Mallory body forming cells express the preneoplastic hepatocyte phenotype

Experimental and Molecular Pathology 80 (2006) 109 – 118 www.elsevier.com/locate/yexmp

Mallory body forming cells express the preneoplastic hepatocyte phenotype Li Nan, Fawzia Bardag-Gorce, Yong Wu, Jun Li, Barbara A. French, Samuel W. French ⁎ Harbor-UCLA Medical Center, Department of Pathology, Los Angeles Biomedical Research Institute, 1000 W. Carson St., Torrance, CA 90502, USA Received 1 November 2005, and in revised form 1 November 2005 Available online 18 January 2006

Abstract The livers of mice fed diethyl 1,4-dihydro-2,4,6,-trimethyl-3,5-pyridinedicarboxylate (DDC) for 10 weeks formed Mallory bodies (MBs) in clusters of hepatocytes. Mice withdrawn from DDC for 9 months developed liver tumors. In the present study, the phenotype of the hepatocytes that formed MBs and tumors was characterized. Immunoperoxidase and immunofluorescent stains were done on the DDC-treated mouse livers, as well as mouse liver tumors and a human hepatocellular carcinoma that formed MBs. Antibodies to markers of hepatocellular neoplasms such as αfetoprotein (AFP), ubiquitin B (UbB) fatty acid synthase (FAS) and α2 macroglobulin (A2m) stained the MB forming cells positive. Quantitative real-time RT-PCR assay was used to measure AFP, UbB, FAS and GCP-3 A2m mRNA levels in the livers of DDC fed mice and the DDC-induced mouse liver tumors. The FAS, UbB, GPC-3 and AFP mRNA levels were significantly increased in the MB forming liver cells. The in vitro model of MB formation was used to correlate MB formation with gene and protein expression. Primary cultures of DDC-primed hepatocytes were compared with the controls. A2m and UbB expression increased in the primary cultures of DDC-primed hepatocytes when MBs formed. Thus, the tumor markers used to identify hepatocellular carcinoma were upregulated in cells forming MBs in vivo and in vitro, suggesting that MB forming cells express preneoplastic phenotypic features. © 2005 Elsevier Inc. All rights reserved.

Introduction Mallory bodies (MBs) are aggresomes which form in many chronic liver diseases (French et al., 2001). Tazawa et al. (1983) observed that the Mallory body (MB) forming hepatocytes were altered to overexpress gamma glutamyl transferase (GGT), a marker for preneoplastic change in mice (Tazawa et al., 1983; Meierhenry et al., 1981, 1983; Cadrin et al., 1990; Nagao et al., 1999). Mice fed griseofulvin for 5 months developed clusters of MB forming hepatocytes. Mice fed for a longer period developed hepatocytic nodules and hepatocellular carcinomas (Tazawa et al., 1983; Cadrin et al., 1990; Nagao et al., 1999). A study of human hepatocellular carcinoma (HCC), which developed in chronic liver disease including viral hepatitis and alcoholic cirrhosis, supported the concept that liver cells forming MBs were preneoplastic (Nakanuma and Ohta, 1985; Iwaya and Mukai, 2005). Recently, it was shown that patients with hepatitis C and elevated serum α-fetoprotein were in association with MB formation (Bisceglie et al., 2005). This idea that MB forming hepatocytes may be preneoplastic was ⁎ Corresponding author. Fax: +1 310 222 5333. E-mail address: [email protected] (S.W. French). 0014-4800/$ - see front matter © 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexmp.2005.11.001

further supported by data derived from an experiment where mice were fed DDC for 10 weeks, followed by DDC withdrawal, followed by refeeding DDC for 7 days (Nagao et al., 1998). In this experiment, it took 10 weeks of DDC feeding for MBs to form, but only 7 days to reform, when DDC was later refed. Nuclei stained positive with the antibody to proliferating cell nuclear antigen (PCNA). It was present in the nuclei of hepatocytes that were forming MBs during DDC refeeding, indicating that these cells were proliferating (Nagao et al., 1998). Northern blot analysis for mRNA indicated that the genes for cytokeratin 8, transglutaminase, ubiquitin, c-myc and c-jun were upregulated during MB formation (Nagao et al., 1998). The gel shift assay for AP-1 activation, an indicator of cell proliferation, was increased. Thus, it was suggested that MB forming hepatocytes express genes involved in cell proliferation (Nagao et al., 1998). Several proteins, including α-fetoprotein (AFP), fatty acid synthase (FAS), α2 macroglobulin (A2m) and glypican-3 (GPC3) have been associated with hepatocarcinogenesis (Sukata et al., 2004; Marrero and Lok, 2004; Evert et al., 2005; Capurro et al., 2003). AFP, a major transport protein in the fetus, has long served as a serum marker in the clinical diagnosis of liver cancer (Abelev, 1971; Gillespie and Uversky,

