Maize (Zea mays) growth and nutrient uptake following integrated improvement of vermicompost and humic acid fertilizer on coastal saline soil

Applied Soil Ecology 142 (2019) 147–154

Contents lists available at ScienceDirect

Applied Soil Ecology journal homepage: www.elsevier.com/locate/apsoil

Maize (Zea mays) growth and nutrient uptake following integrated improvement of vermicompost and humic acid fertilizer on coastal saline soil

T

⁎

Mengli Liu, Chong Wang , Fuyou Wang, Yongjin Xie College of Resources and Environmental Sciences, China Agricultural University, 2 Yuanmingyuan Xilu, Beijing 100193, China Beijing Key Laboratory of Biodiversity and Organic Farming, 2 Yuanmingyuan Xilu, Beijing 100193, China Key Laboratory of Plant-Soil Interactions, Ministry of Education, 2 Yuanmingyuan Xilu, Beijing 100193, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Soil salinity Soil microbial community Soil aggregates Illumina MiSeq sequencing Structural equation model

Soil salinity, poor soil structure and macronutrient deficiencies are three important limitations responsible for poor crop yields in coastal saline soil. Therefore, the objective was to investigate the integrated effects of humic acid fertilizer and vermicompost on maize growth and nutrient uptake in coastal saline soil. The experiment included three treatments: (1) control without humic acid fertilizer and vermicompost (CK); (2) treatment with humic acid fertilizer (H); (3) treatment with vermicompost (V). Soil salinity, aggregates, nutrient availability and uptake, the soil microbial community from next-generation high-throughput sequencing, maize biomass and yield were determined in this study. The results showed that humic acid fertilizer and vermicompost increased soil macroaggregates by 77.59–125.58% and 35.02–91.02%, respectively, which could efficiently decrease soil salinity. Proteobacteria, Actinobacteria and Acidobacteria were the dominant bacterial phyla, and Ascomycota was the dominant fungal phylum in this coastal saline soil. The humic acid fertilizer and vermicompost could affect the fungal community structure in the six-leaf stage (6S) and the bacterial community structure in the harvest stage (HS), which consequently improved soil nutrient availability and maize nutrient uptake. The humic acid fertilizer and vermicompost could enhance nitrogen (N) nutrient absorption of the maize plant in the vegetative growth period (6S) and the phosphorus (P) and potassium (K) nutrient absorption in the reproductive growth period (tasseling stage (TS) and harvest stage (HS)) of maize, which played an important role in increasing the maize yield in coastal saline soil. Therefore, the application of humic acid fertilizer and vermicompost can be integrated as a practice for improving coastal saline soil.

1. Introduction Soil salinization has become more serious and complicated in coastal zones worldwide, owing to specific hydrologic, geographic characteristics, shallow underground water tables, and groundwater salinization (Xie et al., 2017; Zhang et al., 2015). The accumulation of Na+ causes the degradation of soil structure, which can impact soil water and air movement, and root penetration (Bano and Fatima, 2009). However, the high salt concentration can also impose ion toxicity and osmotic stress, thereby adversely affecting soil microbial communities and their activity, which in turn decreases soil nutrient availability (Rousk et al., 2011; Tripathi et al., 2006). Therefore, high salt concentrations, nutrient deficiencies, degradation of the soil structure and poor microbial communities are the major limitations responsible for poor crop yields in coastal saline soil (Amundson et al.,

⁎

2015). The integrated improvement of the physical, chemical and biological soil properties should be pursued to improve nutrient uptake and grain yield of cereal crops in these regions. Organic matter, such as farmyard manure, green manure and organic amendments, can integrally improve the physical, chemical and biological properties in the saline soil (Liang et al., 2005; Mahdy, 2011). Vermicompost is a nutrient-rich, microbiologically active organic matter using earthworms to create a mixture of animal waste and crop residues (Ndegwa et al., 2000), containing the most nutrients present in plant-available form with high porosity, aeration, drainage, and water holding capacity (Edwards and Burrows, 1988). Previous studies showed that vermicompost could increase soil nutrient availability and enhanced the leaching out of Na+, which consequently alleviate salinity stress on plant in saline soil (Oo et al., 2015). Vermicompost could also improve plant growth and nutrient uptake in saline

Corresponding author at: College of Resources and Environmental Sciences, China Agricultural University, 2 Yuanmingyuan Xilu, Beijing 100193, China. E-mail address: [email protected] (C. Wang).

https://doi.org/10.1016/j.apsoil.2019.04.024 Received 28 March 2018; Received in revised form 20 April 2019; Accepted 20 April 2019 Available online 03 May 2019 0929-1393/ © 2019 Elsevier B.V. All rights reserved.

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

soil by improving the antioxidant enzyme activity of plant under greenhouse condition (Xu et al., 2016). Few reports have addressed whether vermicompost promotes plant growth and nutrient uptake under field conditions in coastal saline soil (Elayaraja and Singaravel, 2017). Furthermore, vermicompost has integrated improvements in plant growth, and it is unclear how vermicompost regulates the soil physical properties, nutrient availability and soil microbial communities in natural coastal saline soil. Humic acids are the principal components of humic substances, which are the major organic constituents in soils and are derived mainly from the (bio) chemical degradation of plant and animal residues by microbial synthetic activity (Gulser et al., 2010). Application of humic acid fertilizer could improve soil hydro-physical properties and nutrient availability, which consequently increase photosynthetic efficiency (Rady et al., 2016), plant growth and crop yields in saline soil (Osman and Rady, 2012). Additionally, humic acid fertilizer could also increase crop productivity by regulating microbial community in the rhizosphere of saline soil (Canellas and Olivares, 2014). However, few studies have focused on the integrated role of humic acid fertilizer on plant growth under field conditions by improving the soil microbial community and soil physicochemical amelioration in coastal saline soil. Maize is widely cultivated under a wide spectrum of soil and climatic conditions throughout the world, with total production surpassing wheat or rice. Maize is moderately sensitive to salt stress (Chinnusamy et al., 2005). Salt accumulation in topsoil has osmotic and ion-specific effects on maize, with adverse effects on germination, mineral uptake, grain development and yield (Farooq et al., 2014; Farooq et al., 2015). Understanding the effects of salt stress on the nutrient uptake, growth and yield of maize and finding the integrated improvement options may help to devise strategies for improved maize growth and yields in coastal saline soil. High salinity can also affect soil microbial composition and function, which in turn decreases the nutrient availability and plant growth in the saline soil (Chowdhury et al., 2011; Zhang et al., 2015). Currently, studies on microorganisms in saline alkali soil are focused on the bacterial activity and community structure (Liu et al., 2016). However, fungi can also grow in areas with high salt concentration as decomposers, which can degrade organic matter to inorganic molecules and play an essential role in nutrient cycling (Barea et al., 2005; Gadd, 2007). Therefore, it is necessary to study soil bacterial and fungal community at the same time in coastal saline soil. The overall objective of this study was to real the integrated improvement of humic acids fertilizer and vermicompost on the soil aggregates, nutrient availability and microbial communities structure, which led to greater nutrient uptake and maize yield in coastal saline soil.

