- Email: [email protected]
Mapping and direct visualization of a region-specific viral DNA integration site on chromosome 19q13-qter
CENOMICS
l&831-834
(19%)
SHORT COMMUNICATION Mapping
and Direct Visualization of a Region-Specific Integration Site on Chromosome 19ql3-qter
ROBERT M. KoTIN,**’
JOAN C. MENrwmt,t
Viral DNA
DAVID C. WARD, t AND KENNETH I. BERNS*
*Department of Microbiology, Hearst Microbiology Research Center, Cornell University Medical College, 7300 York Avenue, New York, New York 70027; and tDepartment of Human Genetics, Molecular Biophysics and Biochemistry, Yale University School of Medicine, 333 CedarStreet, New Haven, Connecticut 06570 Received
September
27, 1990;
0 1991 Academic
Press, he.
Integration into the cellular genome is a means by which nuclear DNA viruses establish latent infec-
tions. At the cytogenetic level, there are chromosomal regions that exhibit preferential integration by viral genomes (Romani et aZ., 1990). However, at the molecular level the integration sites appear to be random (Jessberger et al., 1989). The exception thus far is the site specificity of AAV DNA integration (Kotin et al., 1990). The AAV genome has been shown to integrate into a small segment (ca. 8 kb) of chromosome 19 with high frequency in immortal cells. The AAV latently infected cell lines used in this study all displayed the following characteristics: (i) the production of wild-type AAV upon challenge with adenovirus, (ii) the maintenance of stably integrated provirus, and (iii) cell viability. The extent to which any of these three parameters affects choice of integration site is difficult to assess directly. To define the locus on chromosome 19 more precisely, biotinylated probes were utilized for in situ hybridization (Lichter et aZ., 1988, 1990a) to visualize directly the AAV DNA integration site. The results presented here confirm and extend the previously reported findings (Kotin et aE., 1990). In each cell line examined the integration site was mapped specifically to chromosome 19ql3-qter. ’ Current
address:
Lederle
Laboratories,
Pearl
River,
January
11, 1991
The first probe used was the AAV integration site 1 (AAVSl), which had been isolated from a bacteriophage X library of uninfected WI38 cells (Kotin et d, 1990). Hybridization of the AAVSl probe demonstrated that the sequence indeed was derived from chromosome 19q. The analysis was rendered somewhat complex because the probe contained a minisatellite sequence (Fig. 1). As a consequence, from a single individual 48-70% of the spreads had two signal loci (Fig. 2b) while the rest had one signal per chromosome 19 (Fig. 2a). Sequence analysis of AAVSl revealed that a 37-nt element was inexactly repeated 10 times (Fig. 1) within 500 bp of a viral-cellular junction (R.M.K. and K.I.B., unpublished observations) . This repeat, a minisatellite sequence, had been originally found in the third intron of the apolipoprotein (APO) C-II gene (Das et aZ., 1987) and was shown to be unique to the q arm of chromosome 19, occurring at approximately 60 loci. Otherwise, the AAVSl sequence bears no similarity to the Apo C-II exons (R.M.K. and K.I.B., unpublished results). A diffuse signal specific to chromosome 19q was detected when the Apo C-II-derived plasmid, PE670, containing the minisatellite sequence, was used as probe on normal human T-lymphocytes (Fig. 2~); the diffuseness of the signal is consistent with the occurrence of multiple loci as previously reported (Das et al., 1987). When plasmid PE670 was used as a “cold” competitor with the AAVSl probe, only the more telomeric of the two signals was observed (Fig. 2d). This result suggests that the unique AAVSl sequences are localized in the 19ql3-qter region. Probes produced from cloned AAV DNA also were used to visualize the site of viral integration in latently infected KB M19, KB M21 (Laughlin et al., 1986), and Detroit 6 (D6) 7374 (Berns et aZ., 1975) cell lines. A second probe, Sst, specific for chromosomes
A human parvovirus, adeno-associatedvirus (AAV), is unique amongeukaryotic DNA viruses in its ability to integrate site specifically into a defined region of human chromosome19. In this study we usedin situ hybridization to visualize directly the site of AAV DNA integration in latently infected human cell lines and normal human Cdh
revised
NY 10965. 631
0333-7643/91$3.00
Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
832
SHORT
1.
