- Email: [email protected]
Manilkara zapota (L.) P. Royen leaf water extract triggered apoptosis and activated caspase-dependent pathway in HT-29 human colorectal cancer cell line
Biomedicine & Pharmacotherapy 110 (2019) 748–757
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Manilkara zapota (L.) P. Royen leaf water extract triggered apoptosis and activated caspase-dependent pathway in HT-29 human colorectal cancer cell line Bee Ling Tana, Mohd Esa Norhaizana,b,c,
T
⁎
a
Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia Research Centre of Excellent, Nutrition and Non-Communicable Diseases (NNCD), Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia c Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia b
A R T I C LE I N FO
A B S T R A C T
Keywords: Apoptosis Beta-catenin Caspase-dependent pathway Cytotoxicity Manilkara zapota
Manilkara zapota (L.) P. Royen (Family: Sapotaceae), commonly called as sapodilla, has been applied as traditional folk medicine for diarrhea and pulmonary infections. Conventional therapy in colorectal cancer is not likely effective due to undesirable outcomes. The anti-colon cancer properties of Manilkara zapota leaf water extract have yet to be investigated thus far. Therefore, our present study aimed to evaluate the ability to induce apoptosis and the underlying mechanisms of Manilkara zapota leaf water extract against human colorectal cancer (HT-29) cells. The cytotoxicity of Manilkara zapota leaf water extract was screened in different cancer cell lines using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and lactate dehydrogenase (LDH) analyses. The morphological changes in HT-29 cell lines after exposure to Manilkara zapota leaf water extract were viewed under fluorescence and inverted light microscope. The apoptotic cell was measured by Annexin Vpropidium iodide staining. The caspase-3 and -8 activities were assessed by colorimetric assay. Overall analyses revealed that treatment with Manilkara zapota leaf water extract for 72 h can inhibit the viability of HT-29 cells. Incubation with Manilkara zapota leaf water extract for 24, 48, and 72 h significantly increased (p < 0.05) the total apoptotic cells compared to the control. Treatment with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h triggered both caspase-3 and -8 activities in a concentration-dependent pattern. We also found that the catalase level in the two treatment groups (21 and 42 μg/mL) was significantly elevated after 24 h incubation. Incubation with Manilkara zapota leaf water extract for 72 h triggered the transcriptional elevation of the adenomatous polyposis coli (APC), glycogen synthase kinase 3β (GSK3β), AXIN1, and casein kinase 1 (CK1). The β-catenin mRNA levels were reduced accordingly when the concentration of the Manilkara zapota leaf water extract was increased. Our results suggested that Manilkara zapota leaf water extract offer great potential against colorectal cancer through modulation of Wnt/β-catenin signaling pathway, caspase-dependent pathway, and antioxidant enzyme.
1. Introduction Colorectal cancer represents the third leading cancer after lung and liver cancers [1]. In Malaysia, colorectal cancer has become the second leading cancer in females and the most common cancer in males [2]. Nearly 103,507 new cancer cases were reported from 2007 to 2011, contributes for 46,794 (45.2%) and 56,713 (54.8%) in males and females, respectively [2]. The previous study has reported that Wnt/β-catenin signaling
pathway involves in the human biology [3]. Inappropriate stimulation of the Wnt signaling has been linked to colorectal cancer [4]. The cytoplasmic β-catenin is regulated at a low level through ubiquitin-proteasome-mediated degradation and is modulated by a destruction complex including adenomatous polyposis coli (APC), glycogen synthase kinase 3β (GSK3β), AXIN1, and casein kinase 1 (CK1) [5]. Natural dietary products have been recognized as a source of remedy [6]. The plant is of particular interest because its derived compounds modulate oxidative stress and thus affecting cancer cell
⁎ Corresponding author at: Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. E-mail address: [email protected] (M.E. Norhaizan).
https://doi.org/10.1016/j.biopha.2018.12.027 Received 27 June 2018; Received in revised form 5 December 2018; Accepted 5 December 2018 0753-3322/ © 2018 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
2.4. Determination of cytotoxicity of Manilkara zapota leaf water extract
development by altering gene and protein expression. Pharmacological activities in plants are strongly correlated with natural antioxidants [7]. Antioxidants have shown their ability to reduce adverse outcomes of reactive species and have been identified for the treatment of many diseases and severe disorders including heart disease and cancer [8,9]. Plant-derived compounds such as flavonoids, alkaloids, phenolic compounds, terpenoids, tannins, and steroids have antitumor properties and may reduce undesirable side effects [10,11]. Further, plants exert highly diverse and complex molecular bioactive compounds, and therefore plant kingdom is a potential source of antineoplastic and cytotoxic agent [12,13]. Manilkara zapota (L.) P. Royen (Family: Sapotaceae), commonly called as sapodilla, or locally known as ciku, is an evergreen tree found abundantly throughout India subcontinent including Bangladesh [14], though it is native to Mexico and Central America. Manilkara zapota leaf has been traditionally applied as traditional folk medicine for cough, cold, and diarrhea [15]. Nevertheless, the anti-colon cancer properties of Manilkara zapota leaf water extract have yet to be investigated thus far. Our earlier study found that Manilkara zapota leaf methanol extract inhibited the proliferation of HeLa human cervical cancer cells [7]. Therefore, this study aimed to investigate the ability to induce apoptosis and the underlying mechanisms of Manilkara zapota leaf water extract against HT-29 human colorectal cancer cell lines. Collectively, understanding the mode of action in anticancer activities of Manilkara zapota leaf water extract and the cytotoxic effect may contribute to the development of a promising anticancer agent.
HeLa, HepG2, PC-3, HT-29, BALB/c 3T3, HCT-116, and HGT-1 cell lines were seeded in a 96-well plate (1 × 105 cells/well) for 24 h. The cells were treated with different concentration (1.56–200 μg/mL) water extract of Manilkara zapota leaf. After 24, 48, and 72 h of treatment, 5 mg/mL of MTT (20 μL) was added into each well and incubated for 2–4 h. Following 2–4 h incubation, 100 μL of dimethyl sulfoxide was added and the absorbance was read using ELISA microplate reader (Tecan, Switzerland) at the wavelength of 570 nm. The reference wavelength used was 630 nm. 2.5. Lactate dehydrogenase assay Cytotoxicity was evaluated using an in vitro Toxicology Assay Kit by the release of lactate dehydrogenase (LDH), according to the recommended instruction. HeLa, HepG2, PC-3, HT-29, BALB/c 3T3, HCT116, and HGT-1 cells were seeded in a 96-well plate (1 × 105 cells/ well) for 24 h. All cells were treated with 1.56–200 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h, and the supernatant was used to measure the LDH activity. The absorbance was measured using ELISA microplate reader (Tecan, Switzerland) at 490 nm. 2.6. Morphological changes of HT-29 cells exposed to Manilkara zapota leaf water extract The HT-29 cells were seeded in a 6-well plate (1 × 106 cells/well). Following 24 h of incubation, the cells were exposed to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. The necrosis or apoptosis characteristic of the cells was visualized under an inverted light microscope (Olympus, Center Valley, PA, USA).
2. Materials and methods 2.1. Reagents and chemicals Dulbecco's Modified Eagle Medium (DMEM), trypsin EDTA (1×), RPMI-1640 medium, and Mycoplex™ fetal bovine serum (FBS) were procured from Gibco (Grand Island, NY, USA). CaspACE™ Assay System, Colorimetric was bought from Promega (Madison, Wisconsin, USA). All other reagents used were bought from Sigma-Aldrich (St. Louis, MO, USA).
2.7. Quantification of apoptosis using acridine orange and propidium iodide Acridine orange (AO) and propidium iodide (PI) double staining were performed following the method described by Tan et al. [17]. The cells were seeded in a 6-well plate (1 × 106 cells/well) for 24 h. Following 24, 48, and 72 h of treatment, 1 mg/mL of AO and PI were added into the cells. The cell morphology was viewed at 400× and 200× magnifications using a fluorescence microscope (Olympus, Center Valley, PA, USA).
2.2. Plant extraction The plant (Manilkara zapota (L.) P. Royen) was collected from Pahang, Malaysia. Authentication of the plant was conducted at Biodiversity Unit, Institute of Bioscience, Universiti Putra Malaysia (voucher specimen number: SK 3179/17). Briefly, leaf of Manilkara zapota was cut into small pieces and dried in an oven at 40 °C for 3 days before ground into powder form. Manilkara zapota leaf was extracted using water following the method described by Tan et al. [16]. Five g of ground samples were extracted with 40 mL of water at 40 °C for 2 h. The slurry was filtered using filter paper and the residues were re-extracted. Lastly, the filtrate from water extract was freeze-dried using a freeze drier (Tecan, Switzerland) to obtain a concentrated powder.
2.8. Determination of apoptosis by Annexin V-propidium iodide staining Late and early apoptotic cells were measured by Annexin V-FITC Apoptosis Detection Kit I. The cells were seeded in 25 cm2 tissue culture flask (1 × 106 cells). After 24 h, the cells were treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. Following trypsinization, the cells were washed two times with phosphate-buffered saline-bovine serum albumin-ethylenediaminetetraacetic acid and resuspended the cell pellet in 100 μL of 1× binding buffer. Ten μL of PI and 5 μL of Annexin V-fluorescein isothiocyanate (FITC) were mixed with each sample and incubated for 10 min. Subsequently, 1× binding buffer (400 μL) was added and the fluorescence of cells was measured using a flow cytometry FACS Calibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA).
2.3. Cell culture The human hepatocellular carcinoma (HepG2), human cervical cancer (HeLa), human prostate cancer (PC-3), human colorectal adenocarcinoma (HT-29), mouse fibroblast (BALB/c 3T3), human colon carcinoma (HCT-116), and human gastric adenocarcinoma (HGT-1) cell lines were procured from American Type Culture Collection (Rockville, MD, USA). HCT-116, HGT-1, and HT-29 cells were cultured in DMEM supplemented with 10% (v/v) FBS, 100 IU/mL penicillin, and 100 μg/ mL streptomycin. The BALB/c 3T3, HeLa, HepG2, and PC-3 cells were cultured in RPMI-1640 medium supplemented with 100 μg/mL streptomycin, 100 IU/mL penicillin, and 10% (v/v) FBS. All cell lines were grown at 37 °C humidified atmosphere incubator with 5% CO2.
2.9. Caspase-3 and caspase-8 activities The caspase-3 and -8 assays were measured using a commercial colorimetric assay kit. Briefly, the cells were seeded in a 6-well plate (1 × 105 cells/well). After an overnight incubation, the cells were treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. The cell pellets were lysed in 25 μL of cold lysis buffer prior to incubation for 10 min on ice. An aliquot of 50 μL of 2 × Reaction Buffer 8 or 2 × Reaction Buffer 3 was added into 50 μL of 749
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
cell lysate (200 μg total protein), followed by 5 μL of caspase-3 or caspase-8 colorimetric substrate (DEVD-pNa or IETD-pNa). Following 2 h of incubation, the absorbance in each well was measured at 405 nm.
Table 1 The nucleotide sequence of PCR primers for amplification and sequence-specific detection of cDNA (obtained from the GenBank database).
2.10. Caspase inhibitor assay The caspase inhibitor was measured using a CaspACE™ Assay System, Colorimetric, according to the recommended instruction. Briefly, the cells were seeded in a 6-well plate (1 × 105 cells/well). The cells were treated with 20 μM Z-VAD-FMK inhibitor alone, Manilkara zapota leaf water extract or cotreated with 20 μM Z-VAD-FMK inhibitor. Following 24, 48, and 72 h of treatment, the cells were trypsinized and centrifuged at 450 × g for 10 min at 4 °C. The cell pellet was rinsed with 1× ice-cold phosphate-buffered saline (PBS) and resuspended in cell lysis buffer prior to incubation for 15 min on ice. The cell lysates were centrifuged at 15,000 × g for 20 min at 4 °C. The supernatants were collected and stored at −70 °C. An aliquot of 20 μL of cell extract (25–100 μg total protein) was added into each well of 96-well plate, followed by 2 μL of DEVD-pNA Substrate. Subsequently, the plate was covered with Parafilm® laboratory film and incubated at 37 °C for 4 h. Following 4 h of incubation, the absorbance in each well was measured at 405 nm.
Primer name [accession number]
Oligonucleotides (5′-3′) sequence
AXIN1 [XM_005255610.2] CK1 [NM_001271741.1] GSK3β [BC012760] APC [NM_000038.5] Beta-catenin [Z19054.1] ACTBa [NM_001101.3] GAPDHa [NM_002046.4] 18S rRNAa [HQ387008.1]
F- TTTCACCGAAGATGCTCCCC R- CACTGCCCTCAGGCTCATAC F- GAGATCCCTTTCCCAGAGTGC R- TTTGTGAAGGGCTTCTCGGC F- CGAATGGGGAACAGTCGAGG R- TCGGAAATGCGACGGGAAAC F- AGCAAGTTGAGGCACTGAAGA R- TCCCGGCTTCCATAAGAACG F- GCCGGCTATTGTAGAAGCTG R- GAGTCCCAAGGAGACCTTCC F- AGAGCTACGAGCTGCCTGAC R- AGCACTGTGTTGGCGTACAG F- GGATTTGGTCGTATTGGGC R- TGGAAGATGGTGATGGGATT F- GTAACCCGTTGAACCCCATT R- CCATCCAATCGGTAGTAGCG
ACTB = beta-actin, APC = adenomatous polyposis coli, CK1 = casein kinase 1, GAPDH = glyceraldehyde-3-phosphate dehydrogenase, GSK3β = glycogen synthase kinase 3β. a Housekeeping gene.
2.11. Cells supernatant preparation
in triplicate using the CFX™ Real-time System (Bio-Rad, Hercules, CA, USA). The housekeeping genes were used (glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, and 18S rRNA) for normalization.
