–684. Baguley, B.C., and Ching, L.-M. (1997). Immunomodulatory actions of xanthenone anticancer agents. BioDrugs 8, 119–127. Baird, J.R., Friedman, D., Cottam, B., Dubensky, T.W., Jr., Kanne, D.B., Bambina, S., Bahjat, K., Crittenden, M.R., and Gough, M.J. (2016). Radiotherapy combined with novel STING-targeting oligonucleotides results in regression of established tumors. Cancer Res. 76, 50–61. Baird, J.R., Feng, Z., Xiao, H.D., Friedman, D., Cottam, B., Fox, B.A., Kramer, G., Leidner, R.S., Bell, R.B., Young, K.H., et al. (2017). STING expression and response to treatment with STING ligands in premalignant and malignant disease. PLoS ONE 12, e0187532. Bakhoum, S.F., Ngo, B., Laughney, A.M., Cavallo, J.-A., Murphy, C.J., Ly, P., Shah, P., Sriram, R.K., Watkins, T.B.K., Taunk, N.K., et al. (2018). Chromosomal instability drives metastasis through a cytosolic DNA response. Nature 553, 467–472. Blank, C., Brown, I., Peterson, A.C., Spiotto, M., Iwai, Y., Honjo, T., and Gajewski, T.F. (2004). PD-L1/B7H-1 inhibits the effector phase of tumor rejection by T cell receptor (TCR) transgenic CD8+ T cells. Cancer Res 64, 1140–1145.

3084 Cell Reports 25, 3074–3085, December 11, 2018

Bose, D. (2017). cGAS/STING pathway in cancer: Jekyll and Hyde story of cancer immune response. Int. J. Mol. Sci. 18, E2456. Cerboni, S., Jeremiah, N., Gentili, M., Gehrmann, U., Conrad, C., Stolzenberg, M.-C., Picard, C., Neven, B., Fischer, A., Amigorena, S., et al. (2017). Intrinsic antiproliferative activity of the innate sensor STING in T lymphocytes. J. Exp. Med. 214, 1769–1785. Chandra, D., Quispe-Tintaya, W., Jahangir, A., Asafu-Adjei, D., Ramos, I., Sintim, H.O., Zhou, J., Hayakawa, Y., Karaolis, D.K.R., and Gravekamp, C. (2014). STING ligand c-di-GMP improves cancer vaccination against metastatic breast cancer. Cancer Immunol. Res. 2, 901–910. Chen, Q., Sun, L., and Chen, Z.J. (2016). Regulation and function of the cGASSTING pathway of cytosolic DNA sensing. Nat. Immunol. 17, 1142–1149. Corrales, L., and Gajewski, T.F. (2015). Molecular pathways: targeting the stimulator of interferon genes (STING) in the immunotherapy of cancer. Clin. Cancer Res. 21, 4774–4779. Corrales, L., Glickman, L.H., McWhirter, S.M., Kanne, D.B., Sivick, K.E., Katibah, G.E., Woo, S.-R., Lemmens, E., Banda, T., Leong, J.J., et al. (2015). Direct activation of STING in the tumor microenvironment leads to potent and systemic tumor regression and immunity. Cell Rep. 11, 1018–1030. Corrales, L., McWhirter, S.M., Dubensky, T.W., Jr., and Gajewski, T.F. (2016). The host STING pathway at the interface of cancer and immunity. J. Clin. Invest. 126, 2404–2411. Curran, E., Chen, X., Corrales, L., Kline, D.E., Dubensky, T.W., Jr., Duttagupta, P., Kortylewski, M., and Kline, J. (2016). STING pathway activation stimulates potent immunity against acute myeloid leukemia. Cell Rep. 15, 2357–2366. Demaria, O., De Gassart, A., Coso, S., Gestermann, N., Di Domizio, J., Flatz, L., Gaide, O., Michielin, O., Hwu, P., Petrova, T.V., et al. (2015). STING activation of tumor endothelial cells initiates spontaneous and therapeutic antitumor immunity. Proc. Natl. Acad. Sci. USA 112, 15408–15413. Deng, L., Liang, H., Xu, M., Yang, X., Burnette, B., Arina, A., Li, X.-D., Mauceri, H., Beckett, M., Darga, T., et al. (2014). STING-dependent cytosolic DNA sensing promotes radiation-induced type I interferon-dependent antitumor immunity in immunogenic tumors. Immunity 41, 843–852. Fletcher, A.L., Malhotra, D., Acton, S.E., Lukacs-Kornek, V., Bellemare-Pelletier, A., Curry, M., Armant, M., and Turley, S.J. (2011). Reproducible isolation of lymph node stromal cells reveals site-dependent differences in fibroblastic reticular cells. Front. Immunol. 2, 35. Foote, J.B., Kok, M., Leatherman, J.M., Armstrong, T.D., Marcinkowski, B.C., Ojalvo, L.S., Kanne, D.B., Jaffee, E.M., Dubensky, T.W., Jr., and Emens, L.A. (2017). A STING agonist given with OX40 receptor and PD-L1 modulators primes immunity and reduces tumor growth in tolerized mice. Cancer Immunol. Res. 5, 468–479. Francica, B.J., Ghasemzadeh, A., Desbien, A.L., Theodros, D., Sivick, K.E., Reiner, G.L., Hix Glickman, L., Marciscano, A.E., Sharabi, A.B., Leong, M.L., et al. (2018). TNF-a and radioresistant stromal cells are essential for therapeutic efficacy of cyclic dinucleotide STING agonists in nonimmunogenic tumors. Cancer Immunol. Res. 6, 422–433. Gaidt, M.M., Ebert, T.S., Chauhan, D., Ramshorn, K., Pinci, F., Zuber, S., O’Duill, F., Schmid-Burgk, J.L., Hoss, F., Buhmann, R., et al. (2017). The DNA inflammasome in human myeloid cells is initiated by a STING-cell death program upstream of NLRP3. Cell 171, 1110–1124. Gulen, M.F., Koch, U., Haag, S.M., Schuler, F., Apetoh, L., Villunger, A., Radtke, F., and Ablasser, A. (2017). Signalling strength determines proapoptotic functions of STING. Nat. Commun. 8, 427. He, L., Xiao, X., Yang, X., Zhang, Z., Wu, L., and Liu, Z. (2017). STING signaling in tumorigenesis and cancer therapy: a friend or foe? Cancer Lett. 402, 203–212. Heng, T.S.P., and Painter, M.W.; Immunological Genome Project Consortium (2008). The Immunological Genome Project: networks of gene expression in immune cells. Nat. Immunol. 9, 1091–1094. Larkin, B., Ilyukha, V., Sorokin, M., Buzdin, A., Vannier, E., and Poltorak, A. (2017). Cutting edge: activation of STING in T cells induces type I IFN responses and cell death. J. Immunol. 199, 397–402.