110

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

2000). Elevated serum AFP levels have been associated with various liver diseases and hepatic regeneration including acute and chronic viral hepatitis, liver cirrhosis and HCC. AFP has been an important serum marker for diagnosing HCC, although it is not sensitive for the early detection of HCC (Marrero and Lok, 2004). Besides this, AFP has many important physiological functions: as a binding protein which transports ligands (Sotnichenko et al., 1999) and as an anticancer drug-ligand carrier (Severin et al., 1997). As a growth regulator, AFP is capable of both enhancement and inhibition of growth (Bennett et al., 1998; Mizejewski, 1997; Semenkova et al., 1997; Wang and Xu, 1998). FAS is the key enzyme of de novo fatty acid synthesis in rodents and humans. It is usually expressed at low levels in most adult tissues. However, it is expressed at a higher level in the liver, in the lactating breast, and during embryonic development (Chirala et al., 2003; Kusakabe et al., 2000). Some human neoplasms overexpress FAS including breast (Alo et al., 2001; Milgraum et al., 1997), colorectal (Rashid et al., 1997; Visca et al., 1999), gastric (Kusakabe et al., 2002) and prostate adenocarcinomas (Swinnen et al., 2002), as well as oral (Krontiras et al., 1999) and pulmonary squamous cell carcinomas (Piyathilake et al., 2000). Its overexpression is often associated with a worse prognosis (Epstein et al., 1995; Kuhajda et al., 1994; Takahiro et al., 2003). FAS is overexpressed in N-nitrosomorpholine and insulin-induced HCC of the rat (Abelev, 1971). FAS overexpression is an early marker in spontaneous, hormonally and chemically induced rat hepatocellular carcinoma (Abelev, 1971). A2m, a homotetrameric major acute-phase glycoprotein (Northemann et al., 1983; Schreiber et al., 1982), is capable of inhibiting many proteinases of all classes by means of steric entrapment and covalent binding (Barrett and Starkey, 1973). It also plays a role as a carrier protein and regulator for various growth factors, polypeptide hormones and cytokines (Chu et al., 1991; Dennis et al., 1989; Huang et al., 1984, 1988; James et al., 1990). Many authors have reported that upregulation of serum A2m is associated with HCC in humans (Kar et al., 1987). As a result, A2m has been included as a candidate serological marker for the diagnosis of HCC (Kotaka et al., 2002; Poon et al., 2001). Recently, A2m has been reported to be a novel cytochemical marker in preneoplastic and neoplastic rat liver lesions which are undetectable by other well-established cytochemical markers, such as γ-GGT and particularly placental glutathione S-transferase (GST-P) (Sukata et al., 2004). A2m mRNA was overexpressed in GST-P-negative hepatocellular altered foci (HAF), hepatocellular adenoma (HCA) and hepatocellular carcinoma (HCC). Distinctive immunohistochemical staining for A2m was consistently demonstrated in GST-P-negative HAF, HCA and HCC (Marrero and Lok, 2004). Glypican-3 (GPC-3) is a member of the glypican family of glycosyl phosphatidylinositol-anchored cell-surface heparan sulfate proteoglycans (Gillespie and Uversky, 2000). GPC-3 is expressed at the protein level in most HCCs, but it is undetectable in normal liver and benign hepatic lesions, including dysplastic foci and cirrhotic nodules (Zhu et al.,

2001). In addition, GPC-3 is significantly elevated in the serum of a large proportion of patients with HCC (Gillespie and Uversky, 2000; Bardag-Gorce et al., 2002). In the present study, the phenotype of the liver cells which potentially form MBs when DDC is refed (drugprimed hepatocytes) and induced hepatocytic tumors was compared with livers of control mice using Western blot, quantitative PCR, immunofluorescence and immunoperoxidase methods of analysis. Several proteins which characterized the cells that potentially form MBs and tumors were identified including UbB, AFP, FAS, GPC-3 and A2m. The MB forming cells responded to DDC refeeding to form MBs in 7 days and formed tumors after DDC was withdrawn for 9 months. The drug-primed livers were upregulated to form MBs spontaneously, when cultured for 6 days in primary culture. Preneoplastic hepatocellular changes have been identified morphologically and by phenotypic molecular markers in human liver (Takashima et al., 2005; Libbrecht et al., 2005). In fact, it has been possible to identify changes in dysplastic liver cell nodules and hepatocellular carcinoma using gene expression profiling (Nam et al., 2005).

Materials and methods Animals Experiment 1. One-month-old C3H male mice (Harlan Sprague–Dawley, San Diego, CA) were divided into 4 groups for quantitative real-time RT-PCR assay of the liver, n = 3. Group 1: 3 control mice were fed a protein-rich semisynthetic, complete standard control diet (Teklad, Madison, WI). These mice were treated IP with saline, 0.2 ml every second day for 15 weeks. Group 2: 3 mice were fed the control diet plus 0.1% diethyl 1,4-dihydro-2,4,6,-trimethyl3,5-pyridinedicarboxylate (DDC, Aldrich, St. Louis, MO) for 10 weeks to induce MB formation in vivo. Group 3: 3 mice were fed DDC 10 weeks and then withdrawn from DDC for 5 weeks at which time MBs had almost completely disappeared. Group 4: 6 mice were fed DDC 10 weeks, withdrawn 4 weeks then fed the DDC diet plus chlormethiazole (80 mg/kg) (CMZ, a gift from Dr. Magnus Ingleman-Sundberg) for 1 week to enhance MB formation (Nan et al., 2005). Mice used here were the same mice used in two previous studies (Wu et al., 2005; Nan et al., 2005). Experiment 2. For primary liver cell cultures, 3 control mice were fed the control diet (group 1) and mice were withdrawn from DDC and CMZ in the diet for 4–6 weeks (group 3). At this time, the MBs had almost completely disappeared (drug-primed mice). Experiment 3. 11 group 2 mice were withdrawn from the drug for 8–9 months and then were sacrificed to check for liver tumors. 11 group 2 mice were withdrawn from the drug for 13–14 months before sacrifice. 5 control mice were fed the control diet for 9 months. All mice were treated in a humane manner as approved by the Animal Care Committee at Harbor-UCLA Research and Education Institute according to the Guidelines of the National Academy of Science. The mice livers were used to extract RNA for quantitative real-time PCR assay and to extract protein for Western blot. A portion of the livers was fixed in 10% formalin for immunofluorescent and immunoperoxidase staining.

Tissue cultures The livers of both drug-primed (group 3) and control mice (group 1) were then perfused to isolate hepatocytes for use in the primary cultures. This is the primary tissue culture model used to study spontaneous MB formation in vitro (Nan et al., 2005).

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118 Table 1 Sequences of the primers used in quantitative real-time RT-PCR assay

111

MBs and phenotype. The hepatocytes were plated at a density of 105 per well on six-well plates containing fibronectin (Biochemical Technologies INC., Stoughton, MA)-coated glass coverslips. The cells were collected at 3 h, 24 h, 48 h and 6 days of culture.

Genes (mouse)

Sequences (5′–3′)

Accession number

AFP

F: ACCCGCTTCCCTCATCCT R: GAAGCTATCCCAAACTCATTTTCG F TTCGGCGGTCTTTCTGTGA R: CAAATGTGATGAAAGCACAAACC F: GGAAGGCTGGGCTCTATGG R: GGCGTCGAACTTGGAGAGATC F: CTTCTATTATCTGATGATGGCAAAGG R: CCTGCGTCACAGGCAGAAC F: CAACTGCGCTTCCTTGCA R: CCGGAGCATCGTCCACAT