Initially, HT-29 cells were seeded in a 6-well plate (1 × 105 cells/ well) for 24 h. HT-29 cells were exposed to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. HT-29 cells were centrifuged at 250 × g for 10 min to remove the medium. The cell pellets were lysed in 100 μL of cold lysis buffer followed by 10 min incubation on ice. The supernatants were collected after the cell lysates centrifuged at 10,000 × g and 4 °C for 1 min.
2.13. Statistical analyses The results are demonstrated as mean ± standard deviations (SD) using one-way analysis of variance (ANOVA) and Tukey’s post hoc test by SPSS version 19.0. The differences with p < 0.05 were considered statistically significant.
2.11.1. Determination of malondialdehyde Briefly, hundred μL of the supernatant was mixed with 400 μL of PBS, 250 μL trichloroacetic acid (TCA), and 12.5 μL of butylated hydroxytoluene (8.8 mg/mL). The reaction mixture was incubated at 4 °C for 2 h prior to centrifugation at 2000 × g for 15 min. The supernatant was boiled with 125 μL of thiobarbituric acid (1%) and 37.5 μL of 0.1 mol/L ethylenediaminetetraacetic acid for 15 min. The pink-colored product was observed after cooling at room temperature. The absorbance was read at 532 and 600 nm using an ELISA microplate reader (Tecan, Switzerland). The malondialdehyde (MDA) level was measured using a standard curve of tetramethoxypropane and expressed as nmol MDA/g of protein [18].
3. Results and discussion 3.1. Manilkara zapota leaf water extract induces cytotoxicity and inhibits the viability of HT-29 cells To explore the antiproliferative effect of Manilkara zapota leaf water extract on cancer cells, HeLa, HepG2, PC-3, HT-29, HGT-1, HCT-116, and BALB/c 3T3 cell lines were exposed to 1.56–200 μg/mL Manilkara zapota leaf water extract for 24, 48, and 72 h, and the effect on cell viability was assessed using MTT assay. Our results from MTT assay revealed that Manilkara zapota leaf water extract was cytotoxic to all cancer cells studied after 72 h incubation. As illustrated in Table 2, Manilkara zapota leaf water extract suppressed the viability of HT-29 cell line after 24, 48, and 72 h, with IC50 values 121.20 ± 15.29, 72.91 ± 8.04, and 42.48 ± 7.40 μg/mL, respectively. HT-29 cells were relatively more sensitive to Manilkara zapota leaf water extract than other cancer cell lines studied. Consistent with the cytotoxic effect found in HT-29 cells, Manilkara zapota leaf water extract also reduces the cell viability of HCT-116 in a time-dependent pattern after 24 h (161.68 ± 5.34 μg/mL), 48 h (99.42 ± 7.11 μg/mL), and 72 h (92.15 ± 7.89 μg/mL). A similar trend was also observed in HeLa and HGT-1 cells. After treatment with Manilkara zapota leaf water extract for 72 h, HeLa (48.72 ± 3.53 μg/mL), HGT-1 (47.57 ± 5.12 μg/mL), HepG2 (49.03 ± 5.98 μg/mL) cells were inhibited. Interestingly, we found that water extract of Manilkara zapota leaf promotes the viability of PC-3 cells after 24, 48, and 72 h (Fig. 1A). Hence, we believed that PC-3 cells were more resistant to the Manilkara zapota leaf water extract compared to other cancer cell lines studied. Nevertheless, increase proliferation of PC-3 cells by water extract of Manilkara zapota leaf in the current study remains to be elucidated. As a positive control, HT-29
2.11.2. Determination of catalase Catalase activity was determined following the method of Claiborne [19]. An aliquot of 1.9 mL (0.05 M, pH 7.0) of phosphate buffer was added into 0.1 mL of supernatant and 1 mL of hydrogen peroxide (0.019 M). The absorbance was read at the wavelength of 240 nm using a UV–vis spectrophotometer. The catalase activity was expressed as nmol H2O2 consumed min−1 mg−1 protein. 2.12. Gene expression Briefly, the cells were treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h. The total RNA was isolated using TRI Reagent®, following the recommended instruction. A 2-g of RNA per 20 μL was reverse-transcribed by High-Capacity RNA-to-cDNA Kit, following the recommended instruction, using Authorized Thermal Cycler (Eppendorf, NY, USA). Quantitative real-time polymerase chain reaction (PCR) was conducted by SYBR® Select Master Mix (CFX) using the designed primer sets (Table 1) originating from human cell lines with optimum annealing temperature evaluated from annealing temperature gradient analysis. All the controls and samples were assessed 750
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Table 2 Treatment of Manilkara zapota leaf water extract (1.56–200 μg/mL) on selected cancer cell lines for 24, 48, and 72 h evaluated by MTT and LDH assays. Cancer cell lines
MTT (μg/mL)
LDH (μg/mL)
24 h HT-29 HCT-116 HeLa HGT-1 HepG2
121.20 161.68 172.28 157.26 115.57
48 h ± ± ± ± ±
15.29 5.34a 5.23a 9.76a 4.96a
a
72 h b
72.91 ± 8.04 99.42 ± 7.11b 129.35 ± 6.21b 99.35 ± 10.11b 167.92 ± 9.92a
24 h
42.48 92.15 48.72 47.57 49.03
± ± ± ± ±
c
7.40 7.89b 3.53c 5.12c 5.98b
115.64 184.33 203.44 110.15 102.17
48 h ± ± ± ± ±
a
12.23 4.22a 13.22a 10.23ab 6.35a
72 h a
116.93 ± 6.78 101.59 ± 9.52b 100.54 ± 9.67b 127.52 ± 8.65a 76.52 ± 3.94a
46.98 88.37 63.46 91.92 48.97
± ± ± ± ±
1.23b 8.23b 6.93c 6.54b 7.94b
HCT-116 = human colon carcinoma, HeLa = human cervical cancer, HepG2 = human hepatocellular carcinoma, HGT-1 = human gastric adenocarcinoma, HT-29 = human colorectal adenocarcinoma, LDH = lactate dehydrogenase, MTT = 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. Values are reported as mean ± SD (n = 3). Value with different superscript letter in the same row for their respective assay indicates significant difference by one−way analysis of variance (ANOVA) (p < 0.05).
water extract is selectively inhibited the cancer cell lines without affecting BALB/c 3T3 cells as measured using both MTT and LDH assays (Figs. 1C and ID). Taken together, our data suggest that Manilkara zapota leaf water extract can induce cytotoxicity in different cancer cell lines, particularly in HT-29 cells. Thus, the HT-29 cells were selected for further analyses. Given the broad cytotoxicity range of Manilkara zapota leaf water extract against HT-29 cells as evaluated using both LDH and MTT assays, only these three concentrations (21, 42, and 84 μg/mL) were selected for further analyses.
cells were incubated with the commercial drug, 5-Fluorouracil (5-FU). After treatment with 5-FU for 24, 48, and 72 h, the viability of HT-29 cells was inhibited, with IC50 values 10.94 ± 3.24, 9.38 ± 1.26, and 1.40 ± 0.65 μg/mL [20], respectively. This finding indicates that 5-FU was capable to suppress the viability of HT-29 cells better compared to Manilkara zapota leaf water extract. In order to verify the cytotoxicity activity of Manilkara zapota leaf water extract, the viability of all cancer cells studied was measured using the LDH assay. Consistent with MTT results, LDH analyses demonstrated that the cell viability of HCT-116 and HT-29 cells was inhibited after treatment with Manilkara zapota leaf water extract (Table 2). Compared to other cancer cell lines studied, HT-29 cells are the most sensitive towards Manilkara zapota leaf water extract with an IC50 value 46.98 ± 1.23 μg/mL after 72 h incubation. Conversely, HeLa, HGT-1, and HepG2 cells were less sensitive compared to HT-29 cells (Table 2). Consistent with the cytotoxic effect observed in MTT results, our LDH analysis further demonstrated that Manilkara zapota leaf water extract induces proliferation of PC-3 cells after 24, 48, and 72 h (Fig. 1B). Notably, our data showed that Manilkara zapota leaf
3.2. Manilkara zapota leaf water extract triggers morphological changes in HT-29 cells To explore the cell morphology of HT-29 treated with Manilkara zapota leaf water extract, the cells were exposed to 21, 42, and 84 μg/ mL of Manilkara zapota leaf water extract. As shown in Fig. 2, increasing concentrations of Manilkara zapota leaf water extract from 21 to 84 μg/ mL for 24, 48, and 72 h trigger cell morphological changes and a decrease in the number of cells. The proliferation of cells treated with
Fig. 1. Treatment of Manilkara zapota leaf water extract on cancer and normal cells. (A) Manilkara zapota leaf water extract increases the proliferation of human prostate cancer (PC-3) cells after 24, 48, and 72 h. The cell viability was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. (B) Manilkara zapota leaf water extract promotes the proliferation of PC-3 cells after 24, 48, and 72 h evaluated by lactate dehydrogenase (LDH) assay. (C) Treatment of Manilkara zapota leaf water extract in mouse fibroblast (BALB/c 3T3) cell lines evaluated using MTT assay. (D) Cell viability of BALB/c 3T3 cell lines after treatment with Manilkara zapota leaf water extract was evaluated using LDH assay. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05). 751
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Fig. 2. Morphological changes of HT-29 cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract. Reduction of the cell population was observed with increasing concentration of the treatment compared to the control, viewed under an inverted light microscope (Magnification 200 ×).
Fig. 3. Close-up view of morphological changes in HT-29 cells after treatment with Manilkara zapota leaf water extract. Untreated HT-29 cells (control), HT-29 cells treated with Manilkara zapota leaf water extract at concentrations of 21, 42, and 84 μg/mL for 24, 48, and 72 h viewed under an inverted light microscope. The cells showed apoptosis characteristics such as cellular shrinkage (CS), apoptotic bodies (AB), nuclear fragmentation (NF), and membrane blebbing (MB) (Magnification 400 ×).
84 μg/mL of Manilkara zapota leaf water extract for 24 and 48 h was inhibited and this phenomenon became obvious at 72 h (Fig. 2). In addition, we also observed that the cells exposed to Manilkara zapota leaf water extract exhibited some characteristics of apoptosis for instance nuclear fragmentation (NF), cellular shrinkage (CS), apoptotic bodies (AB), and membrane blebbing (MB) (Fig. 3).
3.3. Mode of cell death in HT-29 cells exposed to Manilkara zapota leaf water extract The morphological changes in HT-29 cells exposed to Manilkara zapota leaf water extract were further evaluated using AO and PI double staining after exposure to 21, 42, and 84 μg/mL water extract of Manilkara zapota leaf for 24, 48, and 72 h. As shown in Fig. 4, prominent changes were noted in HT-29 cells treated with 42 and 84 μg/mL 752
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Fig. 4. Morphological characterizations of cells undergo apoptotic cell death using acridine orange and propidium iodide staining. Untreated human colorectal cancer (HT-29) cells and HT-29 cells induced with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. Untreated HT-29 cells showed normal structure (viable cells (VC)). Treated cells showed the typical characteristics of apoptosis, such as nuclear margination (NM), nuclear fragmentation (NF), chromatin condensation (CC), secondary necrotic (SN) cell, apoptotic bodies (AB), and late apoptotic (LA) cell (Magnification 200 × and 400 ×).
compared to the control (Figs. 5C and D). The total apoptotic cells in HT-29 cells exposed to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 48 and 72 h were significantly elevated (p < 0.05) compared to the untreated cells, with the highest effect at a dosage of 42 and 84 μg/mL for 48 and 72 h, respectively. Overall, our findings suggest that Manilkara zapota leaf water extract induces translocation of phosphatidylserine from inner to the outer leaflet of the cell membrane, indicate a hallmark of apoptosis. Apoptosis is vitally important for colon cancer therapy [21]. Data shown in the present study implied that the induction of apoptotic cells by Manilkara zapota leaf water extract could be of greater significance in identifying the anticancer effect of this extract in colon cancer. Accordingly, these findings provide evidence that Manilkara zapota leaf water extract triggers apoptotic cell death in HT-29 cells.
water extract of Manilkara zapota leaf for 72 h. Treatment with 42 and 84 μg/mL of Manilkara zapota leaf water extract for 72 h led to the prominent changes of cells such as nuclear fragmentation (NF) and chromatin condensation (CC) indicate that Manilkara zapota leaf water extract triggered apoptosis in HT-29 cells. The apoptotic cells were seen as fluorescent bright-green color (Fig. 4). Conversely, untreated HT-29 cells showed a round morphology with similar sizes, appeared healthy, and displayed an intact nucleus (green color) (Fig. 4). Other than apoptotic cells, secondary necrotic (SN) cells were also noted and can be seen in red color after treatment with 42 and 84 μg/mL Manilkara zapota leaf water extract for 48 and 72 h (Fig. 4). 3.4. Manilkara zapota leaf water extract induces apoptosis in HT-29 cells To examine if the cytotoxic activity of Manilkara zapota leaf water extract was due to the induction of apoptosis, the cells were exposed to 21, 42, and 84 μg/mL water extract of Manilkara zapota leaf for 24, 48, and 72 h and analyzed by Annexin V-FITC/PI double staining (Fig. 5A). Treatment with 42 μg/mL of Manilkara zapota leaf water extract significantly triggered (p < 0.05) the percentage of early apoptotic HT-29 cells compared to the control (Fig. 5B). Additionally, the percentage of late apoptotic HT-29 cells were significantly increased compared to the control after exposure to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24 h (p < 0.05) (Fig. 5B). Collectively, incubation with Manilkara zapota leaf water extract for 24 h significantly increased the total apoptotic cells (p < 0.05), with the highest effect at a dosage of 42 μg/mL. As shown in Fig. 5B, the percentage of total apoptotic cells was more prominent than necrotic cells in HT-29 cells exposed to Manilkara zapota leaf water extract (< 2%). In addition to the effects mentioned above, a similar trend was also observed after treatment with Manilkara zapota leaf water extract for 48 h and 72 h (Figs. 5C and D). Treatment with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 48 and 72 h led to a significant increase (p < 0.05) in the percentage of early and late apoptotic cells
3.5. Manilkara zapota leaf water extract promotes caspase-3 and -8 activities in HT-29 cells To assess the mechanisms of action underlying apoptosis induction in HT-29 cells exposed to Manilkara zapota leaf water extract, we determined the effect of Manilkara zapota leaf water extract on caspase-3 and -8 activities. Elevation of caspases is a crucial molecular target in chemoprevention [22]. As illustrated in Fig. 6, incubation with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h triggered both caspase-3 and -8 activities in a concentration-dependent pattern. However, no significant differences (p < 0.05) in caspase-3 activity after 24 and 48 h incubation with Manilkara zapota leaf water extract. Consistent with the caspase-8 activity observed in 72 h, a significant elevation in the caspase-8 activity was also noted in HT-29 cells treated with 42 and 84 μg/mL of Manilkara zapota leaf water extract for 24 and 48 h compared to the control (p < 0.05). Our findings in this study showed that Manilkara zapota leaf water extract suppresses the viability of colon cancer, leading to programmed cell death via modulation of the caspase-dependent pathway. 753
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Fig. 5. Apoptotic cell death of HT-29 cells (A) after treatment with Manilkara zapota leaf water extract. After 24 h (B), 48 h (C), and 72 h (D) exposure to Manilkara zapota leaf water extract, apoptotic cells were measured using the Annexin V−FITC and propidium iodide staining assay. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates a significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05).
vitro mode of action found in HT-29 cells could be modulated by the antioxidant levels, we investigated the antioxidant effect of these treatments.