colourimetric oxidization (Walkley, 1947). Results showed that the initial soil pH was 8.86, and the salinity was 1.23 dS m−1. The soil organic matter content was 11.06 g kg−1, and the total N was 0.8 g kg−1. The available P and exchangeable K were 17.11 and 445 mg kg−1, respectively. 2.2. Experimental design The experiment had a completely randomized design with four replications that had the following treatments (Fig. S1): (1) CK: treatment without humic acid fertilizer and vermicompost additions, which received chemical fertilizer with 100 kg N ha−1 as urea, 120 kg P ha−1 as superphosphate and 100 kg K ha−1 as potassium sulphate at sowing; (2) H: treatment with 3.75 t ha−1 humic acid fertilizer and chemical fertilizer (81.25 kg N ha−1 as urea, 86.25 kg P ha−1 as superphosphate and 100 kg K ha−1 as potassium sulphate) at sowing; and (3)V: treatment with 3.75 t ha−1 vermicompost and chemical fertilizer (58.75 kg N ha−1 as urea, 75 kg P ha−1 as superphosphate and 70 kg K ha−1 as potassium sulphate) at sowing. Humic acid fertilizer and vermicompost were provided by Shandong Shengkang Biotechnology Co., Ltd. Vermicompost was prepared from cow dung， and the nutrient composition of vermicompost was 1.1% N, 1.2% P, and 0.8% K. The composition of humic acid fertilizer was humic acid and fulvic acid. The nutrient composition of humic acid fertilizer was 0.5% N and 0.9% P. All three treatments applied 60 kg N ha−1 as urea and 45 kg K ha−1 as potassium sulphate in the six-leaf stage of maize. All three treatments had equal fertilization of N, P and K. There are four replicates of each treatment plot (11 × 13 m). Summer maize was sown on 20 June 2016. During the experiment, the produced straw was returned to the soil, the irrigation was optimized, and small amounts of pesticide and herbicide were used for pest control. 2.3. Soil sampling and analysis Shoot, root and soil samples were collected in the three different growth stages of maize, i.e., the six-leaf stage (6S, 16 July 2016), the tasseling stage (TS, 20 August 2016), and harvest stage (HS, 2 October 2016). Three plants were collected in per sampling plot. Shoots were cut at the soil surface. Roots were unearthed with a shovel, sieved through a 2-mm mesh screen and collected by handpicking, then washed with tap water and next with deionized water. The biomass of maize shoots and roots was determined by oven drying at 65 °C for 48 h. At harvest, maize ears were manually harvested as a subsample with a 5 m length and 4-row width, and the distance between two adjacent lines was 60 cm. The air-dried grains were weighed. The plant samples were ground with a stainless-steel grinder for nutrient analysis. The shoots and roots were digested with mixed H2SO4 and H2O2 (5:2, v/v) and then analysed for total N with the Kjeldahl method (Axmann et al., 1990). The microwave-accelerated reaction system (CEM, Matthews, NC, USA) was used to digest plant samples with HNO3–H2O2. Total P, K and Na concentrations in the digested solutions were determined by inductively coupled plasma optical emission spectroscopy (ICPOES, OPTIMA 3300 DV, Perkin–Elmer, USA). For each plot, three soil samples for the determination of soil aggregates were collected by a ring sampler (10 cm deep) and placed in an aluminium box (diameter of 10 cm). Soil aggregates were measured using the wet-sieving method, and the > 250 μm size fractions were defined as macroaggregates and the 20–250 μm size fractions were defined as micro-aggregates (Bast et al., 2015; Wilson et al., 2009). At the same sampling site, a tube type soil auger of 5 cm diameter was used to collect 3 undisturbed core soil samples per sampling plot down to a 20-cm depth. The three auger profiles were taken between two rows at a distance of 1.5 m from the plot edges and then mixed, homogenized and sieved through a 2-mm mesh screen to remove the shoot materials, roots, and stones. Soil subsample were stored at −80 °C for the analysis of the microbial community or air-dried for salt

2. Materials and methods 2.1. Site description The experimental field site with a wheat-maize rotation system is situated in Wudi County, Shandong Province, China (26°45′N, 111°52′E), on the south coast of Bohai Bay. The site has a temperate continental semi-humid monsoon climate with an average annual rainfall of ~575 mm (70% falls from June to August), a mean annual air temperature of 12.6–12.7 °C and mean annual evaporation of 1800 mm. The ground water level is approximately 0.9–1.1 m. The soil type for the field experiment was classified as Aquic Inceptisol with loam texture. The pH was determined in the extracts by soil/water 1:5, v/v. The soil salinity as indicated by electrical conductivity was determined in a 1:5 soil:water mixture. Total N was measured using the Kjeldahl method (Bremner, 1960), and the available P was extracted with 0.5 mol L−1 NaHCO3 and spectrophotometrically measured at 880 nm according to the procedure described by Olsen et al. (1954). Exchangeable K was determined using the procedure described by Metson (1957). Soil organic matter (SOM) was determined from K2Cr2O7 148

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

Table 1). While humic acid fertilizer just significantly decreased the soil salinity in the HS stage of maize (p < 0.05, Table 1).

concentration, organic matter, total N, available P, exchangeable K and Na concentration determinations within one month. The Na of the soil were digested with HNO3–HCl and then determined by inductively coupled plasma optical emission spectroscopy (ICPOES, OPTIMA 3300 DV, Perkin–Elmer, USA).