NM_007423

Immunofluorescent staining and antibodies

NM_011664

Four-micron sections were cut from formalin-fixed, paraffin-embedded mouse liver tissue specimens and mounted on poly-L-lysine-coated slides. The sections were treated with Antigen Retrieval CITRA (Biogenex, San Ramon, CA), microwaved and blocked with normal second antibody host serum. The cells in culture were treated in the same way as the tissue sections except that microwaving was not used for antigen retrieval. NP40 (0.1%) was used to permeabilize the cells. The primary antibodies used for the immunofluorescent single or double antibody staining included: rabbit polyclonal anti-ubiquitin (Ub) (DAKO, Carpinteria, CA), mouse monoclonal antiubiquitin, mouse monoclonal antibody to p62 (Santa Cruz, CA), mouse monoclonal anti-CK8 (RDI, Flanders, NJ), rabbit anti-AFP (DAKO, Carpinteria, CA), rabbit anti-FAS (Novus Biologicals, Littleton, CO) and goat anti-A2m (Abcam Inc., Cambridge, MA). In all double stains, the primary antibodies were from two different species, i.e. rabbit and mouse. Binding of the primary antibodies was detected with Texas-Red-conjugated and FITC-conjugated secondary antibodies (Jackson, West Grove, PA). DAPI was used for nuclear staining. The MBs were examined using a Nikon 400 fluorescent microscope with a triple color band cube to detect simultaneously FITC, Texas Red and DAPI staining. A yellow fluorescence indicated colocalization of two different antigens.

UbB FAS A2m GPC3

NM_007988 NM_175628 NM_016697

Hepatocyte isolation Mice were anesthetized with 33% ketamine (Phoenix, St. Joseph, MD), and a catheter was inserted into the hepatic vein. The livers were perfused in a retrograde manner with PBS containing 100 U/ml collagenase type 1 (Sigma, St. Louis, MO) and 0.1 U/ml elastase (Worthington, Lakewood, NJ). After perfusion, the livers were removed, and the cells were dispersed in William's E serum-free medium (Sigma, St. Louis, MO) containing fatty acid free bovine serum albumin (5 mg/ml), insulin (2.4 U/L), dexamethasone (3.9 μg/ml), and ornithine (67 μg/ml). The cell suspensions were monitored for the presence of

Fig. 1. AFP was colocalized with Ub in MBs, clusters of altered mouse hepatocytes and a human HCC. Ub (Texas Red) and AFP (FITC) immunofluorescent double staining was used. (A) Control mouse (group 1) (Tricolor filter). 840×. (B) DDC-primed mice (group 2), white arrows point to MB forming cells, black arrow points to normal cells between clusters of hepatocytes which were forming MBs (Tricolor filter). 840×. (C) AFP (FITC) staining of the same cells in B, white arrows point to MBs. (D) Withdrawn mouse (group 3) white arrows point to AFP-stained hepatocytes without MBs (Tricolor filter). 840×. (E) DDC + CMZ refed mouse (group 4), white arrow points to MBs (Tricolor filter). 840×. (F) FITC filter used to view the same field as E, white arrows point to MBs. 840×. (G) A DDC-induced mouse liver tumor 9 months after DDC withdrawal, white arrows point to MBs (Tricolor filter). 840×. (H) Human HCC, white arrows point to MBs (Tricolor filter). 840×. (I) Same cells as shown in H, white arrows point to MBs (FITC filter). 840×.

112

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

Immunoperoxidase staining and antibodies Four-micron sections were cut from formalin-fixed, paraffin-embedded mouse liver tissue specimens and mounted on poly-L-lysine-coated slides. The primary antibodies used in the staining include: mouse monoclonal anti-PCNA (DAKO, Carpinteria, CA) and mouse monoclonal anti-cyclin D-1 (Novocastra, Newcastle upon Tyne, United Kingdom). Goat anti-mouse polyclonal antibody HRP-conjugated (DAKO, Carpinteria, CA) was used as the secondary antibody. The slides with anti-PCNA immunoperoxidase staining were double stained with anti-AFP immunofluorescent staining (method and anti-AFP antibody were mentioned above). The results were examined under light microscopy for immunoperoxidase staining and a Nikon 400 fluorescent microscope to detect FITC staining.

Quantitative real-time RT-PCR assay Total liver RNAs were extracted with Ultraspec™ RNA Isolation System (Biotecx Laboratories, Houston, TX) followed by DNase digestion. Synthesis of cDNAs was performed with 5 μg total RNA, 200 ng random primers using SuperSriptIII RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, CA). PCR primers were designed with the assistance of the Primer Express software (Applied Biosystems, Foster City, CA), as shown in Table 1. Quantitative PCR was achieved using the SYBR Green JumpStart™ Tag ReadyMix (Sigma, St. Louis, MO) on an ABI PRISM 7700 Sequence Detector System (Applied Biosystems, Foster City, CA). The thermal cycling consists of an initial step at 50°C for 2 min followed by a denaturation step at 95°C for 10 min then 40 cycles at 95°C for 15 s and 60°C for 1 min. Single PCR product was confirmed with the heat dissociation protocol at the end of the PCR cycles. Each data point was repeated three times. Quantitative values were obtained from the threshold PCR cycle number (Ct) at which point the increase in signal associated with an exponential growth for PCR product starts to be detected. The target mRNA abundance in each sample was normalized to its 18S level as ΔCt = Cttarget gene − Ct18S. For each target gene, the highest ΔCt was assigned as ΔCt max. The relative mRNA abundance were calculated as 2ÄÄCt, (group x) = ÄCtmax (group X) − ÄCt max (control group).

Western blot analysis Proteins (50 μg) from the cultured hepatocytes were fractionated by size on a 12% SDS-PAGE gel and transferred to a PVDF membrane (Bio-Rad, Hercules, CA) for 1 h in 25 mM Tris–HCl (pH 8.3), 192 mM glycine and 20% methanol. The same antibodies used for the immunofluorescent staining were used for the immunoblot analysis. Goat anti-rabbit polyclonal antibody HRP-conjugated (Cell signal, Beverly, MA) was used as the second antibody. The membranes were subjected to chemiluminescence detection using luminal, according to the manufacturer's instruction (Amersham Pharmacia Biotech, Piscataway, NJ). The membranes were stripped and re-probed with an anti-GAPDH monoclonal antibody (Sigma, St. Louis, MO) in order to normalize the protein used in each gene. The difference in protein levels was determined by densitometric analysis.

Statistics Statistical analysis was performed using ANOVA t test and Bonferoni for multiple group comparison (SigmaStat software). Significance was defined as P b 0.05.