AGTCCAGGCCCAACCCCTCCCCATTCA---ACCCAGG
2.
AGGCCAGGCCCCAGCCCTTCCGCCCTC-AGATGAAGG
3.
AGTCCAGGCCCCCAGCCTCTCCCCATTCAGACCCAGG
4.
GGTCCAGGCCCAGCCCCGCCTCCCTA--AGACCCAGG
5.
AGTCCAGGCCCCCGACCCCTCCTCCCTCAGACCCACG
6.
AGTCCAGGCCCC-AGCCCCTCCTCCCTCGGACCCAGG
7.
AGTCCAGGCCCCCAGTCCCTCCACCCTCAGACCCAGG
8.
AGTCCAGGCCCC-AGCCCCTCCTCCCTCGGACCCAGG
9.
AGTCCAGGCCCC-AGC
COMMUNICATION
FIG. 1. Chromosome IS-specific minisatellite sequence. The 357-nt element has been organized by repeat unit and listed in order of occurrence. These 10 units represent the entire sequence of the minisatellite locus; i.e., there are no intervening sequences between the units. The sequence of the 10 units has been aligned for comparative purposes. A dash (-) indicates that the sequence has been expanded for the purpose of alignment. The sequence was determined by subcloning the original AAVSl into pBluescript vectors (Stratagene). Sequence determination was performed by the dideoxynucleoside triphosphate termination method (12). Overlapping sequences of both strands were determined.
FIG. 2. In situ hybridizations of metaphase chromosomes from karyotypically normal T-lymphocytes (46,xX and 46,XY) (a-d) and latently infected cell lines KB Ml9 (eh) and Detroit 6 7374 (i-l). Normal T-lymphocyte metaphase chromosomes were hybridized to probes produced from: (a and b) AAVSl (the human sequence in which AAV integrates); (c) PE670 (apolipoprotein CII intron sequence containing repeated 37-mer also present in AAVSl); (d) AAVSl plus unlabeled PE670 competitor. (e-h and i-l) Metaphase chromosomes produced from KB Ml9 and Detroit 6 7374 cell lines, respectively, were hybridized to probes produced from AAVSl (e-g and i-k) or AAV viral DNA (b and 1). Metaphase spreads were prepared by colcemid treatment of cultured cells as previously described (8). Probe preparations, suppressive hybridization conditions, and detection of hybridization signals were performed as previously described (69). FIG. 3. Metaphase chromosomes prepared from uninfected Detroit 6 cells (a) or latently infected Detroit 6 cells (cell line 7374) (b). The chromosomes were hybridized to a total chromosome 19 probe set to localize chromosome 19 sequences in rearranged chromosomes. FIG. 4. Hybridization of probe Sst and AAV DNA to latently infected cell lines Detroit 6 7374 (a and b) and KB Ml9 (c). The four signal chromosomes are shown in a; b and c are isolated images of the one doubly labeled chromosome in each of the two cell lines described (showing that the AAV DNA is on a chromosome arm positive for 19 sequence).