3.1.2. Soil organic matter and nutrient availability Compared to the control, H and V treatments significantly increased the SOM content in the TS and HS stages of maize (p < 0.05, Table 1). In the 6S and HS stages of maize, both the H and V treatments significantly increased the soil total N content compared to the control (p < 0.05, Table 1), whereas only the H treatment significantly increased the soil total N content in the TS stage of maize (p < 0.05, Table 1). Compared to the control, both the H and V treatments significantly increased the soil available P content in the 6S stage of maize (p < 0.05, Table 1). Moreover, the H and V treatments significantly increased the soil available P content in the TS and HS stages of maize (p < 0.05, Table 1), respectively. Both the H and V treatments significantly increased the soil exchangeable K content in the HS stages compared to the control (p < 0.05, Table 1). While the V treatment significantly decreased the soil exchangeable K content in the TS stage of maize (p < 0.05, Table 1).

2.4. DNA extraction, PCR amplification and Illumina-based sequencing DNA was extracted from 0.5 g of fresh soil with the EZNA Soil DNA Kit (Omega Bio-Tek, Inc., Norcross, GA, USA) according to the manufacturer's instructions. For the bacterial community analyses, the PCR primer pair 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) targeting the V3-V4 region of the 16S rRNA gene was used (Wang et al., 2016). For the fungal community analyses, we used PCR primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (TGCGTTCTTCATCGATGC) to amplify the ITS1 spacer (Holman et al., 2016). PCR amplification was performed in triplicate using TransStart Fastpfu DNA Polymerase (ABI GeneAmp® 9700, USA) in a total volume of 50 μl, which contained 5 μl of 10 × Pyrobest Buffer, 4 μl of 2.5 mM dNTPs, 2 μl of 10 μM of each primer, 0.3 μl of 2.5 U μl−1 Pyrobest DNA Polymerase (TaKaRa Code:DR005A) and 30 ng of template DNA. Then, the purified amplicons were pooled in equimolar concentrations and employed for library construction using the NEB Next R UltraTM DNA Library Prep Kit for Illumina (New England Biolabs, UK). All the library preparations for sequencing were performed using the Illumina MiSeq platform (Beijing Allwegene Technology Co., Ltd., China). Sequences were processed with the QIIME software package (version 1.17) and UPARSE pipeline. Raw FASTQ files were filtered by QIIME quality filter. Operational taxonomic units (OTUs) with 97% similarity cut off were clustered using UPARSE (version 7.1), and chimeric sequences were identified and removed using UCHIME. Representative sequences for each OTU were picked up to be used in the ribosomal database project (RDP) classifier to annotate the taxonomic information for each representative sequence.

3.2. Soil microbial community and diversity 3.2.1. Soil bacterial community and diversity For bacteria, a total of 947,598 sequences were classified into 4569 OTUs (defined at 97% sequence similarity) in the present study. Compared to the control, the H treatment significantly increased the number of OTUs in the TS stage, whereas the V treatment significantly increased the number of OTUs in the HS stage (p < 0.05, Table 1). Both H and V treatments had no significant effects on bacterial diversity in all three growth stages of maize (Table 1). The dominant phyla of the 16S rRNA sequences were clustered into Proteobacteria (44.95–31.72%), Actinobacteria (27.74–7.80%), Acidobacteria (21.62–6.44%), Chloroflexi (15.45–6.45%), Gemmatimonadetes (14.93–3.58%), Bacteroidetes (11.23–2.01%), Planctomycetes (2.86–0.50%), Verrucomicrobia (2.90–0.27%), Nitrospirae (1.43–0.47%) and Firmicutes (0.91–0.14%). Application of humic acid fertilizer and vermicompost had a significant impact on the bacterial taxa distribution. In the 6S stage, the H treatment significantly decreased the relative abundance of Proteobacteria, Actinobacteria, and Chloroflexi and increased the relative abundance of Acidobacteria, Gemmatimonadetes, Bacteroidetes, Planctomycetes and Verrucomicrobia (p < 0.05, Fig. 1A). Meanwhile, the V treatment significantly decreased the relative abundance of Actinobacteria and increased the relative abundance of Acidobacteria. In the TS and HS stages, the H treatment significantly decreased the relative abundance of Actinobacteria and Chloroflexi and increased the relative abundance of Acidobacteria, Gemmatimonadetes, Bacteroidetes, Planctomycetes and Verrucomicrobia (p < 0.05, Fig. 1A). In the TS stage, the V treatment significantly decreased the relative abundance of Chloroflexi and increased the relative abundance of Acidobacteria and Verrucomicrobia (p < 0.05, Fig. 1A). In the HS stage, the V treatment decreased the relative abundance of Chloroflexi, and significantly increased the relative abundance of Acidobacteria, Planctomycetes and Verrucomicrobia (p < 0.05, Fig. 1A). The number of unique bacterial genera in the H and V treatments was more than the number of unique bacteria in the controls (Fig. 1B).