Lechner, M.G., Karimi, S.S., Barry-Holson, K., Angell, T.E., Murphy, K.A., Church, C.H., Ohlfest, J.R., Hu, P., and Epstein, A.L. (2013). Immunogenicity of murine solid tumor models as a defining feature of in vivo behavior and response to immunotherapy. J. Immunother. 36, 477–489. Le´vi, F.A., Boige, V., Hebbar, M., Smith, D., Lepe`re, C., Focan, C., Karaboue´, A., Guimbaud, R., Carvalho, C., Tumolo, S., et al.; Association Internationale pour Recherche sur Temps Biologique et Chronothe´rapie (ARTBC International) (2016). Conversion to resection of liver metastases from colorectal cancer with hepatic artery infusion of combined chemotherapy and systemic cetuximab in multicenter trial OPTILIV. Ann. Oncol. 27, 267–274. Moore, E., Clavijo, P.E., Davis, R., Cash, H., Van Waes, C., Kim, Y., and Allen, C. (2016). Established T cell-inflamed tumors rejected after adaptive resistance was reversed by combination STING activation and PD-1-pathway blockade. Cancer Immunol. Res. 4, 1061–1071. €ller, U., Steinhoff, U., Reis, L.F.L., Hemmi, S., Pavlovic, J., Zinkernagel, Mu R.M., and Aguet, M. (1994). Functional role of type I and type II interferons in antiviral defense. Science 264, 1918–1921. Ng, K.W., Marshall, E.A., Bell, J.C., and Lam, W.L. (2018). cGAS-STING and cancer: dichotomous roles in tumor immunity and development. Trends Immunol. 39, 44–54. Pauken, K.E., Sammons, M.A., Odorizzi, P.M., Manne, S., Godec, J., Khan, O., Drake, A.M., Chen, Z., Sen, D.R., Kurachi, M., et al. (2016). Epigenetic stability of exhausted T cells limits durability of reinvigoration by PD-1 blockade. Science 354, 1160–1165. Ribas, A., and Wolchok, J.D. (2018). Cancer immunotherapy using checkpoint blockade. Science 359, 1350–1355. Sauer, J.-D., Sotelo-Troha, K., von Moltke, J., Monroe, K.M., Rae, C.S., Brubaker, S.W., Hyodo, M., Hayakawa, Y., Woodward, J.J., Portnoy, D.A., and Vance, R.E. (2011). The N-ethyl-N-nitrosourea-induced Goldenticket mouse mutant reveals an essential function of Sting in the in vivo interferon response to Listeria monocytogenes and cyclic dinucleotides. Infect. Immun. 79, 688–694.