SHORT
833
COMMUNICATION
4p and 19q (Epstein et al., 1987) was used, as well, as a chromosome identification marker. In cell line KB M21 the AAV sequence was observed in the q arm of an apparently normal chromosome 19 and the signal appeared to be at the same position as AAVSl, i.e., near the telomere of 19q (data not shown). Both KB Ml9 (Figs. 2e-g) and D6 7374 (Figs. 2i-k) cell lines have the AAV sequence at the site of AAVSl (Figs. 2h and 1, respectively). However, the chromosome 19 morphology was abnormal. To identify the chromosome 19 sequences present in the D6 7374 cell line, the metaphase spreads were hybridized with a composite probe set specific for chromosome 19 (Lichter et al., 1990a) that we generated from a monochromosomal hybrid cell line using polymerase chain reaction with a human Ah repeat sequence primer (Nelson et al., 1989). This chromosome “painting” resulted in four 19-sequence-positive chromosomes: one acrocentric, the q arms of two metacentrics, and the p arm and approximately 25% of the q arm of a submetacentric (Fig. 3a). To determine whether these marker chromosomes preexisted in the cell line prior to the AAV infection, the chromosome 19 probe set was also hybridized to metaphase spreads from uninfected Detroit 6 cells. Since the same four marker chromosomes were seen (Fig. 3b), we conclude that the chromosome 19 rearrangements that we observed are not a consequence of the AAV infection. In the latently infected Detroit 6 cell line, one metacentric and the acrocentric chromosomes did not hybridize to the Sst probe, indicating that the chromosome 19 component of these abnormal chromosomes was probably derived from the p arm of 19. Conversely, the p arm of the submetacentric and the q arm of the metacentric chromosomes were chromosome 19q-derived since the Sst probe did hybridize to these (Fig. 4a). The second signal on the submetacentric chromosome was due to the AAV probe. The submetacentric morphology of this chromosome was the result of an addition to the p arm of chromosome 19. To confirm that the AAV integration site in the translocation chromosomes was in the same position on 19q as in the KB M21 line that had apparently normal chromosome 19 sequences, the Sst and AAV probes were hybridized simultaneously. As seen in Figs. 4b and c, the viral sequences are observed near the 19q arm terminus distal to the Sst probes. The source of the non-chromosome-19 material in these hybrids has not been determined. It appears that there is not a normal chromosome 19 in the D6 7374 cell line; nevertheless, both the AAVSl and AAV probes (Figs. 2i-k and 1, respectively) give signals near the p terminus of the derivative chromosome which contains chromosome 19q sequence. Similar experiments were performed with the KB Ml9 cell line and a derivative chromo-
some 19 was identified. Again, these results indicated that the AAV DNA had integrated into a marker chromosome derived from chromosome 19 and that both AAVSl and AAV probes were localized in the 19ql3-qter region. The process of in situ hybridization has enabled us to visualize directly the AAV integration site in the human genome. The cytogenetic colocalization of proviruses in chromosome 19-derived DNA in three independent, latently infected cell lines demonstrates that this locus is a highly preferred site of AAV DNA integration. These data corroborate and extend the original results of Kotin et al. (1990) that described site-specific integration of AAV DNA into chromosome 19 based on genomic blots of latently infected KB, D6, and HeLa cell lines. What makes this cellular locus special? At the nucleotide level, the viral integration site is proximal to a chromosome 19q-specific minisatellite. This sequence element may be directly involved in the predilection of this region to recombination events (Wahls et al., 1990). Preliminary sequencing results of AAVSl have demonstrated that over a 4-kb region, which includes the sites for AAV integration, the sequence is >60% G+C (R.M.K. and K.I.B., unpublished results). Because nonhomologous recombination is a basic function in both normal and aberrant cellular processes and may be the precipitating event in the etiology of some of these conditions, an understanding of the mechanisms involved would be extremely valuable. The recombination of AAV DNA and cellular DNA appears to be an attractive model for exploring the phenomenon. The unique properties of AAV DNA site-specific integration could be exploited to address questions concerning viral DNA recognition of the target sequence. Basic issues involve determining whether viral gene products are required, what viral sequences are necessary in cis, and what the cellular contributions are both in cis and in trans. ACKNOWLEDGMENTS We of the work 22251
thank A. Beaton, P. Ward, and C. Kotin for careful review manuscript and M. Siniscalco for helpful discussions. The was supported by U.S. Public Health Service Grants AI (K.I.B.) and HG00272 and HG00246 (D.C.W.).
REFERENCES 1.
BERNS, K. I., PINKERTON, T. C., THOMAS, G. F., AND HocGAN, M. D. (1975). Detection of adeno-associated virus (AAV) specific nucleotide sequences in DNA isolated from latently infected Detroit 6 cells. Virology 68: 556-560.
2.
DAS, H. K., JACKSON, C. L., MILLER, D. A., Lm, T., AND BRESLOW, J. L. (1987). The human apolipoprotein CII gene sequence contains a novel chromosome 19-specific minisatellite in its third intron. J. Biol. Chem. 262: 4787-4793.
834 3.
SHORT
COMMUNICATION
EPSTEIN, N. D., KARLSSON, S., O’BRIEN, S., MODI, W., MOULTON, A., AND NIEHUIS, A. W. (1987). A new moderately repetitive DNA sequence family of novel organization. Nucleic Acids Res. 15: 2327-2341.