2.5. Statistical analysis The variance analysis was performed using SPSS software, version 17.0 (SPSS Institute, Inc., Cary, NC, USA). Duncan's multiple range test was used to detect differences between treatments, and the significant differences were determined by Duncan at p < 0.05. Nonmetric multidimensional scaling (NMDS) was based on the Bray–Curtis distances of phyla relative abundance (RA). In addition, Anosim (analysis of similarity) was conducted to justify the statistical power using the microbiota data. Canoco (version 4.5, Microcomputer Power) was used to identify the microbial classes that primarily contributed to the variation in different treatments in a redundancy analysis (RDA). A structural equation model (SEM) was carried out using AMOS 21.0 to investigate the causal relationships between the maize yield, nutrient accumulation and plant K/Na ratio. The SEM is a multivariate statistical method that can offer scientific answers and causal understanding by testing hypothesized networks of path-relationships or causal relationships (Eisenhauer et al., 2015). 3. Results 3.1. Soil physicochemical properties

3.2.2. Soil fungal community and diversity For fungi, a total of 2,726,882 sequences were classified into 2048 OTUs (defined at 97% sequence similarity) in the present study. Compared to the control, the H treatments significantly increased the number of OTUs and the fungal diversity in the 6S and TS stages (p < 0.05, Table 1). The V treatment did not change the number of OTUs and the fungal diversity in all three growth stages of maize. The dominant phyla of the ITS rRNA sequences were clustered into Ascomycota (96.50–72.59%), Zygomycota (10.57–0.29%), Chytridiomycota

3.1.1. Soil aggregates and salinity Compared to the control, the H and V treatments significantly increased the proportion of soil macroaggregates (> 250 μm in diameter, p < 0.05) and decreased the proportion of soil microaggregates (20–250 μm, p < 0.05) in the three stages of maize (Table 1). Compared to the control, application of vermicompost could significantly decrease the soil salinity in the three growth stages of maize (p < 0.05, 149

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

Table 1 Soil physical, chemical and biological characteristics during the three growth stages of maize.

6S

TS

HS

Treatment

Macroaggregate (%)

Microaggregate (%)

Salinity (dS m−1)

Organic matter (g kg−1)

Total N (g kg−1)

Available P (mg kg−1)

Exechangeable K (mg kg−1)

Bacterial OTUs

Fungal OTUs

Bacterial diversity (shannon)

Fungal diversity (shannon)

CK H V CK H V CK H V

48.86c 86.77a 65.97b 39.75c 89.67a 75.93b 39.23c 88.05a 63.61b

45.54a 10.42c 29.77b 53.31a 6.85c 20.12b 53.17a 8.81c 32.27b

1.37 a 1.22ab 1.03 b 1.13 a 0.97 a 0.85 b 1.01 a 0.73 b 0.78 b

20.14b 22.85 a 21.99ab 14.48 c 17.82 a 15.57 b 15.12 b 21.24 a 21.18 a

1.22b 1.40a 1.35a 1.25b 1.45a 1.29b 1.20b 1.53a 1.41a

18.34b 21.67a 22.49a 19.64b 26.74a 18.94b 21.76b 26.13b 42.50a

535.43b 601.4a 539.04b 517.35a 513.74a 463.13b 483.07c 609.14a 515.49b

2406a 2378a 2371a 2365b 2541a 2469ab 2282b 2392ab 2470a

650b 838a 602b 620b 811a 630b 630a 685a 621a

9.21ab 9.28 a 9.10 b 9.27 a 9.37 a 9.23 a 9.37 a 9.33 a 9.35 a

4.77b 5.44a 4.83b 4.52b 5.83a 4.69b 5.23a 5.18a 5.03a

Mean values (n = 4) are shown. Different lowercase letters indicate significant differences among the three treatments (p < 0.05). CK is the control with chemical fertilizer; H is the alkali soil amended with humic acid fertilizer; V is the alkali soil amended with vermicompost. 6S is the six-leaf stage of the maize; TS is the tasseling stage of the maize; HS is the harvest stage of the maize.

Glomeromycota (p < 0.005, Fig. 1C). The number of unique fungal genera in the H treatment was more than the number of unique fungal genera in the controls (Fig. 1D).

(1.79–0.05%), Basidiomycota (5.53–0.28%) and Glomeromycota (0.95–0.01%). Application of humic acid fertilizer and vermicompost had a significant impact on the fungal taxa distribution. In the 6S and TS stages, the H treatment significantly decreased the relative abundance of Ascomycota and increased the relative abundance of Basidiomycota and Glomeromycota (p < 0.005, Fig. 1C), whereas the V treatment significantly decreased the relative abundance of Ascomycota in the 6S stage and increased the relative abundance of Basidiomycota in the TS stage (p < 0.005, Fig. 1C). In the HS stage, the H treatment significantly increased the relative abundance of Basidiomycota and

3.3. Maize cation and nutrient uptake, growth and yields 3.3.1. The cation content of maize shoots and roots Compared to the control, the H treatment significantly decreased the Na concentration of the maize shoots in the 6S and TS stages (p < 0.05, Table 2). The H treatment significantly decreased the Na

A

B

C

D

Fig. 1. Distribution and comparison of Illumina-based 16S rRNA gene (A) and ITS rRNA gene (C) metagenomic profiling. The Venn diagram depicts bacterial (B) and fungal (D) genera that are shared or unique for different treatments CK is the control with chemical fertilizer; H is the coastal saline soil amended with humic acid fertilizer; V is the coastal saline soil amended with vermicompost. The six-leaf stage of the maize is 6S; TS is the tasseling stage of the maize; HS is the harvest stage of the maize. 150

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

Table 2 Shoot and root biomass, nutrient uptake and K/Na of maize during the three growth stages of maize. Treatment Shoot

6S

TS

HS

Root

6S

TS

HS

CK H V CK H V CK H V CK H V CK H V CK H V

Biomass (g plant−1)

N content (g plant−1)

P content (g plant−1)

K content (g plant−1)

Na concentration(g kg−1)

K/Na

2.56b 11.59a 11.22a 102.67c 151.50a 125.33b 218.17c 308.13a 274.00b 0.52b 2.06a 2.09a 13.06b 20.00a 18.83a 16.00b 22.00a 17.50b

0.10b 0.44a 0.41a 1.89c 2.79a 2.22b 2.16b 3.01a 2.41b 0.014b 0.058a 0.059a 0.16a 0.20a 0.18a 0.16ab 0.20a 0.15b

0.010b 0.046a 0.047a 0.24c 0.38a 0.32b 0.14c 0.22b 0.26a 0.0014b 0.0059a 0.0062a 0.014b 0.025a 0.024a 0.009b 0.012a 0.014a

0.13b 0.67a 0.67a 2.69c 4.34a 3.30b 6.48b 9.97a 7.21b 0.012b 0.064a 0.057a 0.22c 0.43a 0.34b 0.22b 0.40a 0.29b