Sharma, P., and Allison, J.P. (2015). Immune checkpoint targeting in cancer therapy: toward combination strategies with curative potential. Cell 161, 205–214. Sharma, P., Hu-Lieskovan, S., Wargo, J.A., and Ribas, A. (2017). Primary, adaptive, and acquired resistance to cancer immunotherapy. Cell 168, 707–723. Sivick, K.E., Surh, N.H., Desbien, A.L., Grewal, E.P., Katibah, G.E., McWhirter, S.M., and Dubensky, T.W., Jr. (2017). Comment on ‘‘The common R71HG230A-R293Q human TMEM173 is a null allele.’’ J. Immunol 198, 4183–4185. Tang, C.H.A., Zundell, J.A., Ranatunga, S., Lin, C., Nefedova, Y., Del Valle, J.R., and Hu, C.C.A. (2016). Agonist-mediated activation of STING induces apoptosis in malignant B cells. Cancer Res. 76, 2137–2152. Wang, H., Hu, S., Chen, X., Shi, H., Chen, C., Sun, L., and Chen, Z.J. (2017). cGAS is essential for the antitumor effect of immune checkpoint blockade. Proc. Natl. Acad. Sci. USA 114, 1637–1642. Woo, S.-R., Fuertes, M.B., Corrales, L., Spranger, S., Furdyna, M.J., Leung, M.Y.K., Duggan, R., Wang, Y., Barber, G.N., Fitzgerald, K.A., et al. (2014). STING-dependent cytosolic DNA sensing mediates innate immune recognition of immunogenic tumors. Immunity 41, 830–842. Wu, C., Orozco, C., Boyer, J., Leglise, M., Goodale, J., Batalov, S., Hodge, C.L., Haase, J., Janes, J., Huss, J.W., 3rd, and Su, A.I. (2009). BioGPS: an extensible and customizable portal for querying and organizing gene annotation resources. Genome Biol. 10, R130. Wu, C., Wang, Z., Song, X., Feng, X.-S., Abnet, C.C., He, J., Hu, N., Zuo, X.-B., Tan, W., Zhan, Q., et al. (2014). Joint analysis of three genome-wide association studies of esophageal squamous cell carcinoma in Chinese populations. Nat. Genet. 46, 1001–1006. Yi, G., Brendel, V.P., Shu, C., Li, P., Palanathan, S., and Cheng Kao, C. (2013). Single nucleotide polymorphisms of human STING can affect innate immune response to cyclic dinucleotides. PLoS ONE 8, e77846.

Cell Reports 25, 3074–3085, December 11, 2018 3085

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Rat anti-mouse CD19 (clone 1D3)

BD Biosciences

Cat# 564296; RRID:AB_2716855

Rat anti-mouse CD45 (clone 30-F11)

BD Biosciences

Cat# 564590; RRID:AB_2738857

Rat anti-mouse CD8a (clone 53-6.7)

BD Biosciences

Cat# 563786; RRID:AB_2732919

Antibodies

Mouse anti-human Granzyme B (clone GB11)

BD Biosciences

Cat# 563389; RRID:AB_2738175

Rat anti-mouse CD4 (clone RM4-5)

BD Biosciences

Cat# 564933; RRID:AB_2732918

Rat anti-mouse CD11b (clone M1/70)

BD Biosciences

Cat# 563553; RRID:AB_2738276

Rat anti-mouse TNF-alpha (clone MP6-XT22)

BD Biosciences

Cat# 557730; RRID:AB_396838

Rat anti-mouse CD335 (NKp46; clone 29A1.4)

BioLegend

Cat# 137612; RRID:AB_2563104

Rat anti-mouse I-A/I-E (MHCII; clone M5/114.15.2)

BioLegend

Cat# 107635; RRID:AB_2561397

Rat anti-mouse Ly-6G (clone 1A8)

BioLegend

Cat# 127639; RRID:AB_2565880

Rat anti-mouse Ly-6C (clone HK1.4)

BioLegend

Cat# 128037; RRID:AB_2562630

Armenian Hamster anti-mouse CD11c (clone N418)

BioLegend

Cat# 117318; RRID:AB_493568

Rat anti-mouse CD90.2 (clone 53-2.1)

BioLegend

Cat# 140324; RRID:AB_2566740

Rat anti-mouse CD25 (clone PC61)

BioLegend

Cat# 102049; RRID:AB_2564130

Rat anti-mouse Ki-67 (clone 16A8)