Results Experiment 1 The livers of mice fed DDC for 10 weeks (group 2) had clusters of altered hepatocytes which formed MBs (Figs. 1B, 2C). When DDC was withdrawn for 1 month (group 3), the MBs almost completely disappeared, but the clusters of liver cells remained and a few small aggresomes remained in these

Fig. 2. AFP was colocalized with p62 in MBs and in clusters of altered mouse hepatocytes as shown by positive staining for p62 (Texas Red) and AFP (FITC) (immunofluorescent double staining). (A) Control mouse (group 1) (Tricolor filter) 420×. (B) AFP antibody staining of control (group 1) (FITC filter). 840×. (C) DDC-primed mouse (group 2), white arrows point to MBs (Tricolor filter). 840×. (D) AFP antibody staining of the same view as in C (FITC filter). White arrows point to MBs. 840×. (E) Withdrawn mouse (group 3) (Tricolor filter). The MBs had disappeared, white arrows point to AFB positive hepatocytes. 840×. (F) AFP staining of the same cells in E, white arrow points to AFPpositive hepatocytes (FITC filter). (G) DDC + CMZ refed mouse (group 4), white arrow points to a MB (Tricolor filter). 840×. (H) AFP staining of the same cells seen in G (FITC filter), white arrows point to MBs. 840×. (I) DDC-primed tissue culture double stained for AFP and p62, white arrows point to MBs (Tricolor). 840×. (J) Same cells as I, white arrows point to MBs. MBs stain positive for AFP (white arrows) (FITC filter). 840×.

hepatocytes (Figs. 1D, 2E) compared with the control liver cells (group 1, Figs. 1A, 2A). Numerous MBs reformed after 7 days of DDC and CMZ refeeding (group 4, Figs. 1E, 2G). Experiment 2 DDC-primed hepatocytes in primary culture developed numerous MBs over 7 days of culture Figs 2 I,J, 5G,H, and 6G,H).

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

113

Fig. 3. DDC-induced mouse tumors which formed 9 months after DDC withdrawal are shown. (A) DDC-induced liver tumor. Arrows point to MBs in the cytoplasm. Arrow heads mark the border between tumor and surrounding liver. H&E stain. 840×. (B) A second DDC-induced liver tumor showing a trabecular growth pattern. H&E stain. 420×. (C) Reticulum stain of the same tumor as B. 840×. (D) The liver tumor that developed in a normal control C3H mouse, arrows delineate the border between the tumor and compressed normal liver. H&E stain. 840×.

Experiment 3 Six of the 11 mice withdrawn from DDC for 9 months developed liver tumors compared with the control mice in which 1 of 5 developed one liver tumor (Fig. 3). Of 11 mice withdrawn from DDC for 13–14 months, 5 developed multiple liver tumors. A total of 36 liver tumors were present

microscopically. The DDC-induced mouse liver tumors were composed of the cells that phenotypically resembled the MB forming cells in groups 2 and 4 (Fig. 3). One of the DDCinduced liver tumors showed a trabecular growth pattern with expanded vascular spaces filled with RBCs (Fig. 3B) with loss of reticulum (Fig. 3C). The liver tumor that developed in a normal C3H mouse showed more differentiation of tumor

Fig. 4. Immunoperoxidase staining of mice livers. (A) Control mouse (group 1) liver which stained negative for AFP. 840×. (B) Liver from a mouse refed DDC (group 4). Note the AFP antibody stained clusters of hepatocytes, which contained MBs (arrows). 840×. (C) DDC withdrawn mouse (group 3) liver showing a cluster of AFPpositive hepatocytes located around central veins (arrows). 840×. (D) Liver from a mouse refed DDC (group 4). MB forming liver cells were proliferating as indicated by the double staining for PCNA (immunoperoxidase stain) and AFP (immunofluorescent stain, green FITC filter) (white arrows which have formed MBs point to AFP-antibody-stained cells; black arrows point to cells which were not AFP-positive). 840×. (E) Cyclin D-1 stain showing an increased proliferation index in DDCprimed mouse liver cells. 840×.

114

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

as indicated by the staining of the nuclei by the antibody to PCNA and cyclin D-1 positive nuclear staining (Fig. 4E). Immunoperoxidase staining for AFP was negative in controls (Fig. 4A) but MB forming cells stained positive using cells in groups 2 and 4 (Fig. 4B) and clusters of hepatocytes in group 3 (Fig. 4C). Antibodies to FAS (Fig. 5) and A2m (Fig. 6) also stained the MB forming clusters of hepatocytes and MBs (group 2 and 4)

Fig. 5. The antibody to FAS stained the clusters of MB forming cells and the liver tumors (Ub) (Texas Red) and FAS (FITC) immunofluorescent double staining. (A) Control mouse (group 1) stained positive for FAS. 420×. (B) DDCprimed mouse (group 2) (white arrow points to stained MBs). 840×. (C) DDC withdrawn mouse (group 3). The MBs disappeared (white arrow points to cells stained positive for FAS, black arrow points to cells stained negative to FAS. (D) DDC + CMZ refed mouse (group 4). The MBs stained positive for FAS (Tricolor filter). 840×. (E) DDC-induced mouse liver tumors showing MBs in liver cells stained by the Ub antibody (white arrows) (Tricolor filter). 840×. (F) Human HCC (white arrows point to tumor cells which stained positive for FAS (Tricolor filter). FAS colocalized with Ub at the borders of the MBs. 840×. (G) DDC-primed hepatocytes in 6-day tissue culture double stained for FAS and Ub. The white arrow points to an MB stained positive for Ub and FAS (Tricolor filter). 2100×. (H) Same cell as G. Note that the MB and cytoplasm stained positive for FAS (white arrow) (FITC filter) 2100×.

hepatocytes compared with the DDC-induced tumors (Fig. 3D). Immunoperoxidase and immunofluorescent stains were done on the livers of groups 1–4 mice as well as DDC-induced mouse liver tumors that formed after 9 months of DDC withdrawal and a human HCC that formed MBs. Antibodies to Ub and p62 were used to stain MBs. The antibody to AFP also stained MBs (Figs. 1, 2). Hepatocytes forming MBs (group 2 and 4) and clusters of hepatocytes without MBs (group 3) stained positive for AFP in both the cytoplasm and the nuclei. AFP colocalized with UbB (Fig. 1) and p62 in MBs (Fig. 2). This was also evident in primary tissue cultures of DDC-primed hepatocytes derived from Group 3 livers (Figs. 2I, J). These cells were proliferating