4.
JESSBERGER, R., HEUSS, D., AND DOERFLER, W. (1989). Recombination in hamster cell nuclear extracts between adenovirus type 12 DNA and two hamster preinsertion sequences. EMBO J. 8: 869-878.
5.
KOTIN, R. M., SINISCALCO, M., SAMULSKI, R. J., ZHU, X., HUNTER, L., LAUGHLIN, C., MCLAUGHLIN, S., MUZYCZKA, N., ROCCHI, M., AND BERNS, K. I. (1990). Site-specific integration of adeno-associated virus. Proc. N&l. Acad. Sci. USA 87: 2211-2215.
6.
LAUGHLIN, C. A., CARDELLICHIO, C. B., AND (1986). Latent infection with adeno-associated J. Viral. 60: 515-524.
7.
LICHTER, WARD, D. Alu and Ll terization Natl. Acad.
8.
COON, H. C. virus type 2.
P., LEDBEITER, S. A., LEDBE?TER, D. H., AND C. (199Oa). Fluorescence in situ hybridization with polymerase chain reaction probes for rapid characof human chromosomes in hybrid cell lines. Proc. Sci. USA 87: 6634-6638.
LICHTER, P., CHANG TANG, C.-J., CALL, K., HERMANSON, EVANS, G. A., HOUSMAN, D., AND WARD, D. C. (1990b).
G., High
resolution bridization
mapping of human chromosome 11 by in situ with cosmid clones. Science 247: 64-69.
hy-
9. LICHTER,
P., CREMER, T., BORDEN, J., MANUELIDIS, L., AND WARD, D. C. (1988). Delineation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum. Genet. 80: 224-234.
10.
11.
NELSON, D. L., LEDBETTER, S. A., Co-o, L., VICTORIA, M. F., RAMIREZ-SOLIS, R., WEBSTER, T. D., LEDBETTER, D. H., AND CASKEY, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686-6690. ROMANI, M., DEAMEIROSIS, A., ALHADEFF, B., PURRELLO, M., GLUZMAN, Y., AND SINISCALCO, M. (1990). Preferential viral integration at the highly recombinogenic chromosomal site lp 36 in human cells transformed with adeno 5-SV40. Gene 95: 231-241.
12.
SANGER, F., NICKLEN, S., AND COULSEN, A. R. (1977). sequencing with chain-terminating inhibitors. Proc. Acad, Sci. USA 74: 5463-5467.
13.
WAHLS, W. P., WALLACE, L. J., AND MOORE, P. D. (1990). Hypervariable minisatellite DNA is a hot spot for homologous recombination in human cells. Cell 60: 95-103.
DNA Natl.
l&831-834
(19%)
SHORT COMMUNICATION Mapping
and Direct Visualization of a Region-Specific Integration Site on Chromosome 19ql3-qter
ROBERT M. KoTIN,**’
JOAN C. MENrwmt,t
Viral DNA
DAVID C. WARD, t AND KENNETH I. BERNS*
*Department of Microbiology, Hearst Microbiology Research Center, Cornell University Medical College, 7300 York Avenue, New York, New York 70027; and tDepartment of Human Genetics, Molecular Biophysics and Biochemistry, Yale University School of Medicine, 333 CedarStreet, New Haven, Connecticut 06570 Received
September
27, 1990;
0 1991 Academic
Press, he.