BioLegend

Cat# 652418; RRID:AB_2564269

Mouse anti-mouse T-bet (clone 4B10)

BioLegend

Cat# 644813; RRID:AB_10896913

Armenian Hamster anti-mouse CD183 (CXCR3; clone CXCR3-173)

BioLegend

Cat# 126527; RRID:AB_2562204

Rat anti-mouse CD279 (PD-1; clone 29F.1A12)

BioLegend

Cat# 135216; RRID:AB_10689635

Syrian Hamster anti-mouse CD28 (clone 37.51)

BioLegend

Cat# 102123; RRID:AB_2629549

Rat anti-mouse IFN-gamma (clone XMG1.2)

BioLegend

Cat# 505814; RRID:AB_493314

Rat anti-mouse IL-2 (clone JES6-5H4)

BioLegend

Cat# 503808; RRID:AB_315302

Mouse anti-mouse IFNAR-1 (clone MAR1-5A3)

BioLegend

Cat# 127314; RRID:AB_2122745

Mouse anti-mouse CD45.1 (clone A20)

BioLegend

Cat# 110731; RRID:AB_10896425

Mouse anti-mouse CD45.2 (clone 104)

BioLegend

Cat# 109818; RRID:AB_492870

Rat anti-mouse CD16/CD32 (clone 2.4G2)

Bio X Cell

Cat# BE0307; RRID:AB_2736987

Rat IgG2a isotype control (clone 2A3)

Bio X Cell

Cat# BE0089; RRID:AB_1107769

Rat IgG1 isotype control (clone HRPN)

Bio X Cell

Cat# BE0088; RRID:AB_1107775

Mouse IgG1 isotype control (clone MOPC-21)

Bio X Cell

Cat# BE0083; RRID:AB_1107784

Mouse IgG2b isotype control (clone MPC-11)

Bio X Cell

Cat# BE0086; RRID:AB_1107791

Rat anti-mouse CD8a (clone 2.43)

Bio X Cell

Cat# BE0061; RRID:AB_1125541

Rat anti-mouse TNF-a (clone XT3.11)

Bio X Cell

Cat# BE0058; RRID:AB_1107764

Mouse anti-mouse IFNAR-1 (clone MAR1-5A3)

Bio X Cell

Cat# BE0241; RRID:AB_2687723

Rat anti-mouse PD-1 (clone RMP1-14)

Bio X Cell

Cat# BE0146; RRID:AB_10949053

Mouse anti-mouse CTLA-4 (clone 9D9)

Bio X Cell

Cat# BE0164; RRID:AB_10949609

Rabbit maB Cleaved Caspase-3 (Asp175)(D3E9)

Cell Signaling Technology

Cat# 9602; RRID:AB_2687881

Rabbit Cleaved Caspase-3 (Asp175)

Cell Signaling Technology

Cat# 9661; RRID:AB_2341188

Rat anti-mouse FOXP3 (clone FJK-16 s)

eBioscience

Cat# 61-5773-82; RRID:AB_2574624

H-2Ld MuLV gp70 tetramer-SPSYVYHQF-PE

MBL International Corporation

Cat# TB-M521-1

H-2Kb Negative Tetramer-SIYRYYGL-PE

MBL International Corporation

Cat# TS-M008-1

H-2Kb MuLV p15E Tetramer- KSPWFTTL-PE

MBL International Corporation

Cat# TS-M507-1

Rat anti-mouse IFN Beta (clone RMMB-1)

PBL Assay Science

Cat# 22400-1; RRID:AB_387846 (Continued on next page)

e1 Cell Reports 25, 3074–3085.e1–e5, December 11, 2018

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

SIY peptide (SIYRYYGL)

Elim Biopharm

N/A

AH1 peptide (SPSYVYHQF)

Elim Biopharm

N/A

p15E peptide (KSPWFTTL)

Elim Biopharm

N/A

Chemicals, Peptides, and Recombinant Proteins

Critical Commercial Assays Bond Polymer Refine Detection

Leica Biosystems

Cat# DS9800

BD GolgiStop (monensin)

BD Biosciences

Cat# 554724

BD GolgiPlug (brefeldin A)