Fig. 6. The antibody to A2m stained the MB forming cells in clusters and the hepatocytes in liver tumors (Ub (Texas Red) and A2m (FITC) immunofluorescent double staining). (A) Control mouse (group 1). (Tricolor filter). 840×. (B) DDC + CMZ refed mouse (group 4). The white arrow points to a cluster of cells forming MBs and positive stained cytoplasm: the black arrow points to a negative stained normal cell (Tricolor filter). 1260×. (C) Same as B (white arrow points to positive stained cells; black arrow points to a negative stained cell) (2100×). (D) DDC-induced mouse liver tumor which formed 9 months after DDC withdrawal. The tumor stained positive for A2m. White arrow points to the tumor border (Tricolor filter). 420×. (E) Note the increased A2m staining in the tumor cells (arrow) seen in D (Tricolor filter). 840×. (F) Human HCC. Note the MBs and tumor cells stained positive for Ub and A2m (white arrows). (G) DDCprimed hepatocyte culture showing that there is both A2m and UbB colocalization in the MB (white arrow) (Tricolor filter) 2100×. (H) Same cell as seen in G (white arrow points to MB stained positive for A2M) (FITC filter) 2100×.

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

115

Fig. 7. AFP mRNA expression was significantly increased in the livers of DDC + CMZ refed mice (group 4). Withdrawal column is negative. Refed vs. control (SEM, P b 0.01; n = 3).

and the liver tumors that formed in DDC withdrawn mice. In the primary tissue culture of the DDC-primed hepatocytes, FAS and A2m colocalized with UbB in MBs (Figs. 5G, H and 6G, H). The quantitative real-time RT-PCR assay was used to measure AFP, UbB, FAS, A2m and GPC3 mRNA expression in the livers of the 4 different groups of mice, DDC-induced mouse tumors, and in primary cultures of DDC-primed mouse hepatocytes and control liver cells. AFP mRNA expression significantly increased in the livers of group 4 mice (Fig. 7) and DDC liver tumors from DDC withdrawn mice (Fig. 8). Western blot of the liver tissue from the four groups of mice showed a significant increase in the expression of AFP in the livers of DDC and DDC + CMZ refed mice (Fig. 9). UbB expression increased significantly in the livers of group 2 and group 4 mice (Fig. 10), DDC-induced liver tumors (Fig. 8) and 1-, 2- and 6day cultures of DDC-primed hepatocytes in which MBs formed in vitro compared with the controls (Fig. 11). A2m expression increased significantly in 1-, 2- and 6-day cultures of DDCprimed hepatocytes (Fig. 12). The level of FAS mRNA increased in the livers of group 4 mice (Fig. 13). GPC3 expression increased significantly in the livers of group 2 and group 4 mice (Fig. 14). However, the FAS, A2m and GPC3

Fig. 8. Both AFP and UbB expression were increased in the DDC-induced mouse liver tumors (SEM, n = 3).

Fig. 9. Western blot showed that the level of AFP protein significantly increased in both DDC-treated (group 2) and DDC + CMZ refed groups (group 4) compared with controls (group 1) and DDC withdrawn mice (group 3) (SEM, n = 3).

mRNA levels in DDC-induced liver tumors decreased compared with the controls (data not shown). Discussion The MB forming cell phenotype persisted after DDC was withdrawn (Group 3) and increased when DDC was refed (Group 4) along with the reappearance of MBs. Although the number of altered hepatocytes which persisted diminished, apoptosis was not evident. MBs disappeared when DDC was withdrawn but reappeared in the DDC-induced liver cell tumors that developed 9 months later, suggesting that the MB phenotype was preneoplastic. The phenotype included the upregulation of p62, UbB, FAS, AFP, A2m and GPC3 expression. The phenotype was spontaneously amplified in primary culture during MB formation in vitro, indicating that the culture conditions activated the expression of the MB phenotype change along with MB formation and suggesting that the MB formation process was linked to the expression of the preneoplastic markers.

Fig. 10. UbB mRNA expression was significantly increased in the livers of both DDC-treated (group 2) and DDC + CMZ refed mice (group 4). DDC vs. control (SEM., P b 0.01; n = 3); refed vs. control, P b 0.01; n = 3).

116

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

Fig. 13. FAS mRNA expression was significantly increased in the livers of DDC + CMZ refed mice (Group 4). Refed vs. control (SEM, P b 0.01; n = 3).

Fig. 11. UbB mRNA expression was increased in 24 h, 48 h and 6 days of primary cultures of DDC-primed mice hepatocytes when compared with controls. DDC-primed hepatocytes cultured 24 h vs. controls (SEM, P b 0.01; n = 3); cultured 48 h vs. controls (P b 0.01; n = 3); cultured 6 days vs. controls (P b 0.01; n = 3).

MBs are formed in phenotypically changed hepatocytic foci in the DDC-primed mouse model, and these foci expand rapidly when the drug is refed (Nagao et al., 1998). To determine the phenotype of the MB forming cell and the changed cell type, these cells were phenotyped using antibody to preneoplastic markers in vivo and in vitro. Western blot showed that the AFP tumor marker significantly increased in the livers of DDCtreated mice and DDC + CMZ refed mice. However, AFP mRNA was significantly increased only in the livers of DDC + CMZ refed mice. It is possible that AFP regulation is at the translation level instead of transcription level. The antibody to AFP colocalized with both UbB and p62 antibodies in the cytoplasm of MB forming cells and AFP was also present in MBs. It is possible that, in the livers of the DDC-fed mice, the turnover of AFP is inhibited by the loss of proteasome degradation and AFP bound to UbB and p62. It remains within the MBs and in the MB forming liver cells. Since the expression was increased in the MB forming cells and later in the liver tumors it is likely that the MB forming cells are preneoplastic. FAS has been reported to be overexpressed in chemically and hormonally induced rat HCCs and in many human malignancies

Fig. 12. A2m mRNA expression was increased at 24 h, 48 h and 6 days of primary cultures of DDC-primed mice hepatocytes. DDC-primed hepatocytes in 24 h cultured vs. controls (SEM, P b 0.01; n = 3); cultured 48 h vs. controls (P b 0.01; n = 3); cultured 6 days vs. controls (P b 0.01; n = 3).