To further verify the involvement of caspase stimulation in the apoptotic effect, we measured whether the pan-caspase inhibitor Z-VAD FMK inhibited the apoptosis. When the HT-29 cells were incubated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract cotreated with 20 μM Z-VAD-FMK inhibitor for 48 h, we found that the apoptotic response was reversed, significantly (p < 0.05) (Fig. 7). Similarly, HT29 cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract cotreated with 20 μM Z-VAD-FMK inhibitor for 72 h was also significantly inhibited (p < 0.05) (Fig. 7) compared to Manilkara zapota leaf water extract alone. These results suggest the involvement of caspase-dependent pathways in Manilkara zapota leaf water extractinduced apoptotic cell death in HT-29 cells. To confirm whether the in
3.6. Manilkara zapota leaf water extract decreases malondialdehyde (MDA) and elevates catalase levels in HT-29 cells Mounting evidence showed the positive association between cytotoxicity and antioxidant activities of plant-derived compounds against cancer cells such as resveratrol, quercetin, protocatechuic acid, and gallic acid [23,24]. In the current study, the cytotoxic activity of Manilkara zapota leaf water extract may be linked to the antioxidant 754
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
protein), 42 μg/mL (1.01 ± 0.01 nmol/g of protein), and 84 μg/mL (1.28 ± 0.10 nmol/g of protein) of Manilkara zapota leaf water extract compared to the control (3.64 ± 0.87 nmol/g of protein) (p < 0.05). This result indicates that Manilkara zapota leaf water extract reduces MDA level, with the highest effect noted at a dosage of 42 μg/mL Manilkara zapota leaf water extract (1.01 ± 0.01 nmol/g of protein). In parallel with the highest level of MDA demonstrated in the control group, we also found that the highest MDA levels in 48 h (3.85 ± 0.11 nmol/g of protein) and 72 h (5.19 ± 0.27 nmol/g of protein) compared to other treatment groups (Table 3). However, the MDA levels were decreased after 48 and 72 h incubation with Manilkara zapota leaf water extract. The suppressive effect of Manilkara zapota leaf water extract on MDA level was notable in HT-29 cells exposed to 84 μg/mL of Manilkara zapota leaf water extract (0.87 ± 0.02 nmol/g of protein) at 72 h. Collectively, these data suggest that the reduction of MDA levels observed in the groups treated with Manilkara zapota leaf water extract could be due to the total phenolic content, antioxidant activity, and phytochemical compounds present in the extract. Overall, the findings demonstrated in the present study suggest that Manilkara zapota leaf water extract has the potential to reduce the MDA activity. In addition to the changes observed in the MDA level, we also found that the catalase level in the two treatment groups [21 μg/mL (8.83 ± 0.01 nmol H2O2 consumed min−1 mg−1 protein) and 42 μg/ mL (9.39 ± 0.04 nmol H2O2 consumed min−1 mg−1 protein)] were significantly elevated (p < 0.05) after 24 h incubation compared to the control (6.80 ± 0.66 nmol H2O2 consumed min−1 mg−1 protein) (Table 3). A similar trend was also observed after 48 and 72 h incubation with Manilkara zapota leaf water extract, with the maximum effect obtained at 42 μg/mL (9.35 ± 0.04 nmol H2O2 consumed min−1 mg−1 protein) and 84 μg/mL (9.32 ± 0.01 nmol H2O2 consumed min−1 mg−1 protein) at 48 and 72 h, respectively. These data imply that the cells exposed to Manilkara zapota leaf water extract exhibited an increase in catalase activity is associated with an elevation of antioxidative capacity. Numerous studies have found that phenolic acid for example caffeic acid and gallic acid has antioxidant activity and strong pharmacological action [26]. A positive correlation between cytotoxicity antioxidant activities of plant constituents against cancer cells was also described by Aïssaoui et al. [27]. Thus, it is suggested that Manilkara zapota leaf water extract might have a protective role against cytotoxicity via antioxidant dependent mechanisms including suppressing oxidative stress-induced apoptosis. All these antioxidative enzymes data are in close agreement with the flavonoid and polyphenolic that contained in the water extract of Manilkara zapota leaf. Further, data in this study showed that the treatment of Manilkara zapota leaf water extract contributes to the elevation of apoptotic cells, indicates that the observed effects were more likely attributed by the bioactive compounds contained in the leaf water extract such as total phenolic content (3.14 ± 0.05 mg GAE/g), total flavonoid content (33.71 ± 8.02 μg QE/100 g), antioxidant activity as determined using β-carotene bleaching test (49.94 ± 10.60%) and 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging capacity (0.24 ± 0.02 mg/ mL), saponins, gallic acid (23.11 ± 2.15 μg/g), vanillic acid (5.90 ± 0.71 μg/g), and caffeic acid (3.04 ± 0.12 μg/g) [28]. The
Fig. 6. Caspase-3 and -8 activities in HT-29 cells treated with Manilkara zapota leaf water extract. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05).
Fig. 7. Inhibition of Manilkara zapota leaf water extract-induced apoptosis by the caspase inhibitor Z-VAD-FMK. The HT-29 cells were treated with 20 μM ZVAD-FMK inhibitor alone, Manilkara zapota leaf water extract or cotreated with 20 μM Z-VAD-FMK inhibitor for 24, 48, and 72 h and analyzed for apoptosis by colorimetric assay. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05).
enzyme. Thus, we explored the effect of Manilkara zapota leaf water extract on malondialdehyde (MDA) and catalase activities in HT-29 cells. Table 3 summarizes the changes in MDA and catalase activities after treatment with Manilkara zapota leaf water extract. Our findings demonstrated that untreated HT-29 cells exhibited the highest levels of MDA, indicates an increased lipid peroxidation (Table 3). The impairment of antioxidant enzymes may contribute to this observed effect, which serves as a safeguard cell during detoxification of reactive oxygen species [25]. Conversely, the MDA level was significantly reduced after 24 h incubation with 21 μg/mL (1.95 ± 0.02 nmol/g of
Table 3 Malondialdehyde and catalase levels in human colorectal cancer (HT-29) cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract. Groups
24 h Control 21 μg/mL 42 μg/mL 84 μg/mL
Catalase (nmol H2O2 consumed min−1 mg−1 protein)
Malondialdehyde (nmol/g of protein)
3.64 1.95 1.01 1.28
48 h ± ± ± ±
0.87a 0.02b 0.01b 0.10b
3.85 3.30 1.22 1.22
72 h ± ± ± ±
0.11a 0.27b 0.09c 0.26c
5.19 2.60 1.06 0.87
24 h ± ± ± ±
0.27a 0.14b 0.02c 0.02c
6.80 8.83 9.39 7.25
48 h ± ± ± ±
0.66a 0.01b 0.04b 0.005a
6.35 8.86 9.35 7.18
72 h ± ± ± ±
0.06a 0.03b 0.04c 0.09d
6.93 6.99 8.92 9.32
± ± ± ±
0.04a 0.04a 0.02b 0.01c
Values are reported as mean ± SD (n = 3). Value with different superscript letter in the same column indicates significant difference by one−way analysis of variance (ANOVA) (p < 0.05). 755
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
of β-catenin in a Wnt pathway. Because Manilkara zapota leaf water extract elevates the CK1 and AXIN1 mRNA expression, the susceptibility of HT-29 cells to Manilkara zapota leaf water extract may also be due to GSK3β. Thus, the effect of GSK3β mRNA level in Manilkara zapota leaf water extract-treated HT-29 cells was evaluated. GSK3β regulates several signaling pathways and substrates, the mechanistic action underlying its tumor promoter or suppressor activities are complex [34]. One of the crucial roles of GSK3β on tumor inhibition is more likely through the regulation of Wnt/β-catenin signaling pathway. Active GSK3β triggers the degradation of β-catenin through phosphorylation of ubiquitin-mediated proteasomal, thereby the β-catenin amount in the cytoplasm remains low. Quantitative realtime PCR analyses revealed that the transcriptional activity of GSK3β was predominantly found in the HT-29 cell-treated with 42 and 84 μg/ mL of Manilkara zapota leaf water extract (Fig. 8). This result implies that high GSK3β amounts may contribute to the inhibition of colorectal cancer cells. Our data in the present study was further supported by Tan et al. [8], who observed that the upregulation of GSK3β mRNA level decreases colorectal cancer cell proliferation and suppresses the tumors formation in azoxymethane-treated colon carcinogenesis in rats. Because we found the elevation of AXIN1, CK1, and GSK3β mRNA levels, we further determined the transcriptional activity of APC in Manilkara zapota leaf water extract-treated HT-29 cells. APC is a large protein interacts with β-catenin and AXIN1. It plays a crucial role as a destruction complex in colorectal cancer [35]. As illustrated in Fig. 8, untreated HT-29 cells demonstrated the lowest APC mRNA expression compared to other treatment groups. Almost 70% of colorectal cancer cases are caused by the APC gene mutations and thus are considered as an initiating event due to an inability of the destruction complex to trigger the phosphorylation of β-catenin [36]. Our results showed that treatment with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h significantly upregulated (p < 0.05) the transcriptional activity of APC in HT-29 cells compared to the control (Fig. 8). Taken together, our data suggested that Manilkara zapota leaf water extract inhibits cell viability of HT-29 and induces apoptosis via the modulation of destruction complex in the Wnt signaling pathway.
previous study has reported that plant exerts a high amount of phenolic content exhibited a good antioxidant activity [29]. Accordingly, the synergistic/additive effects of phenolic, flavonoid, and antioxidant activity may contribute to the apoptotic effects observed in this study. Taken together, our findings demonstrated in this study suggest that Manilkara zapota leaf water extract may confer a protective role against colorectal cancer.
3.7. Manilkara zapota leaf water extract upregulates mRNA levels of AXIN1, CK1, GSK3β, and APC in HT-29 cells To evaluate whether the growth inhibitory effects of Manilkara zapota leaf water extract in HT-29 cells are caused by the biological action of Manilkara zapota leaf water extract, the transcriptional activity of upstream-associated genes in the Wnt pathway was evaluated by quantitative real-time PCR. Wnt/β-catenin signaling activity usually depends on the amount of cytoplasmic β-catenin, where the β-catenin is subjected for phosphorylation through destruction complex comprising of APC, GSK3β, AXIN1, and CK1 [30]. Therefore, the transcriptional activity of CK1, AXIN1, APC, and GSK3β in response to Manilkara zapota leaf water extract was assessed using quantitative real-time PCR. It has been reported that the β-catenin can be stabilized via suppression of destruction complex in Wnt pathway [31]. Overexpression of AXIN1 triggers the degradation of β-catenin in cells express truncated APC [32]. Thus, AXIN1 transcriptional activity needs to be mediated to ensure proper regulation of the Wnt pathway. Our current study demonstrated that treatment with 42 and 84 μg/mL of Manilkara zapota leaf water extract significantly upregulated (p < 0.05) the AXIN1 mRNA level compared to the control (Fig. 8). Hence, the transcriptional activity of AXIN1 may play a crucial role in negatively modulating the Wnt activity to trigger the degradation and phosphorylation of β-catenin. The phosphorylation of β-catenin not only mediated by AXIN1 but also modulated by CK1. Beta-catenin is subjected for phosphorylation through the ubiquitin-mediated proteolysis via the regulation of CK1 [33]. As illustrated in Fig. 8, the transcriptional activity of CK1 in HT29 cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h was significantly upregulated compared to the control (p < 0.05). Treatment with Manilkara zapota leaf water extract at 21, 42, and 84 μg/mL increased the transcriptional activity of CK1 in a concentration-dependent manner, and this elevation may be linked to the induction of apoptosis, and subsequently resulting the degradation
3.8. Manilkara zapota leaf water extract downregulates mRNA expression of beta-catenin in HT-29 cells The Wnt/β-catenin signaling plays a critical role in cancer susceptibility and tissue homeostasis. Inappropriate activation of β-catenin causes tumor formation, triggers nuclear localization of β-catenin, and stimulates Wnt target genes [37,38]. The transcriptional activity of βcatenin was downregulated in a dose-dependent pattern when the concentration of Manilkara zapota leaf water extract was increased, indicating that Manilkara zapota leaf water extract triggered the phosphorylation of β-catenin in a concentration-dependent pattern (Fig. 8). However, we observed a high β-catenin mRNA expression in untreated HT-29 cells (Fig. 8). Beta-catenin mutated genes are usually observed in colorectal cancer cells or azoxymethane-treated colon cancer in mice and rats [8,39]. Taken together, the results demonstrated in this study suggest that Manilkara zapota leaf water extract may modulate colorectal cancer via Wnt/β-catenin signaling pathway. 4. Conclusions Our study demonstrated that Manilkara zapota leaf water extract induces apoptosis in colorectal cancer cells via regulation of Wnt/βcatenin and caspase-dependent pathways and elevation of antioxidant activity. However, further studies are warranted in the elucidation and isolation of bioactive constituents of this extract that contribute to the cytotoxic activity and apoptosis. Taken together, this finding implies that the potential use of Manilkara zapota leaf water extract against colon carcinogenesis.