BD Biosciences

Cat# 555029

Mouse IFN-gamma ELISPOT Pair

BD Biosciences

Cat# 551881

BD Cytometric Bead Array (CBA) Mouse Inflammation Kit

BD Biosciences

Cat# 552364

Fixation/Permeabilization Solution Kit

BD Biosciences

Cat# 554714

Zombie Green Fixable Viability Kit

Biolegend

Cat# 423112

Lympholyte Mammal Cell Separation Media

Cedarlane

Cat# CL5115

eBioscience Foxp3/Transcription Factor Staining Buffer Set

Thermo Fisher Scientific

Cat# 00-5523-00

EasySep Mouse CD8+ T Cell Isolation Kit

Stem Cell Technologies

Cat# 19853

Live/dead Fixable Near-IR Dead Cell Stain Kit

Thermo Fisher Scientific

Cat# L34976

Mouse: 4T1 cells

ATCC

CRL-2539; RRID:CVCL_0125

Mouse: B16.F10 cells

ATCC

CRL-6475; RRID:CVCL_0159

Mouse: B16.SIY cells

Laboratory of Thomas Gajewski (Blank et al., 2004)

N/A

Mouse: B16.SIY STING / cells

This paper

N/A

Mouse: BALB/c: BALB/c

Charles River Laboratories

Cat# 028; RRID:IMSR_CRL:28

Mouse: C57BL/6: C57BL/6

Charles River Laboratories

Cat# 027; RRID:IMSR_CRL:27

Mouse: BALB/c: BALB/cJ

The Jackson Laboratory

Cat# 000651; RRID:IMSR_JAX:000651

Experimental Models: Cell Lines

Experimental Models: Organisms/Strains

a

Mouse: CD45.1+ BALB/c: CByJ.SJL(B6)-Ptprc /J

The Jackson Laboratory

Cat# 006584; RRID:IMSR_JAX:006584

Mouse: C57BL/6: C57BL/6J

The Jackson Laboratory

Cat# 000664; RRID:IMSR_JAX:000664

Mouse: CD45.1+ C57BL/6: B6.SJL-Ptprca Pepcb/BoyJ

The Jackson Laboratory

Cat# 002014; RRID:IMSR_JAX:002014

Mouse: Goldenticket: C57BL/6J-Tmem173 gt/J

The Jackson Laboratory

Cat# 017537; RRID:IMSR_JAX:017537

Mouse: IFNAR KO: IFN-ɑbR/

Laboratory of Greg Barton €ller et al., 1994) (Mu

N/A

DNA 2.0

N/A

BD FACSDIVA v8.0.1

BD Biosciences

RRID:SCR_001456; http://www. bdbiosciences.com/us/instruments/ research/software/flow-cytometryacquisition/bd-facsdiva-software/m/ 111112/overview

FlowJo v10

FlowJo, LLC

RRID:SCR_008520; https://www. flowjo.com/solutions/flowjo/downloads

Cytobank release 6.1.2

Cytobank, Inc

RRID:SCR_014043; https://cytobank.org/

ImmunoSpot Software v3.2

Cellular Technology Limited

RRID:SCR_011082; http://www. immunospot.com/ImmunoSpotanalyzers-software

Recombinant DNA Plasmid: CMV-Cas9-2A-GFP encoding gRNA (GTCCAAGTTCGTGCGAGGCT) Software and Algorithms

(Continued on next page)

Cell Reports 25, 3074–3085.e1–e5, December 11, 2018 e2

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

FCAP Array Software v3.0

BD Biosciences

http://www.bdbiosciences.com/us/ applications/research/bead-basedimmunoassays/analysis-software/fcaparray-software-v30/p/652099