(Rashid et al., 1997; Visca et al., 1999; Kusakabe et al., 2002; Swinnen et al., 2002; Krontiras et al., 1999; Piyathilake et al., 2000; Epstein et al., 1995; Kuhajda et al., 1994; Takahiro et al., 2003; Gamsler et al., 1997; Pizer et al., 1998; Swinnen et al., 2003). It is interesting that FAS is also overexpressed in some noninvasive or early stage tumors such as intraepithelial neoplasia in squamous cell carcinoma (Epstein et al., 1995; Kuhajda et al., 1994), prostate (Piyathilake et al., 2000), breast (Milgraum et al., 1997; Alo et al., 2001) or colorectal tumors (Rashid et al., 1997; Kusakabe et al., 2002). Lipids are essential substrates for the biogenesis of cellular membranes, which are important for the proliferation of tumor cells (Evert et al., 2005). Furthermore, FAS expression mainly affects the phospholipid content of detergent-resistant membrane fractions and possibly alters some cell functions including signal transduction and intracellular trafficking (Evert et al., 2005; Swinnen et al., 2003). In the present experiment, FAS mRNA levels significantly increased in DDC and CMZ refed (group 4) mice, but the FAS mRNA levels in DDC-induced liver tumors decreased compared with the controls. The FAS protein increased in the altered liver cell clusters as indicated by increased staining of these cells with the antibody to FAS. The FAS antibody stained MB forming cells and clusters of liver cells without MBs in groups 2, 3 and 4 mice and the DDC-induced liver tumors. Therefore, FAS overexpression is likely a marker of preneoplastic change in these mice.

Fig. 14. GPC3 mRNA expression was increased in the livers of DDC fed (groups 2) and DDC refed (group 4) mice compared to controls (SEM, P b 0.01, n = 3).

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

A2m functions as a carrier protein and regulator for various growth factors and cytokines such as transforming growth factor-β (TGF-β), interleukin-1 (IL-1) and tumor necrosis factor-α (TNF-α) (James, 1990). The present study demonstrated that A2m mRNA expression increased in the primary cultures of DDC-primed hepatocytes in which MBs formed compared with the controls. Immunofluorescent staining showed that the antibody to A2m selectively stained MB forming cells, and clusters of cells without MBs during DDC withdrawal and in tumors, which indicated that A2m might also serve as a marker of preneoplastic change. These results do not identify the mechanism that triggers MB formation. Prior in vitro studies done, where DDCprimed mouse hepatocytes spontaneously form MBs between 2 and 6 days of primary culture, showed that the initiating event of MB formation was the upregulation of integrins and other cell adhesion molecules (Wu et al., 2005). The signal transduction pathway involved was through integrin signaling, src, MEK-1 and ERK activation pathway (Wu et al., 2005). Inhibition of MEK-1 phosphorylation of ERK markedly reduced MB formation in vitro (Wu et al., 2005). NF-κB activation was also involved. Inhibition of the 105/ 50 NF-κB pathway totally blocked MB formation in vitro (Nan et al., 2005). Unreported data showed that inhibition of phosphorylation of p38 also totally blocked MB formation in vitro. These results suggest that changes in the extracellular matrix environment are enough to trigger MB formation in these phenotypically change hepatocytes in culture. In conclusion, the liver cell population that forms MBs in response to DDC toxicity develops a changed phenotype which has some preneoplastic properties since a similar phenotype was expressed in liver tumors that formed 9 months after withdrawal of DDC. Since hepatocytes normally do not survive 9 months, it is likely that the MB forming cell phenotype persisted throughout the 9-month interval by multiple replications before tumor formation eventually developed.

Acknowledgments This research was supported by an Alcoholism Research Center grant for liver and pancreatic disease including the morphology and animal cores National Institute of Health/ National Institutes on Alcohol Abuse and Alcoholism (NIH/ NIAAA) P50-011999 Alcohol Center Grant on Liver and Pancreas, including Animal and Morphology Cores.

References Abelev, G.I., 1971. Alpha-fetoprotein in ontogenesis and its association with malignant tumors. Adv. Cancer Res. 14, 295–358. Alo, P.L., Visca, P., Botti, C., Galati, G.M., Sebastiani, V., Andreano, T., Di Tondo, U., Pizer, E.S., 2001. Immunohistochemical expression of human erythrocyte glucose transporter and fatty acid synthase in infiltrating breast carcinomas and adjacent typical/atypical hyperplastic or normal breast tissue. Am. J. Clin. Pathol. 116, 129–134.