1.26a 0.28b 1.38a 0.58a 0.28b 0.55a 3.03b 3.13b 3.67a 10.68a 3.98b 10.52a 8.18a 4.37b 7.35a 8.62a 4.17b 7.39a

39.28b 207.25a 45.01b 48.79b 107.65a 49.42b 27.02b 42.74a 36.29a 2.02b 10.74a 2.57b 2.17b 5.92a 2.50b 1.57c 3.67a 2.35b

Mean values (n = 4) are shown. Different lowercase letters indicate significant differences among the three treatments (p < 0.05). CK is the control with chemical fertilizer; H is the alkali soil amended with humic acid fertilizer; V is the alkali soil amended with vermicompost. 6S is the six-leaf stage of the maize; TS is the tasseling stage of the maize; HS is the harvest stage of the maize.

concentration of maize roots in the three growth stages of maize (p < 0.05, Table 2). Compared to the control, only the H treatment significantly increased the K/Na ratio of maize shoots and roots in the 6S and TS stages (p < 0.05, Table 2), and both the H and V treatments significantly increased the K/Na ratio of maize shoots and roots in the HS stage (p < 0.05, Table 2). 3.3.2. The nutrient uptake of maize shoots and roots Compared to the control, both the H treatment and V treatment significantly increased the shoot C and P content of maize in the three stages of maize, and significantly increased the shoot N and K content of maize in the 6S and TS stages of maize (p < 0.05, Table 2). Whereas only the H treatment significantly increased the shoot N and K content in the HS stage of maize (p < 0.05, Table 2). Both the H treatment and V treatment significantly increased the root P content of maize in the three stages of maize compared to the control (p < 0.05, Table 2), and significantly increased the root C and K content in the 6S and TS stages (p < 0.05, Table 2). The H and V treatments significantly increased the root N content of maize only in the 6S stage (p < 0.05, Table 2).

Fig. 2. Changes maize yield in different treatments. Significant effects were found for all parameters at p < 0.05. CK is the control with chemical fertilizer; H is the coastal saline soil amended with humic acid fertilizer; V is the coastal saline soil amended with vermicompost.

root K/Na and shoot N content in the 6S stage indirectly affected the maize yield in the coastal saline soil (Fig. 3).

3.3.3. The biomass and yield of maize Compared to the control, both the H treatment and V treatment significantly increased the shoot biomass in the three stages of maize (p < 0.05, Table 2). The H treatment significantly increased the root biomass in the three stages of maize (p < 0.05, Table 2), whereas the V treatment significantly increased the root biomass in the 6S and TS stages of maize (p < 0.05, Table 2). The H treatment and V treatment significantly increased maize yield in the present study compared to the control (p < 0.05, Fig. 2). The results of the structural equation model (SEM) indicated that the model fit well with the data [χ2 = 1.2 (p = 0.881); DF = 4; comparative fit index (CFI) = 1.000; root mean square error of approximation (RMSEA) = 0.000] and explained 89% of the variance in the maize yield (Fig. 3A). Regarding the total effects, root K/Na in the 6S stage of maize (λ = 0.859) was the strongest predictor for maize yield in the harvest stage (HS), followed by shoot K/Na in the 6S stage of maize (λ = 0.737), shoot N content in the 6S stage of maize (λ = 0.432), shoot K content in the HS stage of maize (λ = 0.195), and shoot P content in the TS stage of maize (λ = 0.074) (Fig. 3B). This result indicated that humic acid fertilizer and vermicompost could increase the maize yield directly (i.e., by increasing shoot K/Na and shoot N content in the 6S stage, shoot P content in the TS stage and shoot K content in the HS stage), whereas the shoot K/Na,

4. Discussion 4.1. Improvement of humic acid fertilizer and vermicompost on macroaggregates in the coastal saline soil Generally, native coastal soils are highly argillaceous saline soils with poor porosity and permeability, and soil salinity has become a serious threat to crop productivity (Zhang et al., 2015). Our results demonstrated that application of humic acid fertilizer and vermicompost could significantly increase the proportion of soil macroaggregates in the three growth stages of maize in coastal saline soil (Table 1). Additionally, application of humic acid fertilizer and vermicompost also significantly increased the SOM content in the coastal saline soil, which had a positive relationship with the proportion of soil macroaggregates (Fig. 4), possibly due to the organic matter in the humic acid fertilizer and vermicompost combining with clay particles, which could improve microaggregate stability to form macroaggregates and improved the soil structure in coastal saline soil (Cong et al., 2017).

151

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

the main important limitations responsible for poor crop yields in coastal saline soil. Moreover, microbes play an important role in nutrient cycling and restoration of a degraded ecosystem. However, soil salinity has been reported to affect soil microbial community structure and activities (Rathore et al., 2017). Previous studies have shown that humic substances and vermicompost can effectively improve the biological properties of the saline soil (Oo et al., 2015; Schoebitz et al., 2016). In the current study, the application of humic acid fertilizer and vermicompost could increase bacterial and fungal OTUs (Table 1) and significantly influence the fungal community structure in the seedling stage of maize (6S), while significantly influencing the bacterial community structure in maturing stage of maize (HS) (Fig. 5). For bacteria, the results demonstrated that the humic acid fertilizer and vermicompost application increased the relative abundance of Acidobacteria, and decreased the relative abundance of Proteobacteria and Chloroflexi at all growth stages of maize in the coastal saline soil. Previous studies demonstrated that Acidobacteria play an important role in the nitrogen cycles of soil (Jimenez et al., 2012). In this study, soil total N was positively correlated with the abundance of Acidobacteria at the 6S stage (Fig. 4), suggesting that Acidobacteria could be the contributing factor for the increased concentration of total N in the H– and V-treated coastal saline soil. Proteobacteria are copiotrophic soil bacteria, and might be a nutrient competitor of plants (Ai et al., 2015). Chloroflexi is a green nonsulphur bacterium without nitrogen fixation capability; and may compete with crops for nitrogen resources (Kragelund et al., 2007). In this study, soil total N concentration and shoot N content had a negative correlation with the abundance of Chloroflexi and Proteobacteria (Fig. 4). Most likely humic acid fertilizer and vermicompost decreased Chloroflexi and Proteobacteria, thus stimulating the accumulation of soil total N and N uptake by maize. For fungi, the humic acid fertilizer and vermicompost application increased the relative abundance of Basidiomycota and Glomeromycota at all growth stages in the coastal saline soil (Fig. 1). The H and V treatments possibly increased the nutrient availability by increasing the relative abundance of Basidiomycota, which play a fundamental role in nutrient cycling, mostly affecting decomposition of plant residues (Gibertoni et al., 2015). Glomeromycota have the capacity to release protons for mobilization of insoluble soil phosphates (Schussler et al., 2001; Smith and Smith, 2011). In the present study, there was a significantly positive relationship between soil available P and Glomeromycota in the TS stage of maize (Fig. 4). Our results suggested that application of humic acid fertilizer and vermicompost possibly improved available P concentration by increasing the relative abundance of Glomeromycota in the coastal saline soil.