Fig. 8. mRNA levels of AXIN1, casein kinase 1 (CK1), glycogen synthase kinase 3β (GSK3β), adenomatous polyposis coli (APC), and β-catenin in HT-29 cells treated with Manilkara zapota leaf water extract for 72 h and evaluated using quantitative real−time polymerase chain reaction (PCR). Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05). 756
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Conflict of interest
Oxygen Radical Research, CRC Press, Boca Raton, 1985, pp. 283–284. [20] B.L. Tan, M.E. Norhaizan, L.C. Chan, An intrinsic mitochondrial pathway is required for phytic acid-chitosan-iron oxide nanocomposite (Phy-CS-MNP) to induce G0/G1 cell cycle arrest and apoptosis in the human colorectal cancer (HT-29) cell line, Pharmaceutics 10 (2018) 198, https://doi.org/10.3390/pharmaceutics10040198. [21] K. Yamagata, Y. Izawa, D. Onodera, M. Tagami, Chlorogenic acid regulates apoptosis and stem cell marker-related gene expression in A549 human lung cancer cells, Mol. Cell. Biochem. 441 (2018) 9–19, https://doi.org/10.1007/s11010-0173171-1. [22] I.A. Adedara, B.F. Olabiyi, T.D. Ojuade, U.F. Idris, E.M. Onibiyo, E.O. Farombi, Taurine reverses sodium fluoride-mediated increase in inflammation, caspase-3 activity, and oxidative damage along the brain-pituitary-gonadal axis in male rats, Can. J. Physiol. Pharmacol. 95 (2017) 1019–1029, https://doi.org/10.1139/cjpp2016-0641. [23] A. Rauf, M. Imran, M.S. Butt, M. Nadeem, D.G. Peters, M.S. Mubarak, Resveratrol as an anti-cancer agent: a review, Crit. Rev. Food Sci. Nutr. 58 (2018) 1428–1447, https://doi.org/10.1080/10408398.2016.1263597. [24] Y.S. Tor, L.S. Yazan, J.B. Foo, A. Wibowo, N. Ismail, Y.K. Cheah, R. Abdullah, M. Ismail, I.S. Ismail, S.K. Yeap, Induction of apoptosis in MCF-7 cells via oxidative stress generation, mitochondria-dependent and caspase-independent pathway by ethyl acetate extract of Dillenia suffruticosa and its chemical profile, PLoS One 10 (2015) e0127441, , https://doi.org/10.1371/journal.pone.0127441. [25] K. Singh Chandra, C. Gagan, N.M. Ann, G.-P. Liz Mariely, J. Mack Nicholas, A. Nihal, The role of sirtuins in antioxidant and redox signaling, Antioxid. Redox Signal. 28 (2018) 643–661, https://doi.org/10.1089/ars.2017.7290. [26] L. Crascì, M.R. Lauro, G. Puglisi, A. Panico, Natural antioxidant polyphenols on inflammation management: anti-glycation activity vs metalloproteinases inhibition, Crit. Rev. Food Sci. Nutr. 58 (2018) 893–904, https://doi.org/10.1080/10408398. 2016.1229657. [27] H. Aïssaoui, T. Mencherini, T. Esposito, N. De Tommasi, P. Gazzerro, S. Benayache, F. Benayache, R. Mekkiou, Heliotropium bacciferum Forssk. (Boraginaceae) extracts: chemical constituents, antioxidant activity and cytotoxic effect in human cancer cell lines, Nat. Prod. Res. 12 (2018) 1–6, https://doi.org/10.1080/ 14786419.2018.1437433. [28] B.L. Tan, M.E. Norhaizan, L.C. Chan, Manilkara zapota (L.) P. Royen leaf water extract induces apoptosis in human hepatocellular carcinoma (HepG2) cells via ERK1/2/Akt1/JNK1 signaling pathways, Evid. Complement. Alternat. Med. 2018 (2018) 17, https://doi.org/10.1155/2018/7826576 7826576. [29] O.R. Alara, N.H. Abdurahman, S.K.A. Mudalip, O.A. Olalere, Characterization and effect of extraction solvents on the yield and total phenolic content from Vernonia amygdalina leaves, J. Food Meas. Charact. 12 (2018) 311–316, https://doi.org/10. 1007/s11694-017-9642-y. [30] F. Takahashi-Yanaga, M. Kahn, Targeting Wnt signalling: can we safely eradicate cancer stem cells? Clin. Cancer Res. 16 (2010) 3153–3162, https://doi.org/10. 1158/1078-0432.CCR-09-2943. [31] C.S. Cselenyi, K.K. Jernigan, E. Tahinci, C.A. Thorne, L.A. Lee, E. Lee, LRP6 tranduces a canonical Wnt signal independently of Axin degradation by inhibiting GSK3’s phosphorylation of β-catenin, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 8032–8037, https://doi.org/10.1073/pnas.0803025105. [32] M. Kishida, S. Koyama, S. Kishida, K. Matsubara, S. Nakashima, K. Higano, R. Takada, S. Takada, A. Kikuchi, Axin prevents Wnt-3a-induced accumulation of βcatenin, Oncogene 18 (1999) 979–985, https://doi.org/10.1038/sj.onc.1202388. [33] J. Deitrick, W.M. Pruitt, Wnt/β-catenin-mediated signaling commonly altered in colorectal cancer, Prog. Mol. Biol. Transl. Sci. 144 (2016) 49–68, https://doi.org/ 10.1016/bs.pmbts.2016.09.010. [34] S. Shang, F. Hua, Z.-W. Hu, The regulation of β-catenin activity and function in cancer: therapeutic opportunities, Oncotarget 8 (2017) 33972–33989, https://doi. org/10.18632/oncotarget.15687. [35] L. Zhang, J.W. Shay, Multiple roles of APC and its therapeutic implications in colorectal cancer, J. Natl. Cancer Inst. 109 (2017) djw332, , https://doi.org/10. 1093/jnci/djw332. [36] S.G. Pai, B.A. Carneiro, J.M. Mota, R. Costa, C.A. Leite, R. Barroso-Sousa, J.B. Kaplan, Y.K. Chae, F.J. Giles, Wnt/beta-catenin pathway: modulating anticancer immune response, J. Hematol. Oncol. 10 (2017) 101, https://doi.org/10. 1186/s13045-017-0471-6. [37] S. Liang, S. Zhang, P. Wang, C. Yang, C. Shang, J. Yang, J. Wang, LncRNA, TUG1 regulates the oral squamous cell carcinoma progression possibly via interacting with Wnt/β-catenin signaling, Gene 608 (2017) 49–57, https://doi.org/10.1016/j. gene.2017.01.024. [38] B.L. Tan, N.M. Esa, H.S. Rahman, H. Hamzah, R. Karim, Brewers’ rice induces apoptosis in azoxymethane-induced colon carcinogenesis in rats via suppression of cell proliferation and the Wnt signaling pathway, BMC Complement, Altern. Med. 14 (2014) 304, https://doi.org/10.1186/1472-6882-14-304. [39] K. Lee, A.S. Lindsey, N. Li, B. Gary, J. Andrews, A.B. Keeton, G.A. Piazza, β-catenin nuclear translocation in colorectal cancer cells is suppressed by PDE10A inhibition, cGMP elevation, and activation of PKG, Oncotarget 7 (2016) 5353–5365, https:// doi.org/10.18632/oncotarget.6705.
The authors declare that they have no competing interests. Funding This work was funded by the Ministry of Science, Technology, and Innovation (MOSTI), Malaysia (project no. 02-01-04-SF2141). Acknowledgements The authors would like to thank all the laboratory staffs from the Department of Nutrition and Dietetics who contributed to this study. References [1] World Health Organization, Cancer, (2017) . (Accessed 3 April 2018) http://www. who.int/mediacentre/factsheets/fs297/en/. [2] Malaysian National Cancer Registry Report, Press Statement Director General of Health Malaysia, (2016) . (Accessed 26 February 2017) www.moh.gov.my/index. php/database_stores/attach_download/337/833. [3] M.D. Thompson, S.P.S. Monga, Wnt/-catenin signaling in liver health and disease, Hepatology 45 (2007) 1298–1305, https://doi.org/10.1002/hep.21651. [4] F. Rahmani, A. Avan, A.S.I. Hashemy, S.M. Hassanian, Role of Wnt/β-catenin signaling regulatory microRNAs in the pathogenesis of colorectal cancer, J. Cell. Physiol. 233 (2018) 811–817, https://doi.org/10.1002/jcp.25897. [5] S. Shang, F. Hua, Z.-W. Hu, The regulation of β-catenin activity and function in cancer: therapeutic opportunities, Oncotarget 8 (2017) 33972–33989, https://doi. org/10.18632/oncotarget.15687. [6] V.V. Sathibabu Uddandrao, P. Brahmanaidu, P.R. Nivedha, S. Vadivukkarasi, G. Saravanan, Beneficial role of some natural products to attenuate the diabetic cardiomyopathy through Nrf2 pathway in cell culture and animal models, Cardiovasc. Toxicol. 18 (2018) 199–205, https://doi.org/10.1007/s12012-0179430-2. [7] B.L. Tan, M.E. Norhaizan, L.C. Chan, ROS-mediated mitochondrial pathway is required for Manilkara zapota (L.) P. Royen leaf methanol extract inducing apoptosis in the modulation of caspase activation and EGFR/NF-κB activities of HeLa human cervical cancer cells, Evid. Complement. Alternat. Med. 2018 (2018) 19, https:// doi.org/10.1155/2018/6578648 6578648. [8] B.L. Tan, M.E. Norhaizan, K. Huynh, S.K. Yeap, H. Hazilawati, K. Roselina, Brewers’ rice modulates oxidative stress in azoxymethane-mediated colon carcinogenesis in rats, World J. Gastroenterol. 21 (2015) 8826–8835, https://doi.org/10.3748/wjg. v21.i29.8826. [9] B.L. Tan, M.E. Norhaizan, W.-P.-P. Liew, Nutrients and oxidative stress: friend or foe? Oxid. Med. Cell. Longev. 2018 (2018) 24, https://doi.org/10.1155/2018/ 9719584 9719584. [10] P. Sathishkumar, F.L. Gu, Q. Zhan, T. Palvannan, A.R. Mohd Yusoff, Flavonoids mediated ‘Green’ nanomaterials: a novel nanomedicine system to treat various diseases–current trends and future perspective, Mater. Lett. 210 (2018) 26–30, https://doi.org/10.1016/j.matlet.2017.08.078. [11] K. Govindaraju, A. Ingels, M.N. Hasan, D. Sun, V. Mathieu, M. Masi, A. Evidente, A. Kornienko, Synthetic analogues of the montanine-type alkaloids with activity against apoptosis-resistant cancer cells, Bioorg. Med. Chem. Lett. 28 (2018) 589–593, https://doi.org/10.1016/j.bmcl.2018.01.041. [12] M.A. Khalek, Z. Khatun, M.R. Habib, M.R. Karim, Antitumor activity of Manilkara zapota (L.) fruits against Ehrlich ascites carcinoma in mice, Biologija 61 (2015) 145–152, https://doi.org/10.6001/biologija.v61i3-4.3206. [13] Q.-L. Song, L.Z. Zhang, G.-S. Li, K. Xiao, Q.-T. Han, S.-J. Dai, Cytotoxic sesquiterpenoid derivatives from the whole plant of Solanum septemlobum, Chem. Nat. Comp. 54 (2018) 69–72, https://doi.org/10.1007/s10600-018-2261-y. [14] A. Ghani, Medicinal Plants of Bangladesh: Chemical Constituents and Uses, Asiatic Society of Bangladesh, Dhaka, 2003. [15] M.Y. Haji Mohiddin, W. Chin, D. Holdsworth, Traditional medicinal plants of Brunei Darussalam part III. Sengkurong, Int. J. Pharmacogn. 30 (1992) 105–108. [16] B.L. Tan, M.E. Norhaizan, H.J. Suhaniza, C.C. Lai, S. Norazalina, K. Roselina, Antioxidant properties and antiproliferative effect of brewers’ rice extract (temukut) on selected cancer cell lines, Int. Food Res. J. 20 (2013) 2117–2124. [17] B.L. Tan, M.E. Norhaizan, S.K. Yeap, K. Roselina, Water extract of brewers’ rice induces antiproliferation of human colorectal cancer (HT-29) cell lines via the induction of apoptosis, Eur. Rev. Med. Pharmacol. Sci. 19 (2015) 1022–1029. [18] M. Suhail, M. Faizul-Suhail, Oxidant-antioxidant status in pair-matched maternal and cord blood of normotensive and preeclamptic patients, Zhongguo Linchuang Yixue Yingxiang Zazhi 4 (2009) 241–248. [19] A. Claiborne, Catalase activity, in: R.A. Green Wald (Ed.), Handbook of Methods for
757
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Manilkara zapota (L.) P. Royen leaf water extract triggered apoptosis and activated caspase-dependent pathway in HT-29 human colorectal cancer cell line Bee Ling Tana, Mohd Esa Norhaizana,b,c,
T
⁎
a
Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia Research Centre of Excellent, Nutrition and Non-Communicable Diseases (NNCD), Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia c Laboratory of Molecular Biomedicine, Institute of Bioscience, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia b
A R T I C LE I N FO
A B S T R A C T
Keywords: Apoptosis Beta-catenin Caspase-dependent pathway Cytotoxicity Manilkara zapota
Manilkara zapota (L.) P. Royen (Family: Sapotaceae), commonly called as sapodilla, has been applied as traditional folk medicine for diarrhea and pulmonary infections. Conventional therapy in colorectal cancer is not likely effective due to undesirable outcomes. The anti-colon cancer properties of Manilkara zapota leaf water extract have yet to be investigated thus far. Therefore, our present study aimed to evaluate the ability to induce apoptosis and the underlying mechanisms of Manilkara zapota leaf water extract against human colorectal cancer (HT-29) cells. The cytotoxicity of Manilkara zapota leaf water extract was screened in different cancer cell lines using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and lactate dehydrogenase (LDH) analyses. The morphological changes in HT-29 cell lines after exposure to Manilkara zapota leaf water extract were viewed under fluorescence and inverted light microscope. The apoptotic cell was measured by Annexin Vpropidium iodide staining. The caspase-3 and -8 activities were assessed by colorimetric assay. Overall analyses revealed that treatment with Manilkara zapota leaf water extract for 72 h can inhibit the viability of HT-29 cells. Incubation with Manilkara zapota leaf water extract for 24, 48, and 72 h significantly increased (p < 0.05) the total apoptotic cells compared to the control. Treatment with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h triggered both caspase-3 and -8 activities in a concentration-dependent pattern. We also found that the catalase level in the two treatment groups (21 and 42 μg/mL) was significantly elevated after 24 h incubation. Incubation with Manilkara zapota leaf water extract for 72 h triggered the transcriptional elevation of the adenomatous polyposis coli (APC), glycogen synthase kinase 3β (GSK3β), AXIN1, and casein kinase 1 (CK1). The β-catenin mRNA levels were reduced accordingly when the concentration of the Manilkara zapota leaf water extract was increased. Our results suggested that Manilkara zapota leaf water extract offer great potential against colorectal cancer through modulation of Wnt/β-catenin signaling pathway, caspase-dependent pathway, and antioxidant enzyme.