117

Bardag-Gorce, F., van Leeuwen, F.W., Nguyen, V., French, B.A., Li, J., Riley, N.E., McPhaul, L.W., Lue, Y.H., French, S.W., 2002. The role of the ubiquitin–proteasome pathway in the formation of Mallory bodies. Exp. Mol. Pathol. 73, 75–83. Barrett, A.J., Starkey, P.M., 1973. The interaction of alpha 2-macroglobulin with proteinases. Characteristics and specificity of the reaction, and a hypothesis concerning its molecular mechanism. Biochem. J. 133, 709–724. Bennett, J.A., Zhu, S., Pagano-Mirarchi, A., Kellom, T.A., Jacobson, H.I., 1998. Alpha-fetoprotein derived from a human hepatoma prevents growth of estrogen-dependent human breast cancer xenografts. Clin. Cancer Res. 4, 2877–2884. Bisceglie, A.D., Sterling, R.K., Chung, R.T., Everhart, J.E., Dienstag, J.L., Bonkoursky, H.L., Wright, E.C., Everson, G.T., Lindsay, K.L., Lok, A.S.F., Lee, W.M., Morgan, T.R., Ghany, M.G., Gretch, D.R., Halt, C., 2005. Trial Group. Serum alpha-fetoprotein levels in patients with advanced hepatitis C. Results from the HALT-C Trial. J. Hepatol. 43, 434–441. Cadrin, M., Kawahara, H., Ohta, M., Katsuma, Y., Marceau, N., French, S.W., 1990. Mallory bodies in hepatomas, and hyperplasia nodules: in vivo and in vitro studies. In: Stevenson, McClain, Popp, Sloga, Ward, Pitot (Eds.), Mouse Liver Carcinogenesis: Mechanisms and Species Comparisons. Alan R. Liss., Inc. Publ., New York, pp. 231–232. Capurro, M., Wanless, I.R., Sherman, M., Deboer, G., Shi, W., Miyoshi, E., Filmus, J., 2003. Glypican-3 a novel serum and histochemical marker for hepatocellular carcinoma. Gastroenterology 125, 89–97. Chirala, S.S., Chang, H., Matzuk, M., Abu-Elheiga, L., Mao, J., Mahon, K., Finegold, M., Wakil, S.J., 2003. Fatty acid synthesis is essential in embryonic development: fatty acid synthase null mutants and most of the heterozygotes die in utero. Proc. Natl. Acad. Sci. U. S. A. 100, 6358–6363. Chu, C.T., Rubenstein, D.S., Enghild, J.J., Pizzo, S.V., 1991. Mechanism of insulin incorporation into alpha 2-macroglobulin: implications for the study of peptide and growth factor binding. Biochemistry 30, 1551–1560. Dennis, P.A., Saksela, O., Harpel, P., Rifkin, D.B., 1989. Alpha 2-macroglobulin is a binding protein for basic fibroblast growth factor. J. Biol. Chem. 264, 7210–7216. Epstein, J.I., Carmichael, M., Partin, A.W., 1995. OA-519 (fatty acid synthase) as an independent predictor of pathologic state in adenocarcinoma of the prostate. Urology 45, 81–86. Evert, M., Schneider-Stock, R., Dombrowski, F., 2005. Overexpression of fatty acid synthase in chemically and hormonally induced hepatocarcinogenesis of the rat. Lab. Invest. 85, 99–108. French, B.A., van Leeuwen, F., Riley, N.E., Yuan, Q.X., Bardag-Gorce, F., Lue, Y.H., Marceau, N., French, S.W., 2001. Aggresome formation in liver cells in response to different toxic mechanisms. Role of the ubiquitin–proteasome pathway and the frameshift of ubiquitin. Exp. Mol. Pathol. 71, 241–246. Gamsler, T.S., Hardman III, W., Hunt, D.A., Schaffel, S., Hennigar, R.A., 1997. Increased expression of fatty acid synthase (OA-519) in ovarian neoplasms predicts shorter survival. Hum. Pathol. 28, 686–692. Gillespie, J.R., Uversky, V.N., 2000. Structure and function of alpha-fetoprotein: a biophysical overview. Biochim. Biophys. Acta 1480, 41–56. Huang, J.S., Huang, S.S., Deuel, T.F., 1984. Specific covalent binding of platelet-derived growth factor to human plasma alpha 2-macroglobulin. Proc. Natl. Acad. Sci. U. S. A. 81, 342–346. Huang, S.S., O'Grady, P., Huang, J.S., 1988. Human transforming growth factor beta·alpha 2-macroglobulin complex is a latent form of transforming growth factor beta. J. Biol. Chem. 263, 1535–1541. Iwaya, K., Mukai, K., 2005. Accumulation of ubiquitin-conjugated cytokeratin fragments in tumor cells. Semin. Cancer Biol. 15, 309–318. James, K., 1990. Interactions between cytokines and alpha 2-macroglobulin. Immunol. Today 11, 163–166. Kar, P., Gandhi, B.M., Irshad, M., Gupta, H., Tandon, B.N., 1987. Alpha-2 macroglobulin: an additional marker for diagnosis of hepatocellular carcinoma. J. Assoc. Phys. India 35, 288–289. Kotaka, M., Chen, G.G., Lai, P.B., Lau, W.Y., Chan, P.K., Leung, T.W., Li, A.K., 2002. Analysis of differentially expressed genes in hepatocellular carcinoma with hepatitis C virus by suppression subtractive hybridization. Oncol. Res. 13, 161–167. Krontiras, H., Roye, G.D., Beenken, S.E., Myers, R.B., Mayo, M.S., Peters,

118

L. Nan et al. / Experimental and Molecular Pathology 80 (2006) 109–118

G.E., Grizzle, W.E., 1999. Fatty acid synthase expression is increased in neoplastic lesions of the oral tongue. Head Neck 21, 325–329. Kuhajda, F.P., Jenner, K., Wood, F.D., Hennigar, R.A., Jacobs, L.B., Dick, J. D., Pasternack, G.R., 1994. Fatty acid synthesis: a potential selective target for antineoplastic therapy. Proc. Natl. Acad. Sci. U. S. A. 91, 6379–6383. Kusakabe, T., Maeda, M., Hoshi, N., Sugino, T., Watanabe, K., Fukuda, T., Suzuki, T., 2000. Fatty acid synthase is expressed mainly in adult hormonesensitive cells or cells with high lipid metabolism and in proliferating fetal cells. J. Histochem. Cytochem. 48, 613–622. Kusakabe, T., Nashimoto, A., Honma, K., Suzuki, T., 2002. Fatty acid synthase is highly expressed in carcinoma, adenoma and in regenerative epithelium and intestinal metaplasia of the stomach. Histopathology 40, 71–79. Libbrecht, L., Desmet, V., Roskams, T., 2005. Preneoplastic lesions in human hepatocarcinogenesis. Liver Int. 25, 16–27. Marrero, J.A., Lok, A.S., 2004. Newer markers for hepatocellular carcinoma. Gastroenterology 127, S113–S119. Meierhenry, E.F., Rubner, B., French, S.W., 1981. Mallory body formation in hepatic nodules of mice ingesting dieldrin. Lab. Invest. 44, 392–396. Meierhenry, E.F., Rubner, B., French, S.W., 1983. Mallory bodies in hepatic tumours. Hepatology 3, 90–95. Milgraum, L.Z., Witters, L.A., Pasternack, G.R., Kuhajda, F.P., 1997. Enzymes of the fatty acid synthesis pathway are highly expressed in in situ breast carcinoma. Clin. Cancer Res. 3, 2115–2120. Mizejewski, G.J., 1997. Alpha-fetoprotein as a biologic response modifier: relevance to domain and subdomain structure. Proc. Soc. Exp. Biol. Med. 215, 333–362. Nagao, Y., Yuan, Q.X., Wan, Y.-J., French, B.A., French, S.W., 1998. Pathogenesis of Mallory body formation: studies using the drug-primed mouse model. Hepatol. Res. 13, 42–54. Nagao, Y., Wan, Y.-J., Yuan, Q.X., Kachi, K., Marceau, N., French, S.W., 1999. Mouse model of hepatocellular hyperplastic nodule formation characterization of mRNA expression. Hepatol. Res. 15, 110–123. Nakanuma, Y., Ohta, G., 1985. Is Mallory body formation a preneoplastic change? A study of 181 cases of liver bearing hepatocellular carcinoma and 82 cases of cirrhosis. Cancer 55, 2400–2404. Nam, S.W., Park, J.Y., Ramasamy, A., Shevade, S., Islamd, A., Long, P.M., Park, C.K., Park, S.E., Kim, S.Y., Lee, S., Park, W.S., Yoo, N.J., Liu, E.T., Miller, L.D., Lee, J.Y., 2005. Molecular changes from dysplastic nodule to hepatocellular carcinoma through gene expression profiling. Hepatology 42, 809–818. Nan, L., Wu, Y., Bardag-Gorce, F., Li, J., French, B.A., Wilson, L.T., French, S.W., 2005. The p105/50 NF-kB pathway is essential for Mallory body formation. Exp. Mol. Pathol. 78, 198–206. Northemann, W., Andus, T., Gross, V., Nagashima, M., Schreiber, G., Heinrich, P.C., 1983. Messenger RNA activities of four acute phase proteins during inflammation. FEBS Lett. 161, 319–322. Piyathilake, C.J., Frost, A.R., Manne, U., Bell, W.C., Weiss, H., Heimburger, D.C., Grizzle, W.E., 2000. The expression of fatty acid synthase (FASE) is an early event in the development and progression of squamous cell carcinoma of the lung. Hum. Pathol. 31, 1068–1073. Pizer, E.S., Lax, S.F., Kuhajda, F.P., Pasternack, G.R., Kurman, R.J., 1998. Fatty acid synthase expression in endometrial carcinoma: correlation with cell proliferation and hormone receptors. Cancer 83, 528–537. Poon, T.C., Chan, A.T., Zee, B., Ho, S.K., Mok, T.S., Leung, T.W., Johnson, P.J., 2001. Application of classification tree and neural network algorithms to the identification of serological liver marker profiles for the diagnosis of hepatocellular carcinoma. Oncology 61, 275–283.