Integration into the cellular genome is a means by which nuclear DNA viruses establish latent infec-
tions. At the cytogenetic level, there are chromosomal regions that exhibit preferential integration by viral genomes (Romani et aZ., 1990). However, at the molecular level the integration sites appear to be random (Jessberger et al., 1989). The exception thus far is the site specificity of AAV DNA integration (Kotin et al., 1990). The AAV genome has been shown to integrate into a small segment (ca. 8 kb) of chromosome 19 with high frequency in immortal cells. The AAV latently infected cell lines used in this study all displayed the following characteristics: (i) the production of wild-type AAV upon challenge with adenovirus, (ii) the maintenance of stably integrated provirus, and (iii) cell viability. The extent to which any of these three parameters affects choice of integration site is difficult to assess directly. To define the locus on chromosome 19 more precisely, biotinylated probes were utilized for in situ hybridization (Lichter et aZ., 1988, 1990a) to visualize directly the AAV DNA integration site. The results presented here confirm and extend the previously reported findings (Kotin et aE., 1990). In each cell line examined the integration site was mapped specifically to chromosome 19ql3-qter. ’ Current
address:
Lederle
Laboratories,
Pearl
River,
January
11, 1991
The first probe used was the AAV integration site 1 (AAVSl), which had been isolated from a bacteriophage X library of uninfected WI38 cells (Kotin et d, 1990). Hybridization of the AAVSl probe demonstrated that the sequence indeed was derived from chromosome 19q. The analysis was rendered somewhat complex because the probe contained a minisatellite sequence (Fig. 1). As a consequence, from a single individual 48-70% of the spreads had two signal loci (Fig. 2b) while the rest had one signal per chromosome 19 (Fig. 2a). Sequence analysis of AAVSl revealed that a 37-nt element was inexactly repeated 10 times (Fig. 1) within 500 bp of a viral-cellular junction (R.M.K. and K.I.B., unpublished observations) . This repeat, a minisatellite sequence, had been originally found in the third intron of the apolipoprotein (APO) C-II gene (Das et aZ., 1987) and was shown to be unique to the q arm of chromosome 19, occurring at approximately 60 loci. Otherwise, the AAVSl sequence bears no similarity to the Apo C-II exons (R.M.K. and K.I.B., unpublished results). A diffuse signal specific to chromosome 19q was detected when the Apo C-II-derived plasmid, PE670, containing the minisatellite sequence, was used as probe on normal human T-lymphocytes (Fig. 2~); the diffuseness of the signal is consistent with the occurrence of multiple loci as previously reported (Das et al., 1987). When plasmid PE670 was used as a “cold” competitor with the AAVSl probe, only the more telomeric of the two signals was observed (Fig. 2d). This result suggests that the unique AAVSl sequences are localized in the 19ql3-qter region. Probes produced from cloned AAV DNA also were used to visualize the site of viral integration in latently infected KB M19, KB M21 (Laughlin et al., 1986), and Detroit 6 (D6) 7374 (Berns et aZ., 1975) cell lines. A second probe, Sst, specific for chromosomes
A human parvovirus, adeno-associatedvirus (AAV), is unique amongeukaryotic DNA viruses in its ability to integrate site specifically into a defined region of human chromosome19. In this study we usedin situ hybridization to visualize directly the site of AAV DNA integration in latently infected human cell lines and normal human Cdh
revised
NY 10965. 631
0333-7643/91$3.00
Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
832
SHORT
1.
AGTCCAGGCCCAACCCCTCCCCATTCA---ACCCAGG
2.
AGGCCAGGCCCCAGCCCTTCCGCCCTC-AGATGAAGG
3.
AGTCCAGGCCCCCAGCCTCTCCCCATTCAGACCCAGG
4.
GGTCCAGGCCCAGCCCCGCCTCCCTA--AGACCCAGG
5.
AGTCCAGGCCCCCGACCCCTCCTCCCTCAGACCCACG
6.
AGTCCAGGCCCC-AGCCCCTCCTCCCTCGGACCCAGG
7.
AGTCCAGGCCCCCAGTCCCTCCACCCTCAGACCCAGG
8.
AGTCCAGGCCCC-AGCCCCTCCTCCCTCGGACCCAGG
9.
AGTCCAGGCCCC-AGC
COMMUNICATION
FIG. 1. Chromosome IS-specific minisatellite sequence. The 357-nt element has been organized by repeat unit and listed in order of occurrence. These 10 units represent the entire sequence of the minisatellite locus; i.e., there are no intervening sequences between the units. The sequence of the 10 units has been aligned for comparative purposes. A dash (-) indicates that the sequence has been expanded for the purpose of alignment. The sequence was determined by subcloning the original AAVSl into pBluescript vectors (Stratagene). Sequence determination was performed by the dideoxynucleoside triphosphate termination method (12). Overlapping sequences of both strands were determined.