A

B 6S 6S 6S TS HS

Root K/Na Shoot K/Na Shoot N Shoot P Shoot K

Direct path Indirect path Total effect 0.859 0.859 0.445 0.292 0.737 0.350 0.082 0.432 0.075 0.075 0.195 0.195

Fig. 3. A structural equation model (SEM) (A) showing the causal relationship between root K/Na, shoot K/Na, shoot N content of maize in the 6S stage (sixleaf stage), maize shoot P content in the TS stage (tasseling stage), maize shoot K content and maize yield in the HS stage (harvest stage). Direct, indirect and total effect coefficients of each variable in relation to maize yield in the harvest stage (HS) (B).

4.2. Effect of humic acid fertilizer and vermicompost on soil microbial community and nutrient availability The nutrient deficiencies and poor microbial community are also

A

B

C

Fig. 4. Two-dimensional similarities of samples revealed by RDA ordination plots for the first two dimensions of the relationship between environmental parameters and major bacterial phylogenetic classes in the six-leaf stage (6S) (A), tasseling stage (TS) (B) and harvest stage (HS) (C). The environmental variables of the first two dimensions explained 89.6%, 91.1% and 94.7% of the variation in microbial composition in the three growth stages, respectively. CK is the control with chemical fertilizer; H is the coastal saline soil amended with humic acid fertilizer; V is the coastal saline soil amended with vermicompost. 152

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

Bacterial community structures

B

A

6S

TS

R-value

P-value

R-value

P-value

R-value

P-value

CK-H

1.00

0.026

1.00

0.029

0.896

0.036

CK-V

0.33

0.076

0.42

0.060

0.302

0.033

H-V

1.00

0.030

1.00

0.027

0.979

0.031

Stage

R-value=0.22

P-value=0.002

Treatment

R-value=0.668

P-value=0.001

All

R-value=0.789

P-value=0.001

Fungal community structures

D

C

HS

6S

CK-H

TS

HS

R-value

P-value

R-value

P-value

R-value

P-value

0.95

0.027

0.80

0.027

0.45

0.023

CK-V

0.57

0.033

0.19

0.140

0.10

0.321

H-V

0.99

0.033

0.94

0.041

0.39

0.065

Stage

R-value=0.175

P-value=0.001

Treatment

R-value=0.448

P-value=0.001

All

R-value=0.583

P-value=0.001

Fig. 5. Microbial structures under the different treatments at three growth stages of maize as analysed by non-metric multidimensional scaling (NMDS) analysis (A and C) and an analysis of similarities (Anosim) (B and D). The strength of the sample type grouping is denoted by p values for the ANOSIM R statistic, representing the strongest correlation as it approaches. CK is the control with chemical fertilizer; H is the coastal saline soil amended with humic acid fertilizer; V is the coastal saline soil amended with vermicompost. The six-leaf stage of the maize is 6S; TS is the tasseling stage of the maize; HS is the harvest stage of the maize.

4.3. Shoot biomass, nutrient content and maize yield after ameliorating saline soil by humic acid fertilizer and vermicompost

4.4. Root adaptation after ameliorating saline soil by humic acid fertilizer and vermicompost

Many studies have shown that increased sodium accumulation also disturbs iron nutrition, which plays an important role in photosynthesis and respiration (Kim and Guerinot, 2007). Our results showed that there was a significantly positive relationship between soil total N, available P and exchangeable K concentration, shoot N, P and K absorption and shoot biomass in the 6S, TS and HS stages of maize, respectively (Fig. 4), indicating that humic acid fertilizer and vermicompost can enhance the N, P and K absorption of maize shoots by increasing the total N, available P and exchangeable K concentrations in coastal saline soil, which consequently increase maize shoot and root biomass in the 6S, TS and HS stages, respectively. Overall, the integrated improvement of vermicompost and humic acid fertilizer on soil physicochemical and biological properties in coastal saline soil increased the salt tolerance and shoot N content in the vegetative growth period (6S stage) of maize and enhanced the P and K nutrient absorption in the reproductive growth period (TS and HS stages) of maize, which eventually increased the maize yield in the coastal saline soil (Fig. 3). Eventually, humic acid fertilizer and vermicompost could increase the economic benefit of inputs and produce in coastal saline soil (Table S1).