HALO Image Analysis Platform v2.1.1637.10

Indica Lab

www.indicalab.com/halo/

CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Sarah McWhirter ([email protected]). EXPERIMENTAL MODELS AND SUBJECT DETAILS Mice All animals were used according to protocols approved by Institutional Animal Use Committee of Aduro Biotech and maintained in pathogen-free conditions in a barrier facility. BALB/cJ, CByJ.SJL(B6)-Ptprca/J, C57BL/6J, B6.SJL-Ptprca Pepcb/BoyJ (CD45.1), and C57BL/6J-Tmem173gt/J mice were purchased from The Jackson Laboratory and Charles River Laboratories. IFNAR-KO mice €ller et al., 1994) were obtained as a kind gift of Greg Barton. Mice were allowed to acclimate to the housing facility for at least (Mu three days. All experiments were initiated using female mice between the ages of 6 and 8 weeks. B16.F10 tumor cells (and derivatives thereof) were implanted in mice of the C57BL/6 background whereas 4T1 tumor cells were implanted in mice of the BALB/c background. Cell Culture and Cellular Assays The cells used for the in vivo experiments were the C57BL/6-derived melanoma cell lines B16 and the breast cancer 4T1 cell line both originally purchased from ATCC. The melanoma derived B16.SIY (henceforth referred to as B16.SIY) (Blank et al., 2004) was obtained from the Gajewski lab, University of Chicago. The B16.SIY STING/ cells were generated using CRISPR-Cas9 targeting mouse tmem173. The B16, B16.SIY, and B16.SIY STING/ cells were maintained at 37C with 5% CO2 in DMEM high glucose medium containing 2 mM glutaMAX (GIBCO), 10% heat-inactivated FBS, 1% penicillin- streptomycin (GIBCO). The 4T1 cells were maintained at 37C with 5% CO2 in RPMI-1640 containing 2 mM glutaMAX (GIBCO), 10% heat-inactivated FCS, 1% penicillin-streptomycin, 1% sodium pyruvate (GIBCO), 1 mM HEPES buffer (HyClone), 1% NEAA (Corning), 55 mM b-Mercaptoethanol (GIBCO). METHOD DETAILS Flow Cytometry Single cell suspensions were stained with LIVE/DEAD NIR (Thermo Fisher) or LIVE/DEAD Zombie Green (BioLegend) and ɑ-CD16/ CD32 (BioXcell) before tetramer staining. The following MHC class I tetramers were used prior to antibody staining (MBL): H-2Ld MuLV gp70-SPSYVYHQF, H-2Kb SIYRYYGL, and H-2Kb MuLV p15E-KSPWFTTL. The following fluorophore-conjugated antibodies were used (BD Bioscience): ɑ-CD19, CD45, CD8ɑ, Granzyme B, CD4, CD11b, TNFɑ; (BioLegend): ɑ-Nkp46, MHC II, Ly6G, Ly6C, CD8ɑ, CD11c, CD90.2, CD25, Ki-67, T-bet, CXCR3, PD-1, CD28, IFNg, IL-2, IFNAR-1, CD45.1, CD45.2; (eBioscience): ɑ-CD4, FOXP3; (PBL): IFNb; and (Cell Signaling Technology): Cleaved Caspase 3. Note that the clone used to detect PD-1 on cells ex vivo was not blocked by the anti-PD-1 clone used in vivo (data not shown). For transcription factor, or cytokine and cleaved caspase 3 staining, cells were fixed and permeabilized with Fix/perm buffer (eBioscience, BD Biosciences, respectively) prior to intracellular staining. Data were acquired on a LSRFortessa X-20 (BD Biosciences) using FACSDiva software (BD Biosciences) and analyzed with FlowJo (TreeStar) or Cytobank software. For acute cytokine production 1 hour after IT injection with vehicle or CDN, tumors were processed in RPMI containing 10% FBS, HEPES buffer, and the Golgi transport inhibitors Monensin and Brefeldin A (BD Biosciences). Tumors were excised, minced, and homogenized using the gentleMACS Octo Dissociator (Miltenyi). Tumors were digested in media containing Golgi transport inhibitors, 2% Collagenase IV (Worthington), and ultrapure Benzonase (Sigma). TILs were incubated for 4 hours at 37C with 5% CO2 and then processed for flow cytometry. For cleaved caspase 3 staining 24 h after IT injection with vehicle or CDN, axillary or inguinal LNs were processed according to Section ‘‘Enzymatic Digestion of Lymph Nodes’’ to obtain single cell suspensions for flow cytometry. Enzymatic Digestion of LNs LNs were digested as previously described (Fletcher et al., 2011). Axillary or inguinal LNs were dissected, pierced once with fine tip forceps, and collected into RPMI on ice. RPMI was replaced with 2 mL enzymatic solution of RPMI containing 0.8 mg/mL dispase II