1. Introduction Colorectal cancer represents the third leading cancer after lung and liver cancers [1]. In Malaysia, colorectal cancer has become the second leading cancer in females and the most common cancer in males [2]. Nearly 103,507 new cancer cases were reported from 2007 to 2011, contributes for 46,794 (45.2%) and 56,713 (54.8%) in males and females, respectively [2]. The previous study has reported that Wnt/β-catenin signaling
pathway involves in the human biology [3]. Inappropriate stimulation of the Wnt signaling has been linked to colorectal cancer [4]. The cytoplasmic β-catenin is regulated at a low level through ubiquitin-proteasome-mediated degradation and is modulated by a destruction complex including adenomatous polyposis coli (APC), glycogen synthase kinase 3β (GSK3β), AXIN1, and casein kinase 1 (CK1) [5]. Natural dietary products have been recognized as a source of remedy [6]. The plant is of particular interest because its derived compounds modulate oxidative stress and thus affecting cancer cell
⁎ Corresponding author at: Department of Nutrition and Dietetics, Faculty of Medicine and Health Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia. E-mail address: [email protected] (M.E. Norhaizan).
https://doi.org/10.1016/j.biopha.2018.12.027 Received 27 June 2018; Received in revised form 5 December 2018; Accepted 5 December 2018 0753-3322/ © 2018 Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
2.4. Determination of cytotoxicity of Manilkara zapota leaf water extract
development by altering gene and protein expression. Pharmacological activities in plants are strongly correlated with natural antioxidants [7]. Antioxidants have shown their ability to reduce adverse outcomes of reactive species and have been identified for the treatment of many diseases and severe disorders including heart disease and cancer [8,9]. Plant-derived compounds such as flavonoids, alkaloids, phenolic compounds, terpenoids, tannins, and steroids have antitumor properties and may reduce undesirable side effects [10,11]. Further, plants exert highly diverse and complex molecular bioactive compounds, and therefore plant kingdom is a potential source of antineoplastic and cytotoxic agent [12,13]. Manilkara zapota (L.) P. Royen (Family: Sapotaceae), commonly called as sapodilla, or locally known as ciku, is an evergreen tree found abundantly throughout India subcontinent including Bangladesh [14], though it is native to Mexico and Central America. Manilkara zapota leaf has been traditionally applied as traditional folk medicine for cough, cold, and diarrhea [15]. Nevertheless, the anti-colon cancer properties of Manilkara zapota leaf water extract have yet to be investigated thus far. Our earlier study found that Manilkara zapota leaf methanol extract inhibited the proliferation of HeLa human cervical cancer cells [7]. Therefore, this study aimed to investigate the ability to induce apoptosis and the underlying mechanisms of Manilkara zapota leaf water extract against HT-29 human colorectal cancer cell lines. Collectively, understanding the mode of action in anticancer activities of Manilkara zapota leaf water extract and the cytotoxic effect may contribute to the development of a promising anticancer agent.
HeLa, HepG2, PC-3, HT-29, BALB/c 3T3, HCT-116, and HGT-1 cell lines were seeded in a 96-well plate (1 × 105 cells/well) for 24 h. The cells were treated with different concentration (1.56–200 μg/mL) water extract of Manilkara zapota leaf. After 24, 48, and 72 h of treatment, 5 mg/mL of MTT (20 μL) was added into each well and incubated for 2–4 h. Following 2–4 h incubation, 100 μL of dimethyl sulfoxide was added and the absorbance was read using ELISA microplate reader (Tecan, Switzerland) at the wavelength of 570 nm. The reference wavelength used was 630 nm. 2.5. Lactate dehydrogenase assay Cytotoxicity was evaluated using an in vitro Toxicology Assay Kit by the release of lactate dehydrogenase (LDH), according to the recommended instruction. HeLa, HepG2, PC-3, HT-29, BALB/c 3T3, HCT116, and HGT-1 cells were seeded in a 96-well plate (1 × 105 cells/ well) for 24 h. All cells were treated with 1.56–200 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h, and the supernatant was used to measure the LDH activity. The absorbance was measured using ELISA microplate reader (Tecan, Switzerland) at 490 nm. 2.6. Morphological changes of HT-29 cells exposed to Manilkara zapota leaf water extract The HT-29 cells were seeded in a 6-well plate (1 × 106 cells/well). Following 24 h of incubation, the cells were exposed to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. The necrosis or apoptosis characteristic of the cells was visualized under an inverted light microscope (Olympus, Center Valley, PA, USA).
2. Materials and methods 2.1. Reagents and chemicals Dulbecco's Modified Eagle Medium (DMEM), trypsin EDTA (1×), RPMI-1640 medium, and Mycoplex™ fetal bovine serum (FBS) were procured from Gibco (Grand Island, NY, USA). CaspACE™ Assay System, Colorimetric was bought from Promega (Madison, Wisconsin, USA). All other reagents used were bought from Sigma-Aldrich (St. Louis, MO, USA).
2.7. Quantification of apoptosis using acridine orange and propidium iodide Acridine orange (AO) and propidium iodide (PI) double staining were performed following the method described by Tan et al. [17]. The cells were seeded in a 6-well plate (1 × 106 cells/well) for 24 h. Following 24, 48, and 72 h of treatment, 1 mg/mL of AO and PI were added into the cells. The cell morphology was viewed at 400× and 200× magnifications using a fluorescence microscope (Olympus, Center Valley, PA, USA).
2.2. Plant extraction The plant (Manilkara zapota (L.) P. Royen) was collected from Pahang, Malaysia. Authentication of the plant was conducted at Biodiversity Unit, Institute of Bioscience, Universiti Putra Malaysia (voucher specimen number: SK 3179/17). Briefly, leaf of Manilkara zapota was cut into small pieces and dried in an oven at 40 °C for 3 days before ground into powder form. Manilkara zapota leaf was extracted using water following the method described by Tan et al. [16]. Five g of ground samples were extracted with 40 mL of water at 40 °C for 2 h. The slurry was filtered using filter paper and the residues were re-extracted. Lastly, the filtrate from water extract was freeze-dried using a freeze drier (Tecan, Switzerland) to obtain a concentrated powder.
2.8. Determination of apoptosis by Annexin V-propidium iodide staining Late and early apoptotic cells were measured by Annexin V-FITC Apoptosis Detection Kit I. The cells were seeded in 25 cm2 tissue culture flask (1 × 106 cells). After 24 h, the cells were treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. Following trypsinization, the cells were washed two times with phosphate-buffered saline-bovine serum albumin-ethylenediaminetetraacetic acid and resuspended the cell pellet in 100 μL of 1× binding buffer. Ten μL of PI and 5 μL of Annexin V-fluorescein isothiocyanate (FITC) were mixed with each sample and incubated for 10 min. Subsequently, 1× binding buffer (400 μL) was added and the fluorescence of cells was measured using a flow cytometry FACS Calibur flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA).
2.3. Cell culture The human hepatocellular carcinoma (HepG2), human cervical cancer (HeLa), human prostate cancer (PC-3), human colorectal adenocarcinoma (HT-29), mouse fibroblast (BALB/c 3T3), human colon carcinoma (HCT-116), and human gastric adenocarcinoma (HGT-1) cell lines were procured from American Type Culture Collection (Rockville, MD, USA). HCT-116, HGT-1, and HT-29 cells were cultured in DMEM supplemented with 10% (v/v) FBS, 100 IU/mL penicillin, and 100 μg/ mL streptomycin. The BALB/c 3T3, HeLa, HepG2, and PC-3 cells were cultured in RPMI-1640 medium supplemented with 100 μg/mL streptomycin, 100 IU/mL penicillin, and 10% (v/v) FBS. All cell lines were grown at 37 °C humidified atmosphere incubator with 5% CO2.
2.9. Caspase-3 and caspase-8 activities The caspase-3 and -8 assays were measured using a commercial colorimetric assay kit. Briefly, the cells were seeded in a 6-well plate (1 × 105 cells/well). After an overnight incubation, the cells were treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. The cell pellets were lysed in 25 μL of cold lysis buffer prior to incubation for 10 min on ice. An aliquot of 50 μL of 2 × Reaction Buffer 8 or 2 × Reaction Buffer 3 was added into 50 μL of 749
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
cell lysate (200 μg total protein), followed by 5 μL of caspase-3 or caspase-8 colorimetric substrate (DEVD-pNa or IETD-pNa). Following 2 h of incubation, the absorbance in each well was measured at 405 nm.
Table 1 The nucleotide sequence of PCR primers for amplification and sequence-specific detection of cDNA (obtained from the GenBank database).
2.10. Caspase inhibitor assay The caspase inhibitor was measured using a CaspACE™ Assay System, Colorimetric, according to the recommended instruction. Briefly, the cells were seeded in a 6-well plate (1 × 105 cells/well). The cells were treated with 20 μM Z-VAD-FMK inhibitor alone, Manilkara zapota leaf water extract or cotreated with 20 μM Z-VAD-FMK inhibitor. Following 24, 48, and 72 h of treatment, the cells were trypsinized and centrifuged at 450 × g for 10 min at 4 °C. The cell pellet was rinsed with 1× ice-cold phosphate-buffered saline (PBS) and resuspended in cell lysis buffer prior to incubation for 15 min on ice. The cell lysates were centrifuged at 15,000 × g for 20 min at 4 °C. The supernatants were collected and stored at −70 °C. An aliquot of 20 μL of cell extract (25–100 μg total protein) was added into each well of 96-well plate, followed by 2 μL of DEVD-pNA Substrate. Subsequently, the plate was covered with Parafilm® laboratory film and incubated at 37 °C for 4 h. Following 4 h of incubation, the absorbance in each well was measured at 405 nm.
Primer name [accession number]
Oligonucleotides (5′-3′) sequence
AXIN1 [XM_005255610.2] CK1 [NM_001271741.1] GSK3β [BC012760] APC [NM_000038.5] Beta-catenin [Z19054.1] ACTBa [NM_001101.3] GAPDHa [NM_002046.4] 18S rRNAa [HQ387008.1]
F- TTTCACCGAAGATGCTCCCC R- CACTGCCCTCAGGCTCATAC F- GAGATCCCTTTCCCAGAGTGC R- TTTGTGAAGGGCTTCTCGGC F- CGAATGGGGAACAGTCGAGG R- TCGGAAATGCGACGGGAAAC F- AGCAAGTTGAGGCACTGAAGA R- TCCCGGCTTCCATAAGAACG F- GCCGGCTATTGTAGAAGCTG R- GAGTCCCAAGGAGACCTTCC F- AGAGCTACGAGCTGCCTGAC R- AGCACTGTGTTGGCGTACAG F- GGATTTGGTCGTATTGGGC R- TGGAAGATGGTGATGGGATT F- GTAACCCGTTGAACCCCATT R- CCATCCAATCGGTAGTAGCG
ACTB = beta-actin, APC = adenomatous polyposis coli, CK1 = casein kinase 1, GAPDH = glyceraldehyde-3-phosphate dehydrogenase, GSK3β = glycogen synthase kinase 3β. a Housekeeping gene.
2.11. Cells supernatant preparation
in triplicate using the CFX™ Real-time System (Bio-Rad, Hercules, CA, USA). The housekeeping genes were used (glyceraldehyde-3-phosphate dehydrogenase (GAPDH), β-actin, and 18S rRNA) for normalization.
Initially, HT-29 cells were seeded in a 6-well plate (1 × 105 cells/ well) for 24 h. HT-29 cells were exposed to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. HT-29 cells were centrifuged at 250 × g for 10 min to remove the medium. The cell pellets were lysed in 100 μL of cold lysis buffer followed by 10 min incubation on ice. The supernatants were collected after the cell lysates centrifuged at 10,000 × g and 4 °C for 1 min.