FIG. 2. In situ hybridizations of metaphase chromosomes from karyotypically normal T-lymphocytes (46,xX and 46,XY) (a-d) and latently infected cell lines KB Ml9 (eh) and Detroit 6 7374 (i-l). Normal T-lymphocyte metaphase chromosomes were hybridized to probes produced from: (a and b) AAVSl (the human sequence in which AAV integrates); (c) PE670 (apolipoprotein CII intron sequence containing repeated 37-mer also present in AAVSl); (d) AAVSl plus unlabeled PE670 competitor. (e-h and i-l) Metaphase chromosomes produced from KB Ml9 and Detroit 6 7374 cell lines, respectively, were hybridized to probes produced from AAVSl (e-g and i-k) or AAV viral DNA (b and 1). Metaphase spreads were prepared by colcemid treatment of cultured cells as previously described (8). Probe preparations, suppressive hybridization conditions, and detection of hybridization signals were performed as previously described (69). FIG. 3. Metaphase chromosomes prepared from uninfected Detroit 6 cells (a) or latently infected Detroit 6 cells (cell line 7374) (b). The chromosomes were hybridized to a total chromosome 19 probe set to localize chromosome 19 sequences in rearranged chromosomes. FIG. 4. Hybridization of probe Sst and AAV DNA to latently infected cell lines Detroit 6 7374 (a and b) and KB Ml9 (c). The four signal chromosomes are shown in a; b and c are isolated images of the one doubly labeled chromosome in each of the two cell lines described (showing that the AAV DNA is on a chromosome arm positive for 19 sequence).
SHORT
833
COMMUNICATION
4p and 19q (Epstein et al., 1987) was used, as well, as a chromosome identification marker. In cell line KB M21 the AAV sequence was observed in the q arm of an apparently normal chromosome 19 and the signal appeared to be at the same position as AAVSl, i.e., near the telomere of 19q (data not shown). Both KB Ml9 (Figs. 2e-g) and D6 7374 (Figs. 2i-k) cell lines have the AAV sequence at the site of AAVSl (Figs. 2h and 1, respectively). However, the chromosome 19 morphology was abnormal. To identify the chromosome 19 sequences present in the D6 7374 cell line, the metaphase spreads were hybridized with a composite probe set specific for chromosome 19 (Lichter et al., 1990a) that we generated from a monochromosomal hybrid cell line using polymerase chain reaction with a human Ah repeat sequence primer (Nelson et al., 1989). This chromosome “painting” resulted in four 19-sequence-positive chromosomes: one acrocentric, the q arms of two metacentrics, and the p arm and approximately 25% of the q arm of a submetacentric (Fig. 3a). To determine whether these marker chromosomes preexisted in the cell line prior to the AAV infection, the chromosome 19 probe set was also hybridized to metaphase spreads from uninfected Detroit 6 cells. Since the same four marker chromosomes were seen (Fig. 3b), we conclude that the chromosome 19 rearrangements that we observed are not a consequence of the AAV infection. In the latently infected Detroit 6 cell line, one metacentric and the acrocentric chromosomes did not hybridize to the Sst probe, indicating that the chromosome 19 component of these abnormal chromosomes was probably derived from the p arm of 19. Conversely, the p arm of the submetacentric and the q arm of the metacentric chromosomes were chromosome 19q-derived since the Sst probe did hybridize to these (Fig. 4a). The second signal on the submetacentric chromosome was due to the AAV probe. The submetacentric morphology of this chromosome was the result of an addition to the p arm of chromosome 19. To confirm that the AAV integration site in the translocation chromosomes was in the same position on 19q as in the KB M21 line that had apparently normal chromosome 19 sequences, the Sst and AAV probes were hybridized simultaneously. As seen in Figs. 4b and c, the viral sequences are observed near the 19q arm terminus distal to the Sst probes. The source of the non-chromosome-19 material in these hybrids has not been determined. It appears that there is not a normal chromosome 19 in the D6 7374 cell line; nevertheless, both the AAVSl and AAV probes (Figs. 2i-k and 1, respectively) give signals near the p terminus of the derivative chromosome which contains chromosome 19q sequence. Similar experiments were performed with the KB Ml9 cell line and a derivative chromo-