e3 Cell Reports 25, 3074–3085.e1–e5, December 11, 2018

(Sigma), 0.2 mg/mL collagenase P, and 0.1 mg/mL Dnase I (both from Roche), and incubated for 20 minutes (m) in a 37 C water bath. LNs were agitated by gentle pipetting every 5 m. After 20 m, supernatants were transferred to 10 mL ice cold FACS buffer containing 5 mM EDTA and 2% FBS in PBS. Cells were pelleted (300 x g, 4 m, 4 C) and resuspended in FACS buffer. Enzymatic solution was replaced, and LNs incubated for 10 m at 37 C with gentle agitation at 5 m and vigorous pipetting at 10 m. Supernatants were transferred to FACS buffer containing the first supernatant, pelleted, and resuspended in FACS buffer. Enzymatic solution was replaced a final time and LNs incubated at 37 C for 10 m with vigorous pipetting every 5 m at which point LNs were entirely dissociated, transferred to FACS buffer containing previous supernatants, washed, and filtered through a 70 mM cell strainer prior to staining for flow cytometry. Tumor Growth All tumor cells were injected subcutaneously into the flank in 100 mL of PBS. The concentration of 4T1 mammary carcinoma ranged from 2x105-1x106 cells. The concentration of B16 melanoma was 2x105 cells. The concentration of B16.SIY and B16.SIY STING/ was 1x106 cells. Mice were monitored for morbidity and mortality daily. Tumor size was measured twice per week and mice were sacrificed when tumor size reached 2000 mm3. Tumor sizes were measured using a digital caliper and tumor volumes calculated with the formula (length x width2)/2. Following tumor implantation, mice were randomized into treatment groups. In some experiments, tumor-free survivors were rechallenged with tumor cells on the opposite, non-injected flank several weeks after the collapse of the primary tumor. Naive mice were used as controls. Adoptive Cell Transfer CD45.1+ BALB/c mice bearing 4T1 tumors were treated with vehicle alone or 10, 50, or 500 mg CDN IT on day 9 after implantation. To deplete CD8+ T cells from a subset of spleens, cohorts of mice were injected the IP route with 100 mg ɑCD8ɑ (clone 2.43, BioXcell) one and two days prior to transfer. Total splenocytes (3x107), CD8+ T cell depleted splenocytes (3x107), or equivalent numbers of CD8+ T cells (5x106) enriched by negative selection (Stem Cell Technologies) were intravenously transferred into naive CD45.2+ BALB/c mice. Mice were implanted with 4T1 tumor cells one day following adoptive transfer. In vivo Immunotherapy STING intratumoral (IT) therapy consisted of injecting desired doses of S100 formulated in 40-50 mL of vehicle (HBSS or PBS buffer). IT injections were initiated when tumors grew to between 50-100 mm3, one exception being the PK study that was injected when tumors were 400 mm3. A 0.3 cc syringe with a 27-gauge needle was filled with test article and all air bubbles removed. Mice were anesthetized with isoflurane. With the bevel facing the skin, the needle was injected shallowly into the area directly adjacent to the tumor, and the needle was moved underneath the skin until it reached the inside back of the tumor. The test article was injected slowly into the center of the tumor. The needle was then removed delicately to avoid reflux. For multiple injection regimens, doses were allocated over the course of one week. Checkpoint blockade therapy consisting of 200 mg of ɑPD-1 (clone RMP1-14, BioXcell), and 200 mg of ɑCTLA-4 (clone 9D9, BioXcell) antibodies alone or in combination, or 200 mg isotype control antibodies (Rat IgG2a and Mouse IgG2b, respectively, BioXcell) was administered on days 10, 13, 16, 20, 24, 28, 32, 36 after implantation with B16 melanoma cells injected subcutaneously. For 4T1 breast cancer studies, mice were treated with 200 mg of ɑPD-1 or isotype control antibody on days 8 or 10, 13, 16, 20, 24, 28, 32, 36 after implantation. In Vivo Antibody Depletions and Blockade For CD8+ depletion studies, 4T1 tumor bearing mice were treated with 100 mg anti-CD8ɑ monoclonal antibody (clone 2.43, BioXcell) or 100 mg isotype control antibody (Rat IgG1, BioXcell) three times prior and two times after treatment with CDN IT. For depletion prior to rechallenge, 4T1 tumor bearing mice were treated with 100 mg of CDN on day 14 after tumor implantation. Mice that cleared their primary tumor received 100 mg of anti-CD8a or 100 mg of isotype control antibody on days 2 and 4 prior to rechallenge with 0.5 x106 4T1 cell injected subcutaneously in the opposite flank. For neutralization of TNFa, mice were injected the IP route with 200 mg of anti-TNF-a monoclonal antibody (clone XT3.11, BioXcell) or 200 mg or isotype control antibody (clone HRPN, Rat IgG1, BioXcell) on days 4, 7, 10 and 14. For IFNAR blockade, mice were injected the IP route with 200 mg of anti-IFNAR monoclonal antibody (clone MAR1-5A3, BioXcell) or 200 mg isotype control antibody (clone MOPC-21, BioXcell) on days 7 and 12. Ex vivo Restimulation Assays T cell responses were accessed by IFNg ELISPOT 7 days after IT injection of vehicle or CDN. Mice were bled in the retro-orbital sinus and PBMCs were isolated from whole blood using Mammal Lympholyte Cell Separation Media (Cedarlane). Spleens were dissociated and treated with ACK Lysis buffer to lyse red blood cells. 1x105 PBMCS or 2x105 splenocytes were plated per well in X-VIVO media containing 1% penicillin-streptomycin and stimulated overnight with media as a negative control, 1 mM SIY peptide (SIYRYYGL), 1 mM AH1 peptide (SPSYVYHQF, gp70423-431), or 1 mM P15e peptide (KSPWFTTL). Spots were developed using a mouse IFNg ELISPOT antibody pair (BD Biosciences) according to the manufacturer’s instructions, and the number of spots enumerated using an ImmunoSpot Series 3 Analyzer and ImmunoSpot software (Cellular Technology). T cells were assessed by Intracellular Cytokine Staining (ICS) 12 days after IT injection of vehicle or CDN. Tumors were excised, minced, and homogenized using the gentleMACS Octo Dissociator (Miltenyi). Tumors were digested in media containing 2% Collagenase IV (Worthington), and ultrapure