In saline soil, high sodium and chloride ions, due to salinity, in the rhizosphere causes severe nutritional imbalances and an impaired potassium/sodium ratio in root. The soil salinity was significantly different among treatments and stages (p < 0.001, p < 0.01, Table S2). In general, the soil salinity decreased with the growth of maize. The results indicated that there was a serious desalinization in growth stages of maize in coastal saline soil. In the TS and HS stages, the humic acid fertilizer and vermicompost significantly decreased the soil salinity, which had a significantly positive relationship with the macroaggregates (Fig. 4). This result suggests that the application of organic matter to saline soils could improve soil structure, resulting in higher permeability (Tejada and Gonzalez, 2006), which enhances leaching of the salt with rainfall (Rengasamy, 2010). And the improvement of potassium/sodium ratios in plant tissues and host plant nutrition can improve salt resistance in the host plants under saline conditions (Farooq et al., 2015). In the present study, humic acid fertilizer and vermicompost increased the root K/Na, while decreasing the root Na concentration. There was a negative relationship between root K/Na and soil salt salinity (Fig. 4). This result possibly indicated that humic acid fertilizer and vermicompost could improve the salt tolerance of maize root by increasing root K/Na, which was 153

Applied Soil Ecology 142 (2019) 147–154

M. Liu, et al.

attributed to the decrease of soil salinity in coastal saline soil. Additionally, application of humic acid fertilizer and vermicompost significantly increased the N, P and K absorption of maize roots, which had a positive relationship with soil total N, available P and exchangeable K concentration and a negative correlation with salt concentration in coastal saline soil (Fig. 4). The observation suggests that humic acid fertilizer and vermicompost may play an important role in maintaining the nutritional balances of maize root by increasing soil nutrient availability, which further led to improvement in the salt tolerance of maize roots in coastal saline soil.

Farooq, M., Hussain, M., Siddique, K.H.M., 2014. Drought stress in wheat during flowering and grain-filling periods. Crit. Rev. Plant Sci. 33, 331–349. Farooq, M., Hussain, M., Wakeel, A., Siddique, K.H.M., 2015. Salt stress in maize: effects, resistance mechanisms, and management. A review. Agron. Sustain. Dev. 35, 461–481. Gadd, G.M., 2007. Geomycology: biogeochemical transformations of rocks, minerals, metals and radionuclides by fungi, bioweathering and bioremediation. Mycol. Res. 111, 3–49. Gibertoni, T.B., Nogueira-Melo, G.S., de Lira, C.R.S., Baltazar, J.M., Santos, P.J.P., 2015. Distribution of poroid fungi (Basidiomycota) in the Atlantic Rain Forest in Northeast Brazil: implications for conservation. Biodivers. Conserv. 24, 2227–2237. Gulser, F., Sonmez, F., Boysan, S., 2010. Effects of calcium nitrate and humic acid on pepper seedling growth under saline condition. J. Environ. Biol. 31, 873–876. Holman, D.B., Hao, X.Y., Topp, E., Yang, H.E., Alexander, T.W., 2016. Effect of co-composting cattle nanure with construction and demolition waste on the archaeal, bacterial, and fFungal microbiota, and on antimicrobial resistance determinants. PLoS One 11. Jimenez, D.J., Andreote, F.D., Chaves, D., Montana, J.S., Osorio-Forero, C., Junca, H., Zambrano, M.M., Baena, S., 2012. Structural and functional insights from the metagenome of an acidic hot spring microbial planktonic community in the Colombian Andes. PLoS One 7. Kim, S.A., Guerinot, M.L., 2007. Mining iron: Iron uptake and transport in plants. FEBS Lett. 581, 2273–2280. Kragelund, C., Levantesi, C., Borger, A., Thelen, K., Eikelboom, D., Tandoi, V., Kong, Y.H., van der Waarde, J., Krooneman, J., Rossetti, S., Thomsen, T.R., Nielsen, P.H., 2007. Identity, abundance and ecophysiology of filamentous Chloroflexi species present in activated sludge treatment plants. FEMS Microbiol. Ecol. 59, 671–682. Liang, Y., Si, J., Nikolic, M., Peng, Y., Chen, W., Jiang, Y., 2005. Organic manure stimulates biological activity and barley growth in soil subject to secondary salinization. Soil Biol. Biochem. 37, 1185–1195. Liu, W.Q., Zhang, W., Liu, G.X., Zhang, Y.H., Zhang, G.S., 2016. Microbial diversity in the saline-alkali soil of a coastal Tamarix chinensis woodland at Bohai Bay, China. J. Arid. Land 8, 284–292. Mahdy, A.M., 2011. Soil properties and wheat growth and nutrients as affected by compost amendment under saline water irrigation. Pedosphere 21, 773–781. Metson, A.J., 1957. Methods of chemical analysis for soil survey samples. Soil Sci. 83, 245. Ndegwa, P.M., Thompson, S.A., Das, K.C., 2000. Effects of stocking density and feeding rate on vermicomposting of biosolids. Bioresour. Technol. 71, 5–12. Olsen, S.R., Cole, C.V., Watanabe, S., Dean, L.A., 1954. Estimation of available phosphorous in soils by extraction with sodium bicarbonate. In: USDA Circular 939, pp. 1–8. Oo, A.N., Iwai, C.B., Saenjan, P., 2015. Soil properties and maize growth in saline and nonsaline soils using cassava-industrial waste compost and vermicompost with or without earthworms. Land Degrad. Dev. 26, 300–310. Osman, A.S., Rady, M.M., 2012. Ameliorative effects of sulphur and humic acid on the growth, anti-oxidant levels, and yields of pea (Pisum sativum L.) plants grown in reclaimed saline soil. J. Hortic. Sci. Biotechnol. 87, 626–632. Rady, M.M., El-Mageed, T.A.A., Abdurrahman, H.A., Mahdi, A.H., 2016. Humic acid application improves field performance of cotton (Gossypium barbadense L.) under saline conditions. J. Anim. Plant Sci. 26, 487–493. Rathore, A.P., Chaudhary, D.R., Jha, B., 2017. Seasonal patterns of microbial community structure and enzyme activities in coastal saline soils of perennial halophytes. Land Degrad. Dev. 28, 1779–1790. Rengasamy, P., 2010. Soil processes affecting crop production in salt-affected soils. Funct. Plant Biol. 37, 613–620. Rousk, J., Elyaagubi, F.K., Jones, D.L., Godbold, D.L., 2011. Bacterial salt tolerance is unrelated to soil salinity across an arid agroecosystem salinity gradient. Soil Biol. Biochem. 43, 1881–1887. Schoebitz, M., Lopez, M.D., Serri, H., Martinez, O., Zagal, E., 2016. Combined application of microbial consortium and humic substances to improve the growth performance of blueberry seedlings. J. Soil Sci. Plant Nut. 16, 1010–1023. Schussler, A., Schwarzott, D., Walker, C., 2001. A new fungal phylum, the Glomeromycota: phylogeny and evolution. Mycol. Res. 105, 1413–1421. Smith, S.E., Smith, F.A., 2011. Roles of arbuscular mycorrhizas in plant nutrition and growth: new paradigms from cellular to ecosystem scales. Annu. Rev. Plant Biol. 62 (62), 227–250. Tejada, M., Gonzalez, J.L., 2006. The relationships between erodibility and erosion in a soil treated with two organic amendments. Soil Till. Res. 91, 186–198. Tripathi, S., Kumari, S., Chakraborty, A., Gupta, A., Chakrabarti, K., Bandyapadhyay, B.K., 2006. Microbial biomass and its activities in salt-affected coastal soils. Biol. Fert. Soils 42, 273–277. Walkley, A., 1947. A critical examination of a rapid method for determining organic carbon in soils—effect of variations in digestion conditions and of inorganic soil constituents. Soil Sci. 63, 251–264. Wang, J., Chao, X., Yang, S., Wang, L., Huang, Q.W., Shen, Q.R., 2016. Wheat and rice growth stages and fertilization regimes alter soil bacterial community structure, but not diversity. Front. Microbiol. 7, 1207–1219. Wilson, G.W.T., Rice, C.W., Rillig, M.C., Springer, A., Hartnett, D.C., 2009. Soil aggregation and carbon sequestration are tightly correlated with the abundance of arbuscular mycorrhizal fungi: results from long-term field experiments. Ecol. Lett. 12, 452–461. Xie, W.J., Wu, L.F., Zhang, Y.P., Wu, T., Li, X.P., Ouyang, Z., 2017. Effects of straw application on coastal saline topsoil salinity and wheat yield trend. Soil Till. Res 169, 1–6. Xu, L., Yan, D., Ren, X.Y., Wei, Y.Y., Zhou, J., Zhao, H.Y., Liang, M.X., 2016. Vermicompost improves the physiological and biochemical responses of blessed thistle (Silybum marianum Gaertn.) and peppermint (Mentha haplocalyx Briq) to salinity stress. Ind. Crop. Prod. 94, 574–585. Zhang, T., Wang, T., Liu, K.S., Wang, L.X., Wang, K., Zhou, Y., 2015. Effects of different amendments for the reclamation of coastal saline soil on soil nutrient dynamics and electrical conductivity responses. Agr. Water Manage. 159, 115–122.