2.13. Statistical analyses The results are demonstrated as mean ± standard deviations (SD) using one-way analysis of variance (ANOVA) and Tukey’s post hoc test by SPSS version 19.0. The differences with p < 0.05 were considered statistically significant.
2.11.1. Determination of malondialdehyde Briefly, hundred μL of the supernatant was mixed with 400 μL of PBS, 250 μL trichloroacetic acid (TCA), and 12.5 μL of butylated hydroxytoluene (8.8 mg/mL). The reaction mixture was incubated at 4 °C for 2 h prior to centrifugation at 2000 × g for 15 min. The supernatant was boiled with 125 μL of thiobarbituric acid (1%) and 37.5 μL of 0.1 mol/L ethylenediaminetetraacetic acid for 15 min. The pink-colored product was observed after cooling at room temperature. The absorbance was read at 532 and 600 nm using an ELISA microplate reader (Tecan, Switzerland). The malondialdehyde (MDA) level was measured using a standard curve of tetramethoxypropane and expressed as nmol MDA/g of protein [18].
3. Results and discussion 3.1. Manilkara zapota leaf water extract induces cytotoxicity and inhibits the viability of HT-29 cells To explore the antiproliferative effect of Manilkara zapota leaf water extract on cancer cells, HeLa, HepG2, PC-3, HT-29, HGT-1, HCT-116, and BALB/c 3T3 cell lines were exposed to 1.56–200 μg/mL Manilkara zapota leaf water extract for 24, 48, and 72 h, and the effect on cell viability was assessed using MTT assay. Our results from MTT assay revealed that Manilkara zapota leaf water extract was cytotoxic to all cancer cells studied after 72 h incubation. As illustrated in Table 2, Manilkara zapota leaf water extract suppressed the viability of HT-29 cell line after 24, 48, and 72 h, with IC50 values 121.20 ± 15.29, 72.91 ± 8.04, and 42.48 ± 7.40 μg/mL, respectively. HT-29 cells were relatively more sensitive to Manilkara zapota leaf water extract than other cancer cell lines studied. Consistent with the cytotoxic effect found in HT-29 cells, Manilkara zapota leaf water extract also reduces the cell viability of HCT-116 in a time-dependent pattern after 24 h (161.68 ± 5.34 μg/mL), 48 h (99.42 ± 7.11 μg/mL), and 72 h (92.15 ± 7.89 μg/mL). A similar trend was also observed in HeLa and HGT-1 cells. After treatment with Manilkara zapota leaf water extract for 72 h, HeLa (48.72 ± 3.53 μg/mL), HGT-1 (47.57 ± 5.12 μg/mL), HepG2 (49.03 ± 5.98 μg/mL) cells were inhibited. Interestingly, we found that water extract of Manilkara zapota leaf promotes the viability of PC-3 cells after 24, 48, and 72 h (Fig. 1A). Hence, we believed that PC-3 cells were more resistant to the Manilkara zapota leaf water extract compared to other cancer cell lines studied. Nevertheless, increase proliferation of PC-3 cells by water extract of Manilkara zapota leaf in the current study remains to be elucidated. As a positive control, HT-29
2.11.2. Determination of catalase Catalase activity was determined following the method of Claiborne [19]. An aliquot of 1.9 mL (0.05 M, pH 7.0) of phosphate buffer was added into 0.1 mL of supernatant and 1 mL of hydrogen peroxide (0.019 M). The absorbance was read at the wavelength of 240 nm using a UV–vis spectrophotometer. The catalase activity was expressed as nmol H2O2 consumed min−1 mg−1 protein. 2.12. Gene expression Briefly, the cells were treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h. The total RNA was isolated using TRI Reagent®, following the recommended instruction. A 2-g of RNA per 20 μL was reverse-transcribed by High-Capacity RNA-to-cDNA Kit, following the recommended instruction, using Authorized Thermal Cycler (Eppendorf, NY, USA). Quantitative real-time polymerase chain reaction (PCR) was conducted by SYBR® Select Master Mix (CFX) using the designed primer sets (Table 1) originating from human cell lines with optimum annealing temperature evaluated from annealing temperature gradient analysis. All the controls and samples were assessed 750
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Table 2 Treatment of Manilkara zapota leaf water extract (1.56–200 μg/mL) on selected cancer cell lines for 24, 48, and 72 h evaluated by MTT and LDH assays. Cancer cell lines
MTT (μg/mL)
LDH (μg/mL)
24 h HT-29 HCT-116 HeLa HGT-1 HepG2
121.20 161.68 172.28 157.26 115.57
48 h ± ± ± ± ±
15.29 5.34a 5.23a 9.76a 4.96a
a
72 h b
72.91 ± 8.04 99.42 ± 7.11b 129.35 ± 6.21b 99.35 ± 10.11b 167.92 ± 9.92a
24 h
42.48 92.15 48.72 47.57 49.03
± ± ± ± ±
c
7.40 7.89b 3.53c 5.12c 5.98b
115.64 184.33 203.44 110.15 102.17
48 h ± ± ± ± ±
a
12.23 4.22a 13.22a 10.23ab 6.35a
72 h a
116.93 ± 6.78 101.59 ± 9.52b 100.54 ± 9.67b 127.52 ± 8.65a 76.52 ± 3.94a
46.98 88.37 63.46 91.92 48.97
± ± ± ± ±
1.23b 8.23b 6.93c 6.54b 7.94b
HCT-116 = human colon carcinoma, HeLa = human cervical cancer, HepG2 = human hepatocellular carcinoma, HGT-1 = human gastric adenocarcinoma, HT-29 = human colorectal adenocarcinoma, LDH = lactate dehydrogenase, MTT = 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide. Values are reported as mean ± SD (n = 3). Value with different superscript letter in the same row for their respective assay indicates significant difference by one−way analysis of variance (ANOVA) (p < 0.05).
water extract is selectively inhibited the cancer cell lines without affecting BALB/c 3T3 cells as measured using both MTT and LDH assays (Figs. 1C and ID). Taken together, our data suggest that Manilkara zapota leaf water extract can induce cytotoxicity in different cancer cell lines, particularly in HT-29 cells. Thus, the HT-29 cells were selected for further analyses. Given the broad cytotoxicity range of Manilkara zapota leaf water extract against HT-29 cells as evaluated using both LDH and MTT assays, only these three concentrations (21, 42, and 84 μg/mL) were selected for further analyses.
cells were incubated with the commercial drug, 5-Fluorouracil (5-FU). After treatment with 5-FU for 24, 48, and 72 h, the viability of HT-29 cells was inhibited, with IC50 values 10.94 ± 3.24, 9.38 ± 1.26, and 1.40 ± 0.65 μg/mL [20], respectively. This finding indicates that 5-FU was capable to suppress the viability of HT-29 cells better compared to Manilkara zapota leaf water extract. In order to verify the cytotoxicity activity of Manilkara zapota leaf water extract, the viability of all cancer cells studied was measured using the LDH assay. Consistent with MTT results, LDH analyses demonstrated that the cell viability of HCT-116 and HT-29 cells was inhibited after treatment with Manilkara zapota leaf water extract (Table 2). Compared to other cancer cell lines studied, HT-29 cells are the most sensitive towards Manilkara zapota leaf water extract with an IC50 value 46.98 ± 1.23 μg/mL after 72 h incubation. Conversely, HeLa, HGT-1, and HepG2 cells were less sensitive compared to HT-29 cells (Table 2). Consistent with the cytotoxic effect observed in MTT results, our LDH analysis further demonstrated that Manilkara zapota leaf water extract induces proliferation of PC-3 cells after 24, 48, and 72 h (Fig. 1B). Notably, our data showed that Manilkara zapota leaf
3.2. Manilkara zapota leaf water extract triggers morphological changes in HT-29 cells To explore the cell morphology of HT-29 treated with Manilkara zapota leaf water extract, the cells were exposed to 21, 42, and 84 μg/ mL of Manilkara zapota leaf water extract. As shown in Fig. 2, increasing concentrations of Manilkara zapota leaf water extract from 21 to 84 μg/ mL for 24, 48, and 72 h trigger cell morphological changes and a decrease in the number of cells. The proliferation of cells treated with
Fig. 1. Treatment of Manilkara zapota leaf water extract on cancer and normal cells. (A) Manilkara zapota leaf water extract increases the proliferation of human prostate cancer (PC-3) cells after 24, 48, and 72 h. The cell viability was evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. (B) Manilkara zapota leaf water extract promotes the proliferation of PC-3 cells after 24, 48, and 72 h evaluated by lactate dehydrogenase (LDH) assay. (C) Treatment of Manilkara zapota leaf water extract in mouse fibroblast (BALB/c 3T3) cell lines evaluated using MTT assay. (D) Cell viability of BALB/c 3T3 cell lines after treatment with Manilkara zapota leaf water extract was evaluated using LDH assay. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05). 751
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Fig. 2. Morphological changes of HT-29 cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract. Reduction of the cell population was observed with increasing concentration of the treatment compared to the control, viewed under an inverted light microscope (Magnification 200 ×).
Fig. 3. Close-up view of morphological changes in HT-29 cells after treatment with Manilkara zapota leaf water extract. Untreated HT-29 cells (control), HT-29 cells treated with Manilkara zapota leaf water extract at concentrations of 21, 42, and 84 μg/mL for 24, 48, and 72 h viewed under an inverted light microscope. The cells showed apoptosis characteristics such as cellular shrinkage (CS), apoptotic bodies (AB), nuclear fragmentation (NF), and membrane blebbing (MB) (Magnification 400 ×).
84 μg/mL of Manilkara zapota leaf water extract for 24 and 48 h was inhibited and this phenomenon became obvious at 72 h (Fig. 2). In addition, we also observed that the cells exposed to Manilkara zapota leaf water extract exhibited some characteristics of apoptosis for instance nuclear fragmentation (NF), cellular shrinkage (CS), apoptotic bodies (AB), and membrane blebbing (MB) (Fig. 3).
3.3. Mode of cell death in HT-29 cells exposed to Manilkara zapota leaf water extract The morphological changes in HT-29 cells exposed to Manilkara zapota leaf water extract were further evaluated using AO and PI double staining after exposure to 21, 42, and 84 μg/mL water extract of Manilkara zapota leaf for 24, 48, and 72 h. As shown in Fig. 4, prominent changes were noted in HT-29 cells treated with 42 and 84 μg/mL 752
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Fig. 4. Morphological characterizations of cells undergo apoptotic cell death using acridine orange and propidium iodide staining. Untreated human colorectal cancer (HT-29) cells and HT-29 cells induced with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24, 48, and 72 h. Untreated HT-29 cells showed normal structure (viable cells (VC)). Treated cells showed the typical characteristics of apoptosis, such as nuclear margination (NM), nuclear fragmentation (NF), chromatin condensation (CC), secondary necrotic (SN) cell, apoptotic bodies (AB), and late apoptotic (LA) cell (Magnification 200 × and 400 ×).
compared to the control (Figs. 5C and D). The total apoptotic cells in HT-29 cells exposed to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 48 and 72 h were significantly elevated (p < 0.05) compared to the untreated cells, with the highest effect at a dosage of 42 and 84 μg/mL for 48 and 72 h, respectively. Overall, our findings suggest that Manilkara zapota leaf water extract induces translocation of phosphatidylserine from inner to the outer leaflet of the cell membrane, indicate a hallmark of apoptosis. Apoptosis is vitally important for colon cancer therapy [21]. Data shown in the present study implied that the induction of apoptotic cells by Manilkara zapota leaf water extract could be of greater significance in identifying the anticancer effect of this extract in colon cancer. Accordingly, these findings provide evidence that Manilkara zapota leaf water extract triggers apoptotic cell death in HT-29 cells.
water extract of Manilkara zapota leaf for 72 h. Treatment with 42 and 84 μg/mL of Manilkara zapota leaf water extract for 72 h led to the prominent changes of cells such as nuclear fragmentation (NF) and chromatin condensation (CC) indicate that Manilkara zapota leaf water extract triggered apoptosis in HT-29 cells. The apoptotic cells were seen as fluorescent bright-green color (Fig. 4). Conversely, untreated HT-29 cells showed a round morphology with similar sizes, appeared healthy, and displayed an intact nucleus (green color) (Fig. 4). Other than apoptotic cells, secondary necrotic (SN) cells were also noted and can be seen in red color after treatment with 42 and 84 μg/mL Manilkara zapota leaf water extract for 48 and 72 h (Fig. 4). 3.4. Manilkara zapota leaf water extract induces apoptosis in HT-29 cells To examine if the cytotoxic activity of Manilkara zapota leaf water extract was due to the induction of apoptosis, the cells were exposed to 21, 42, and 84 μg/mL water extract of Manilkara zapota leaf for 24, 48, and 72 h and analyzed by Annexin V-FITC/PI double staining (Fig. 5A). Treatment with 42 μg/mL of Manilkara zapota leaf water extract significantly triggered (p < 0.05) the percentage of early apoptotic HT-29 cells compared to the control (Fig. 5B). Additionally, the percentage of late apoptotic HT-29 cells were significantly increased compared to the control after exposure to 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 24 h (p < 0.05) (Fig. 5B). Collectively, incubation with Manilkara zapota leaf water extract for 24 h significantly increased the total apoptotic cells (p < 0.05), with the highest effect at a dosage of 42 μg/mL. As shown in Fig. 5B, the percentage of total apoptotic cells was more prominent than necrotic cells in HT-29 cells exposed to Manilkara zapota leaf water extract (< 2%). In addition to the effects mentioned above, a similar trend was also observed after treatment with Manilkara zapota leaf water extract for 48 h and 72 h (Figs. 5C and D). Treatment with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 48 and 72 h led to a significant increase (p < 0.05) in the percentage of early and late apoptotic cells
3.5. Manilkara zapota leaf water extract promotes caspase-3 and -8 activities in HT-29 cells To assess the mechanisms of action underlying apoptosis induction in HT-29 cells exposed to Manilkara zapota leaf water extract, we determined the effect of Manilkara zapota leaf water extract on caspase-3 and -8 activities. Elevation of caspases is a crucial molecular target in chemoprevention [22]. As illustrated in Fig. 6, incubation with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h triggered both caspase-3 and -8 activities in a concentration-dependent pattern. However, no significant differences (p < 0.05) in caspase-3 activity after 24 and 48 h incubation with Manilkara zapota leaf water extract. Consistent with the caspase-8 activity observed in 72 h, a significant elevation in the caspase-8 activity was also noted in HT-29 cells treated with 42 and 84 μg/mL of Manilkara zapota leaf water extract for 24 and 48 h compared to the control (p < 0.05). Our findings in this study showed that Manilkara zapota leaf water extract suppresses the viability of colon cancer, leading to programmed cell death via modulation of the caspase-dependent pathway. 753
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Fig. 5. Apoptotic cell death of HT-29 cells (A) after treatment with Manilkara zapota leaf water extract. After 24 h (B), 48 h (C), and 72 h (D) exposure to Manilkara zapota leaf water extract, apoptotic cells were measured using the Annexin V−FITC and propidium iodide staining assay. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates a significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05).
vitro mode of action found in HT-29 cells could be modulated by the antioxidant levels, we investigated the antioxidant effect of these treatments.