Cell Reports 25, 3074–3085.e1–e5, December 11, 2018 e4

Benzonase (Sigma). TILs were stimulated with 1 mM AH1 peptide and incubated for 5 hours at 37C with 5% CO2 and then processed for flow cytometry. Cytometric Bead Array (CBA) Serum was analyzed for cytokines by Mouse Inflammation Cytometric Bead Array (BD Biosciences) according to the manufacturer’s instructions. Data was acquired on a FACSVerse (BD Biosciences) and analyzed with FCAP Array Software Version 3.0 (BD Biosciences). Bone Marrow Chimeric Experiments Goldenticket or CD45.1+ C57BL/6 (WT) recipient mice received a total of 10 Gy in two doses (5 Gy, four h rest, 5 Gy) using an X-RAD 320 Biological Irradiator (Precision X-Ray).10x106 bone marrow cells from wild-type (WT) C57BL/6 or Goldenticket (Stinggt/gt, Gt) mice were transferred intravenously into either WT or Gt recipient mice immediately following irradiation, resulting in four sets of bone marrow chimeric mice. Mice reconstituted for > 16 weeks before initiation of tumor studies, with an interim bleed at 13 weeks to assess chimerism by flow cytometry. Generation of STING/ Tumor Cell Lines B16.SIY cells were transfected with plasmid CMV-Cas9-2A-GFP (DNA 2.0) encoding gRNA for mouse tmem173 (GTCCAAGTTCGTGCGAGGCT) using Lipofectamine 2000 (Invitrogen). After 48 h, GFP+ single clones were sorted for sequence analysis by PCR, STING activity by qPCR, and STING protein levels by Western blot. Four confirmed STING-/- clones were pooled to generate a master stock for experimentation. Detection of S100 S100 was quantified via LC/MS/MS at Climax Laboratories (San Jose, CA). Tumors were homogenized with 0.5mL water and diluted 5 fold with blank plasma. S100 was extracted with 100% acetonitrile and analyzed by an LC/MS/MS system, Sciex API-4000Qtrap Mass Spectrometer and a Shimadzu HPLC/Autosampler with a Keystone C18 column (2.1x150mm, 5mm). Positive Electronic Spray Ionization (ESI) and multiple reactions monitor (MRM) were used. The MRM transition of the test compound was 691/136 (m/z). The HPLC mobile phase A and B was 1% Formic acid in 5 mM NH4Ac solution and Acetonitrile/water (9/1) with 1% Formic acid. A related compound was used as an internal standard. The limit of quantification was 1.0 ng/mL and the dynamic range was 1.0-2000 ng/mL. Histopathology and Immunohistochemistry (IHC) Histology was performed by HistoWiz Inc. (histowiz.com) using standard operating procedures and a fully automated workflow. Samples were processed, embedded in paraffin, and sectioned at 5 mm. IHC was performed on a Bond Rx autostainer (Leica Biosystems) with heat mediated antigen retrieval using standard protocols. Rabbit polyclonal Cleaved Caspase 3 at 1:500 dilution was used as the primary antibody and was detected by Anti-rabbit Poly-HRP-IgG. Bond Polymer Refine Detection (Leica Biosystems) was used according to manufacturer’s protocol. Sections were then counterstained with hematoxylin, dehydrated, and film coverslipped using a TissueTek-Prisma and Coverslipper (Sakura). Whole slide scanning (40x) was performed on an Aperio AT2 (Leica Biosystems). Images were quantified using Halo image analysis software (Indica Lab) using the CytoNuclear module. QUANTIFICATION AND STATISTICAL ANALYSIS Data were analyzed in GraphPad Prism 6 software. Data with only two groups were analyzed by Unpaired Students t test. Data with multiple groups were analyzed by One- or Two-way ANOVA with Tukey or Sidak’s multiple comparisons test. Mean tumor volumes were analyzed by One or Two-way ANOVA with Tukey’s multiple comparisons test. Survival curves were analyzed by the log-rank (Mantel-Cox) test. Symbol representation, definition of center and dispersion are defined in the figure legends. n represents number of animals. Mean tumor growth statistics are based on an n of 8 unless specified otherwise in the figure legends. When bars are not used, comparisons are being made against the vehicle control group.

e5 Cell Reports 25, 3074–3085.e1–e5, December 11, 2018