Rashid, A., Pizer, E.S., Moga, M., Milgraum, L.Z., Zahurak, M., Pasternack, G. R., Kuhajda, F.P., Hamilton, S.R., 1997. Elevated expression of fatty acid synthase and fatty acid synthetic activity in colorectal neoplasia. Am. J. Pathol. 150, 201–208. Schreiber, G., Howlett, G., Nagashima, M., Millership, A., Martin, H., Urban, J., Kotler, L., 1982. The acute phase response of plasma protein synthesis during experimental inflammation. J. Biol. Chem. 257, 10271–10277. Semenkova, L.N., Dudich, E.I., Dudich, I.V., Shingarova, L.N., Korobko, V.G., 1997. Alpha-fetoprotein as a TNF resistance factor for the human hepatocarcinoma cell line HepG2. Tumour Biol. 18, 30–40. Severin, S.E., Posypanova, G.A., Katukov, V., Shmyrev, I.I., Luzhkov Yu, M., Gerasimova, G.K., Zhukova, O.S., Vorozhtsov, G.N., Kaliya, O.L., Lukyanets, E.A., Severin, E.S., 1997. Antitumor activity of conjugates of the oncofetal protein alpha-fetoprotein and phthalocyanines in vitro. Biochem. Mol. Biol. Int. 43, 1081–1089. Sotnichenko, A.I., Severin, S.E., Posypanova, G.A., Feldman, N.B., Grigor'ev, M.I., Severin, E.S., Petrov, R.V., 1999. Water-soluble 2,3,7,8-tetrachlorodibenzo-p-dioxin complex with human alpha-fetoprotein: properties, toxicity in vivo and antitumor activity in vitro. FEBS Lett. 450, 49–51. Sukata, T., Uwagawa, S., Ozaki, K., Sumida, K., Kikuchi, K., Kushida, M., Saito, K., Morimura, K., Oeda, K., Okuno, Y., Mikami, N., Fukushima, S., 2004. Alpha(2)-Macroglobulin: a novel cytochemical marker characterizing preneoplastic and neoplastic rat liver lesions negative for hitherto established cytochemical markers. Am. J. Pathol. 165, 1479–1488. Swinnen, J.V., Roskams, T., Joniau, S., Van Poppel, H., Oyen, R., Baert, L., Heyns, W., Verhoeven, G., 2002. Overexpression of fatty acid synthase is an early and common event in the development of prostate cancer. Int. J. Cancer 98, 19–22. Swinnen, J.V., Van Veldhoven, P.P., Timmermans, L., De Schrijver, E., Brusselmans, K., Vanderhoydonc, F., Van de Sande, T., Heemers, H., Heyns, W., Verhoeven, G., 2003. Fatty acid synthase drives the synthesis of phospholipids partitioning into detergent-resistant membrane microdomains. Biochem. Biophys. Res. Commun. 302, 898–903. Takahiro, T., Shinichi, K., Toshimitsu, S., 2003. Expression of fatty acid synthase as a prognostic indicator in soft tissue sarcomas. Clin. Cancer Res. 9, 2204–2212. Takashima, H., Nakajima, T., Moriguchi, M., Sekoguchi, S., Nishikawa, T., Watanabe, T., Katagishi, T., Kimura, H., Ninami, M., Hoh, Y., Kagawa, K., Okanoue, T., 2005. In vivo expression patterns of survivin and its splicing variants in chronic liver disease and hepatocellular carcinoma. 25, 77–84. Tazawa, J., Irie, T., French, S.W., 1983. Mallory body formation runs parallel to gamma-glutamyl transferase induction in hepatocytes of griseofulvin-fed mice. Hepatology 3, 989–1001. Visca, P., Alo, P.L., Del Nonno, F., Botti, C., Trombetta, G., Marandino, F., Filippi, S., Di Tondo, U., Donnorso, R.P., 1999. Immunohistochemical expression of fatty acid synthase, apoptotic-regulating genes, proliferating factors, and ras protein product in colorectal adenomas, carcinomas, and adjacent nonneoplastic mucosa. Clin. Cancer Res. 5, 4111–4118. Wang, X.W., Xu, B., 1998. Stimulation of tumor-cell growth by alphafetoprotein. Int. J. Cancer 75, 596–599. Wu, Y., Nan, L., Bardag-Gorce, F., Li, J., French, B.A., Wilson, L.T., Dedes, J., French, S.W., 2005. Role of ERK activated by laminin-integrin signaling triggered MB formation. An in vivo and vitro study. Exp. Mol. Pathol. 79, 1–8. Zhu, Z.W., Friess, H., Wang, L., Abou-Shady, M., Zimmermann, A., Lander, A.D., Korc, M., Kleeff, J., Buchler, M.W., 2001. Enhanced glypican-3 expression differentiates the majority of hepatocellular carcinomas from benign hepatic disorders. Gut 48, 558–564.