To further verify the involvement of caspase stimulation in the apoptotic effect, we measured whether the pan-caspase inhibitor Z-VAD FMK inhibited the apoptosis. When the HT-29 cells were incubated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract cotreated with 20 μM Z-VAD-FMK inhibitor for 48 h, we found that the apoptotic response was reversed, significantly (p < 0.05) (Fig. 7). Similarly, HT29 cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract cotreated with 20 μM Z-VAD-FMK inhibitor for 72 h was also significantly inhibited (p < 0.05) (Fig. 7) compared to Manilkara zapota leaf water extract alone. These results suggest the involvement of caspase-dependent pathways in Manilkara zapota leaf water extractinduced apoptotic cell death in HT-29 cells. To confirm whether the in
3.6. Manilkara zapota leaf water extract decreases malondialdehyde (MDA) and elevates catalase levels in HT-29 cells Mounting evidence showed the positive association between cytotoxicity and antioxidant activities of plant-derived compounds against cancer cells such as resveratrol, quercetin, protocatechuic acid, and gallic acid [23,24]. In the current study, the cytotoxic activity of Manilkara zapota leaf water extract may be linked to the antioxidant 754
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
protein), 42 μg/mL (1.01 ± 0.01 nmol/g of protein), and 84 μg/mL (1.28 ± 0.10 nmol/g of protein) of Manilkara zapota leaf water extract compared to the control (3.64 ± 0.87 nmol/g of protein) (p < 0.05). This result indicates that Manilkara zapota leaf water extract reduces MDA level, with the highest effect noted at a dosage of 42 μg/mL Manilkara zapota leaf water extract (1.01 ± 0.01 nmol/g of protein). In parallel with the highest level of MDA demonstrated in the control group, we also found that the highest MDA levels in 48 h (3.85 ± 0.11 nmol/g of protein) and 72 h (5.19 ± 0.27 nmol/g of protein) compared to other treatment groups (Table 3). However, the MDA levels were decreased after 48 and 72 h incubation with Manilkara zapota leaf water extract. The suppressive effect of Manilkara zapota leaf water extract on MDA level was notable in HT-29 cells exposed to 84 μg/mL of Manilkara zapota leaf water extract (0.87 ± 0.02 nmol/g of protein) at 72 h. Collectively, these data suggest that the reduction of MDA levels observed in the groups treated with Manilkara zapota leaf water extract could be due to the total phenolic content, antioxidant activity, and phytochemical compounds present in the extract. Overall, the findings demonstrated in the present study suggest that Manilkara zapota leaf water extract has the potential to reduce the MDA activity. In addition to the changes observed in the MDA level, we also found that the catalase level in the two treatment groups [21 μg/mL (8.83 ± 0.01 nmol H2O2 consumed min−1 mg−1 protein) and 42 μg/ mL (9.39 ± 0.04 nmol H2O2 consumed min−1 mg−1 protein)] were significantly elevated (p < 0.05) after 24 h incubation compared to the control (6.80 ± 0.66 nmol H2O2 consumed min−1 mg−1 protein) (Table 3). A similar trend was also observed after 48 and 72 h incubation with Manilkara zapota leaf water extract, with the maximum effect obtained at 42 μg/mL (9.35 ± 0.04 nmol H2O2 consumed min−1 mg−1 protein) and 84 μg/mL (9.32 ± 0.01 nmol H2O2 consumed min−1 mg−1 protein) at 48 and 72 h, respectively. These data imply that the cells exposed to Manilkara zapota leaf water extract exhibited an increase in catalase activity is associated with an elevation of antioxidative capacity. Numerous studies have found that phenolic acid for example caffeic acid and gallic acid has antioxidant activity and strong pharmacological action [26]. A positive correlation between cytotoxicity antioxidant activities of plant constituents against cancer cells was also described by Aïssaoui et al. [27]. Thus, it is suggested that Manilkara zapota leaf water extract might have a protective role against cytotoxicity via antioxidant dependent mechanisms including suppressing oxidative stress-induced apoptosis. All these antioxidative enzymes data are in close agreement with the flavonoid and polyphenolic that contained in the water extract of Manilkara zapota leaf. Further, data in this study showed that the treatment of Manilkara zapota leaf water extract contributes to the elevation of apoptotic cells, indicates that the observed effects were more likely attributed by the bioactive compounds contained in the leaf water extract such as total phenolic content (3.14 ± 0.05 mg GAE/g), total flavonoid content (33.71 ± 8.02 μg QE/100 g), antioxidant activity as determined using β-carotene bleaching test (49.94 ± 10.60%) and 1,1-diphenyl-2-picryl-hydrazyl (DPPH) radical scavenging capacity (0.24 ± 0.02 mg/ mL), saponins, gallic acid (23.11 ± 2.15 μg/g), vanillic acid (5.90 ± 0.71 μg/g), and caffeic acid (3.04 ± 0.12 μg/g) [28]. The
Fig. 6. Caspase-3 and -8 activities in HT-29 cells treated with Manilkara zapota leaf water extract. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05).
Fig. 7. Inhibition of Manilkara zapota leaf water extract-induced apoptosis by the caspase inhibitor Z-VAD-FMK. The HT-29 cells were treated with 20 μM ZVAD-FMK inhibitor alone, Manilkara zapota leaf water extract or cotreated with 20 μM Z-VAD-FMK inhibitor for 24, 48, and 72 h and analyzed for apoptosis by colorimetric assay. Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05).
enzyme. Thus, we explored the effect of Manilkara zapota leaf water extract on malondialdehyde (MDA) and catalase activities in HT-29 cells. Table 3 summarizes the changes in MDA and catalase activities after treatment with Manilkara zapota leaf water extract. Our findings demonstrated that untreated HT-29 cells exhibited the highest levels of MDA, indicates an increased lipid peroxidation (Table 3). The impairment of antioxidant enzymes may contribute to this observed effect, which serves as a safeguard cell during detoxification of reactive oxygen species [25]. Conversely, the MDA level was significantly reduced after 24 h incubation with 21 μg/mL (1.95 ± 0.02 nmol/g of
Table 3 Malondialdehyde and catalase levels in human colorectal cancer (HT-29) cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract. Groups
24 h Control 21 μg/mL 42 μg/mL 84 μg/mL
Catalase (nmol H2O2 consumed min−1 mg−1 protein)
Malondialdehyde (nmol/g of protein)
3.64 1.95 1.01 1.28
48 h ± ± ± ±
0.87a 0.02b 0.01b 0.10b
3.85 3.30 1.22 1.22
72 h ± ± ± ±
0.11a 0.27b 0.09c 0.26c
5.19 2.60 1.06 0.87
24 h ± ± ± ±
0.27a 0.14b 0.02c 0.02c
6.80 8.83 9.39 7.25
48 h ± ± ± ±
0.66a 0.01b 0.04b 0.005a
6.35 8.86 9.35 7.18
72 h ± ± ± ±
0.06a 0.03b 0.04c 0.09d
6.93 6.99 8.92 9.32
± ± ± ±
0.04a 0.04a 0.02b 0.01c
Values are reported as mean ± SD (n = 3). Value with different superscript letter in the same column indicates significant difference by one−way analysis of variance (ANOVA) (p < 0.05). 755
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
of β-catenin in a Wnt pathway. Because Manilkara zapota leaf water extract elevates the CK1 and AXIN1 mRNA expression, the susceptibility of HT-29 cells to Manilkara zapota leaf water extract may also be due to GSK3β. Thus, the effect of GSK3β mRNA level in Manilkara zapota leaf water extract-treated HT-29 cells was evaluated. GSK3β regulates several signaling pathways and substrates, the mechanistic action underlying its tumor promoter or suppressor activities are complex [34]. One of the crucial roles of GSK3β on tumor inhibition is more likely through the regulation of Wnt/β-catenin signaling pathway. Active GSK3β triggers the degradation of β-catenin through phosphorylation of ubiquitin-mediated proteasomal, thereby the β-catenin amount in the cytoplasm remains low. Quantitative realtime PCR analyses revealed that the transcriptional activity of GSK3β was predominantly found in the HT-29 cell-treated with 42 and 84 μg/ mL of Manilkara zapota leaf water extract (Fig. 8). This result implies that high GSK3β amounts may contribute to the inhibition of colorectal cancer cells. Our data in the present study was further supported by Tan et al. [8], who observed that the upregulation of GSK3β mRNA level decreases colorectal cancer cell proliferation and suppresses the tumors formation in azoxymethane-treated colon carcinogenesis in rats. Because we found the elevation of AXIN1, CK1, and GSK3β mRNA levels, we further determined the transcriptional activity of APC in Manilkara zapota leaf water extract-treated HT-29 cells. APC is a large protein interacts with β-catenin and AXIN1. It plays a crucial role as a destruction complex in colorectal cancer [35]. As illustrated in Fig. 8, untreated HT-29 cells demonstrated the lowest APC mRNA expression compared to other treatment groups. Almost 70% of colorectal cancer cases are caused by the APC gene mutations and thus are considered as an initiating event due to an inability of the destruction complex to trigger the phosphorylation of β-catenin [36]. Our results showed that treatment with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h significantly upregulated (p < 0.05) the transcriptional activity of APC in HT-29 cells compared to the control (Fig. 8). Taken together, our data suggested that Manilkara zapota leaf water extract inhibits cell viability of HT-29 and induces apoptosis via the modulation of destruction complex in the Wnt signaling pathway.
previous study has reported that plant exerts a high amount of phenolic content exhibited a good antioxidant activity [29]. Accordingly, the synergistic/additive effects of phenolic, flavonoid, and antioxidant activity may contribute to the apoptotic effects observed in this study. Taken together, our findings demonstrated in this study suggest that Manilkara zapota leaf water extract may confer a protective role against colorectal cancer.
3.7. Manilkara zapota leaf water extract upregulates mRNA levels of AXIN1, CK1, GSK3β, and APC in HT-29 cells To evaluate whether the growth inhibitory effects of Manilkara zapota leaf water extract in HT-29 cells are caused by the biological action of Manilkara zapota leaf water extract, the transcriptional activity of upstream-associated genes in the Wnt pathway was evaluated by quantitative real-time PCR. Wnt/β-catenin signaling activity usually depends on the amount of cytoplasmic β-catenin, where the β-catenin is subjected for phosphorylation through destruction complex comprising of APC, GSK3β, AXIN1, and CK1 [30]. Therefore, the transcriptional activity of CK1, AXIN1, APC, and GSK3β in response to Manilkara zapota leaf water extract was assessed using quantitative real-time PCR. It has been reported that the β-catenin can be stabilized via suppression of destruction complex in Wnt pathway [31]. Overexpression of AXIN1 triggers the degradation of β-catenin in cells express truncated APC [32]. Thus, AXIN1 transcriptional activity needs to be mediated to ensure proper regulation of the Wnt pathway. Our current study demonstrated that treatment with 42 and 84 μg/mL of Manilkara zapota leaf water extract significantly upregulated (p < 0.05) the AXIN1 mRNA level compared to the control (Fig. 8). Hence, the transcriptional activity of AXIN1 may play a crucial role in negatively modulating the Wnt activity to trigger the degradation and phosphorylation of β-catenin. The phosphorylation of β-catenin not only mediated by AXIN1 but also modulated by CK1. Beta-catenin is subjected for phosphorylation through the ubiquitin-mediated proteolysis via the regulation of CK1 [33]. As illustrated in Fig. 8, the transcriptional activity of CK1 in HT29 cells treated with 21, 42, and 84 μg/mL of Manilkara zapota leaf water extract for 72 h was significantly upregulated compared to the control (p < 0.05). Treatment with Manilkara zapota leaf water extract at 21, 42, and 84 μg/mL increased the transcriptional activity of CK1 in a concentration-dependent manner, and this elevation may be linked to the induction of apoptosis, and subsequently resulting the degradation
3.8. Manilkara zapota leaf water extract downregulates mRNA expression of beta-catenin in HT-29 cells The Wnt/β-catenin signaling plays a critical role in cancer susceptibility and tissue homeostasis. Inappropriate activation of β-catenin causes tumor formation, triggers nuclear localization of β-catenin, and stimulates Wnt target genes [37,38]. The transcriptional activity of βcatenin was downregulated in a dose-dependent pattern when the concentration of Manilkara zapota leaf water extract was increased, indicating that Manilkara zapota leaf water extract triggered the phosphorylation of β-catenin in a concentration-dependent pattern (Fig. 8). However, we observed a high β-catenin mRNA expression in untreated HT-29 cells (Fig. 8). Beta-catenin mutated genes are usually observed in colorectal cancer cells or azoxymethane-treated colon cancer in mice and rats [8,39]. Taken together, the results demonstrated in this study suggest that Manilkara zapota leaf water extract may modulate colorectal cancer via Wnt/β-catenin signaling pathway. 4. Conclusions Our study demonstrated that Manilkara zapota leaf water extract induces apoptosis in colorectal cancer cells via regulation of Wnt/βcatenin and caspase-dependent pathways and elevation of antioxidant activity. However, further studies are warranted in the elucidation and isolation of bioactive constituents of this extract that contribute to the cytotoxic activity and apoptosis. Taken together, this finding implies that the potential use of Manilkara zapota leaf water extract against colon carcinogenesis.