5. Conclusions Application of humic acid fertilizer and vermicompost can be integrated as a practice for improving coastal saline soil by increasing soil macroaggregate proportions, decreasing soil salinity and regulating soil microbial community structure. Ultimately, humic acid fertilizer and vermicompost may increase the salt tolerance of maize roots and the soil nutrient availability by changing the abundance of the dominant saline soil bacteria (Acidobacteria) and fungi (Basidiomycota and Glomeromycota), and consequently improve maize shoot and root N, P and K content, biomass and yield in the coastal saline soil. Acknowledgements This work was funded by the National Natural Science Foundation of China (Key Program, U1706211), the National Key Projects in the Science & Technology Pillar Programme during the Twelfth Five-year Plan Period (2013BAD05B03), the Innovative Group Grant of the National Science Foundation of China (31421092), and the National Key Research and Development Program (2016YFE0101100). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.apsoil.2019.04.024. References Ai, C., Liang, G.Q., Sun, J.W., Wang, X.B., He, P., Zhou, W., He, X.H., 2015. Reduced dependence of rhizosphere microbiome on plant-derived carbon in 32-year long-term inorganic and organic fertilized soils. Soil Biol. Biochem. 80, 70–78. Amundson, R., Berhe, A.A., Hopmans, J.W., Olson, C., Sztein, A.E., Sparks, D.L., 2015. Soil and human security in the 21st century. Science 348. Axmann, H., Sebastianelli, A., Arrillag, J., 1990. Sample preparation techniques of biological material for isotope analysis. In: Use of Nuclear Techniques in Studies of Soil-plant Relationship. Internactional Atomic Energy Agency, Viena, Austria, pp. 41–53. Bano, A., Fatima, M., 2009. Salt tolerance in Zea mays (L). following inoculation with Rhizobium and Pseudomonas. Biol. Fert. Soils 45, 405–413. Barea, J.M., Pozo, M.J., Azcon, R., Azcon-Aguilar, C., 2005. Microbial co-operation in the rhizosphere. J. Exp. Bot. 56, 1761–1778. Bast, A., Wilcke, W., Graf, F., Luscher, P., Gartner, H., 2015. A simplified and rapid technique to determine an aggregate stability coefficient in coarse grained soils. Catena 127, 170–176. Bremner, J., 1960. Determination of nitrogen in soil by the Kjeldahl method. J. Agric. Sci. 55, 11–33. Canellas, L.P., Olivares, F.L., 2014. Physiological responses to humic substances as plant growth promoter. Chem. Biol. Technol. Agric. 1, 3–13. Chinnusamy, V., Jagendorf, A., Zhu, J.K., 2005. Understanding and improving salt tolerance in plants. Crop Sci. 45, 437–448. Chowdhury, N., Marschner, P., Burns, R., 2011. Response of microbial activity and community structure to decreasing soil osmotic and matric potential. Plant Soil 344, 241–254. Cong, P.F., Ouyang, Z., Hou, R.X., Han, D.R., 2017. Effects of application of microbial fertilizer on aggregation and aggregate-associated carbon in saline soils. Soil Till. Res. 168, 33–41. Edwards, C.A., Burrows, I., 1988. Potential of earthworm composts as plant growth media. In: Earthworms in Waste & Environmental Management. Eisenhauer, N., Bowker, M.A., Grace, J.B., Powell, J.R., 2015. From patterns to causal understanding: structural equation modeling (SEM) in soil ecology. Pedobiologia 58, 65–72. Elayaraja, D., Singaravel, R., 2017. Effect of vermicompost and micronutrients fertilization on the growth, yield and nutrients uptake by sesame (Sesamum indicum L.) in coastal saline soil. Internat. J. agric. Sci. 13, 177–183.

154