Fig. 8. mRNA levels of AXIN1, casein kinase 1 (CK1), glycogen synthase kinase 3β (GSK3β), adenomatous polyposis coli (APC), and β-catenin in HT-29 cells treated with Manilkara zapota leaf water extract for 72 h and evaluated using quantitative real−time polymerase chain reaction (PCR). Values are reported as mean ± SD (n = 3). Value with different superscript letter indicates significant difference between groups by one−way analysis of variance (ANOVA) (p < 0.05). 756
Biomedicine & Pharmacotherapy 110 (2019) 748–757
B.L. Tan, M.E. Norhaizan
Conflict of interest
Oxygen Radical Research, CRC Press, Boca Raton, 1985, pp. 283–284. [20] B.L. Tan, M.E. Norhaizan, L.C. Chan, An intrinsic mitochondrial pathway is required for phytic acid-chitosan-iron oxide nanocomposite (Phy-CS-MNP) to induce G0/G1 cell cycle arrest and apoptosis in the human colorectal cancer (HT-29) cell line, Pharmaceutics 10 (2018) 198, https://doi.org/10.3390/pharmaceutics10040198. [21] K. Yamagata, Y. Izawa, D. Onodera, M. Tagami, Chlorogenic acid regulates apoptosis and stem cell marker-related gene expression in A549 human lung cancer cells, Mol. Cell. Biochem. 441 (2018) 9–19, https://doi.org/10.1007/s11010-0173171-1. [22] I.A. Adedara, B.F. Olabiyi, T.D. Ojuade, U.F. Idris, E.M. Onibiyo, E.O. Farombi, Taurine reverses sodium fluoride-mediated increase in inflammation, caspase-3 activity, and oxidative damage along the brain-pituitary-gonadal axis in male rats, Can. J. Physiol. Pharmacol. 95 (2017) 1019–1029, https://doi.org/10.1139/cjpp2016-0641. [23] A. Rauf, M. Imran, M.S. Butt, M. Nadeem, D.G. Peters, M.S. Mubarak, Resveratrol as an anti-cancer agent: a review, Crit. Rev. Food Sci. Nutr. 58 (2018) 1428–1447, https://doi.org/10.1080/10408398.2016.1263597. [24] Y.S. Tor, L.S. Yazan, J.B. Foo, A. Wibowo, N. Ismail, Y.K. Cheah, R. Abdullah, M. Ismail, I.S. Ismail, S.K. Yeap, Induction of apoptosis in MCF-7 cells via oxidative stress generation, mitochondria-dependent and caspase-independent pathway by ethyl acetate extract of Dillenia suffruticosa and its chemical profile, PLoS One 10 (2015) e0127441, , https://doi.org/10.1371/journal.pone.0127441. [25] K. Singh Chandra, C. Gagan, N.M. Ann, G.-P. Liz Mariely, J. Mack Nicholas, A. Nihal, The role of sirtuins in antioxidant and redox signaling, Antioxid. Redox Signal. 28 (2018) 643–661, https://doi.org/10.1089/ars.2017.7290. [26] L. Crascì, M.R. Lauro, G. Puglisi, A. Panico, Natural antioxidant polyphenols on inflammation management: anti-glycation activity vs metalloproteinases inhibition, Crit. Rev. Food Sci. Nutr. 58 (2018) 893–904, https://doi.org/10.1080/10408398. 2016.1229657. [27] H. Aïssaoui, T. Mencherini, T. Esposito, N. De Tommasi, P. Gazzerro, S. Benayache, F. Benayache, R. Mekkiou, Heliotropium bacciferum Forssk. (Boraginaceae) extracts: chemical constituents, antioxidant activity and cytotoxic effect in human cancer cell lines, Nat. Prod. Res. 12 (2018) 1–6, https://doi.org/10.1080/ 14786419.2018.1437433. [28] B.L. Tan, M.E. Norhaizan, L.C. Chan, Manilkara zapota (L.) P. Royen leaf water extract induces apoptosis in human hepatocellular carcinoma (HepG2) cells via ERK1/2/Akt1/JNK1 signaling pathways, Evid. Complement. Alternat. Med. 2018 (2018) 17, https://doi.org/10.1155/2018/7826576 7826576. [29] O.R. Alara, N.H. Abdurahman, S.K.A. Mudalip, O.A. Olalere, Characterization and effect of extraction solvents on the yield and total phenolic content from Vernonia amygdalina leaves, J. Food Meas. Charact. 12 (2018) 311–316, https://doi.org/10. 1007/s11694-017-9642-y. [30] F. Takahashi-Yanaga, M. Kahn, Targeting Wnt signalling: can we safely eradicate cancer stem cells? Clin. Cancer Res. 16 (2010) 3153–3162, https://doi.org/10. 1158/1078-0432.CCR-09-2943. [31] C.S. Cselenyi, K.K. Jernigan, E. Tahinci, C.A. Thorne, L.A. Lee, E. Lee, LRP6 tranduces a canonical Wnt signal independently of Axin degradation by inhibiting GSK3’s phosphorylation of β-catenin, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) 8032–8037, https://doi.org/10.1073/pnas.0803025105. [32] M. Kishida, S. Koyama, S. Kishida, K. Matsubara, S. Nakashima, K. Higano, R. Takada, S. Takada, A. Kikuchi, Axin prevents Wnt-3a-induced accumulation of βcatenin, Oncogene 18 (1999) 979–985, https://doi.org/10.1038/sj.onc.1202388. [33] J. Deitrick, W.M. Pruitt, Wnt/β-catenin-mediated signaling commonly altered in colorectal cancer, Prog. Mol. Biol. Transl. Sci. 144 (2016) 49–68, https://doi.org/ 10.1016/bs.pmbts.2016.09.010. [34] S. Shang, F. Hua, Z.-W. Hu, The regulation of β-catenin activity and function in cancer: therapeutic opportunities, Oncotarget 8 (2017) 33972–33989, https://doi. org/10.18632/oncotarget.15687. [35] L. Zhang, J.W. Shay, Multiple roles of APC and its therapeutic implications in colorectal cancer, J. Natl. Cancer Inst. 109 (2017) djw332, , https://doi.org/10. 1093/jnci/djw332. [36] S.G. Pai, B.A. Carneiro, J.M. Mota, R. Costa, C.A. Leite, R. Barroso-Sousa, J.B. Kaplan, Y.K. Chae, F.J. Giles, Wnt/beta-catenin pathway: modulating anticancer immune response, J. Hematol. Oncol. 10 (2017) 101, https://doi.org/10. 1186/s13045-017-0471-6. [37] S. Liang, S. Zhang, P. Wang, C. Yang, C. Shang, J. Yang, J. Wang, LncRNA, TUG1 regulates the oral squamous cell carcinoma progression possibly via interacting with Wnt/β-catenin signaling, Gene 608 (2017) 49–57, https://doi.org/10.1016/j. gene.2017.01.024. [38] B.L. Tan, N.M. Esa, H.S. Rahman, H. Hamzah, R. Karim, Brewers’ rice induces apoptosis in azoxymethane-induced colon carcinogenesis in rats via suppression of cell proliferation and the Wnt signaling pathway, BMC Complement, Altern. Med. 14 (2014) 304, https://doi.org/10.1186/1472-6882-14-304. [39] K. Lee, A.S. Lindsey, N. Li, B. Gary, J. Andrews, A.B. Keeton, G.A. Piazza, β-catenin nuclear translocation in colorectal cancer cells is suppressed by PDE10A inhibition, cGMP elevation, and activation of PKG, Oncotarget 7 (2016) 5353–5365, https:// doi.org/10.18632/oncotarget.6705.
The authors declare that they have no competing interests. Funding This work was funded by the Ministry of Science, Technology, and Innovation (MOSTI), Malaysia (project no. 02-01-04-SF2141). Acknowledgements The authors would like to thank all the laboratory staffs from the Department of Nutrition and Dietetics who contributed to this study. References [1] World Health Organization, Cancer, (2017) . (Accessed 3 April 2018) http://www. who.int/mediacentre/factsheets/fs297/en/. [2] Malaysian National Cancer Registry Report, Press Statement Director General of Health Malaysia, (2016) . (Accessed 26 February 2017) www.moh.gov.my/index. php/database_stores/attach_download/337/833. [3] M.D. Thompson, S.P.S. Monga, Wnt/-catenin signaling in liver health and disease, Hepatology 45 (2007) 1298–1305, https://doi.org/10.1002/hep.21651. [4] F. Rahmani, A. Avan, A.S.I. Hashemy, S.M. Hassanian, Role of Wnt/β-catenin signaling regulatory microRNAs in the pathogenesis of colorectal cancer, J. Cell. Physiol. 233 (2018) 811–817, https://doi.org/10.1002/jcp.25897. [5] S. Shang, F. Hua, Z.-W. Hu, The regulation of β-catenin activity and function in cancer: therapeutic opportunities, Oncotarget 8 (2017) 33972–33989, https://doi. org/10.18632/oncotarget.15687. [6] V.V. Sathibabu Uddandrao, P. Brahmanaidu, P.R. Nivedha, S. Vadivukkarasi, G. Saravanan, Beneficial role of some natural products to attenuate the diabetic cardiomyopathy through Nrf2 pathway in cell culture and animal models, Cardiovasc. Toxicol. 18 (2018) 199–205, https://doi.org/10.1007/s12012-0179430-2. [7] B.L. Tan, M.E. Norhaizan, L.C. Chan, ROS-mediated mitochondrial pathway is required for Manilkara zapota (L.) P. Royen leaf methanol extract inducing apoptosis in the modulation of caspase activation and EGFR/NF-κB activities of HeLa human cervical cancer cells, Evid. Complement. Alternat. Med. 2018 (2018) 19, https:// doi.org/10.1155/2018/6578648 6578648. [8] B.L. Tan, M.E. Norhaizan, K. Huynh, S.K. Yeap, H. Hazilawati, K. Roselina, Brewers’ rice modulates oxidative stress in azoxymethane-mediated colon carcinogenesis in rats, World J. Gastroenterol. 21 (2015) 8826–8835, https://doi.org/10.3748/wjg. v21.i29.8826. [9] B.L. Tan, M.E. Norhaizan, W.-P.-P. Liew, Nutrients and oxidative stress: friend or foe? Oxid. Med. Cell. Longev. 2018 (2018) 24, https://doi.org/10.1155/2018/ 9719584 9719584. [10] P. Sathishkumar, F.L. Gu, Q. Zhan, T. Palvannan, A.R. Mohd Yusoff, Flavonoids mediated ‘Green’ nanomaterials: a novel nanomedicine system to treat various diseases–current trends and future perspective, Mater. Lett. 210 (2018) 26–30, https://doi.org/10.1016/j.matlet.2017.08.078. [11] K. Govindaraju, A. Ingels, M.N. Hasan, D. Sun, V. Mathieu, M. Masi, A. Evidente, A. Kornienko, Synthetic analogues of the montanine-type alkaloids with activity against apoptosis-resistant cancer cells, Bioorg. Med. Chem. Lett. 28 (2018) 589–593, https://doi.org/10.1016/j.bmcl.2018.01.041. [12] M.A. Khalek, Z. Khatun, M.R. Habib, M.R. Karim, Antitumor activity of Manilkara zapota (L.) fruits against Ehrlich ascites carcinoma in mice, Biologija 61 (2015) 145–152, https://doi.org/10.6001/biologija.v61i3-4.3206. [13] Q.-L. Song, L.Z. Zhang, G.-S. Li, K. Xiao, Q.-T. Han, S.-J. Dai, Cytotoxic sesquiterpenoid derivatives from the whole plant of Solanum septemlobum, Chem. Nat. Comp. 54 (2018) 69–72, https://doi.org/10.1007/s10600-018-2261-y. [14] A. Ghani, Medicinal Plants of Bangladesh: Chemical Constituents and Uses, Asiatic Society of Bangladesh, Dhaka, 2003. [15] M.Y. Haji Mohiddin, W. Chin, D. Holdsworth, Traditional medicinal plants of Brunei Darussalam part III. Sengkurong, Int. J. Pharmacogn. 30 (1992) 105–108. [16] B.L. Tan, M.E. Norhaizan, H.J. Suhaniza, C.C. Lai, S. Norazalina, K. Roselina, Antioxidant properties and antiproliferative effect of brewers’ rice extract (temukut) on selected cancer cell lines, Int. Food Res. J. 20 (2013) 2117–2124. [17] B.L. Tan, M.E. Norhaizan, S.K. Yeap, K. Roselina, Water extract of brewers’ rice induces antiproliferation of human colorectal cancer (HT-29) cell lines via the induction of apoptosis, Eur. Rev. Med. Pharmacol. Sci. 19 (2015) 1022–1029. [18] M. Suhail, M. Faizul-Suhail, Oxidant-antioxidant status in pair-matched maternal and cord blood of normotensive and preeclamptic patients, Zhongguo Linchuang Yixue Yingxiang Zazhi 4 (2009) 241–248. [19] A. Claiborne, Catalase activity, in: R.A. Green Wald (Ed.), Handbook of Methods for
757