some 19 was identified. Again, these results indicated that the AAV DNA had integrated into a marker chromosome derived from chromosome 19 and that both AAVSl and AAV probes were localized in the 19ql3-qter region. The process of in situ hybridization has enabled us to visualize directly the AAV integration site in the human genome. The cytogenetic colocalization of proviruses in chromosome 19-derived DNA in three independent, latently infected cell lines demonstrates that this locus is a highly preferred site of AAV DNA integration. These data corroborate and extend the original results of Kotin et al. (1990) that described site-specific integration of AAV DNA into chromosome 19 based on genomic blots of latently infected KB, D6, and HeLa cell lines. What makes this cellular locus special? At the nucleotide level, the viral integration site is proximal to a chromosome 19q-specific minisatellite. This sequence element may be directly involved in the predilection of this region to recombination events (Wahls et al., 1990). Preliminary sequencing results of AAVSl have demonstrated that over a 4-kb region, which includes the sites for AAV integration, the sequence is >60% G+C (R.M.K. and K.I.B., unpublished results). Because nonhomologous recombination is a basic function in both normal and aberrant cellular processes and may be the precipitating event in the etiology of some of these conditions, an understanding of the mechanisms involved would be extremely valuable. The recombination of AAV DNA and cellular DNA appears to be an attractive model for exploring the phenomenon. The unique properties of AAV DNA site-specific integration could be exploited to address questions concerning viral DNA recognition of the target sequence. Basic issues involve determining whether viral gene products are required, what viral sequences are necessary in cis, and what the cellular contributions are both in cis and in trans. ACKNOWLEDGMENTS We of the work 22251
thank A. Beaton, P. Ward, and C. Kotin for careful review manuscript and M. Siniscalco for helpful discussions. The was supported by U.S. Public Health Service Grants AI (K.I.B.) and HG00272 and HG00246 (D.C.W.).
REFERENCES 1.
BERNS, K. I., PINKERTON, T. C., THOMAS, G. F., AND HocGAN, M. D. (1975). Detection of adeno-associated virus (AAV) specific nucleotide sequences in DNA isolated from latently infected Detroit 6 cells. Virology 68: 556-560.
2.
DAS, H. K., JACKSON, C. L., MILLER, D. A., Lm, T., AND BRESLOW, J. L. (1987). The human apolipoprotein CII gene sequence contains a novel chromosome 19-specific minisatellite in its third intron. J. Biol. Chem. 262: 4787-4793.
834 3.
SHORT
COMMUNICATION
EPSTEIN, N. D., KARLSSON, S., O’BRIEN, S., MODI, W., MOULTON, A., AND NIEHUIS, A. W. (1987). A new moderately repetitive DNA sequence family of novel organization. Nucleic Acids Res. 15: 2327-2341.
4.
JESSBERGER, R., HEUSS, D., AND DOERFLER, W. (1989). Recombination in hamster cell nuclear extracts between adenovirus type 12 DNA and two hamster preinsertion sequences. EMBO J. 8: 869-878.
5.
KOTIN, R. M., SINISCALCO, M., SAMULSKI, R. J., ZHU, X., HUNTER, L., LAUGHLIN, C., MCLAUGHLIN, S., MUZYCZKA, N., ROCCHI, M., AND BERNS, K. I. (1990). Site-specific integration of adeno-associated virus. Proc. N&l. Acad. Sci. USA 87: 2211-2215.
6.
LAUGHLIN, C. A., CARDELLICHIO, C. B., AND (1986). Latent infection with adeno-associated J. Viral. 60: 515-524.
7.
LICHTER, WARD, D. Alu and Ll terization Natl. Acad.
8.
COON, H. C. virus type 2.
P., LEDBEITER, S. A., LEDBE?TER, D. H., AND C. (199Oa). Fluorescence in situ hybridization with polymerase chain reaction probes for rapid characof human chromosomes in hybrid cell lines. Proc. Sci. USA 87: 6634-6638.
LICHTER, P., CHANG TANG, C.-J., CALL, K., HERMANSON, EVANS, G. A., HOUSMAN, D., AND WARD, D. C. (1990b).
G., High
resolution bridization
mapping of human chromosome 11 by in situ with cosmid clones. Science 247: 64-69.
hy-
9. LICHTER,
P., CREMER, T., BORDEN, J., MANUELIDIS, L., AND WARD, D. C. (1988). Delineation of individual human chromosomes in metaphase and interphase cells by in situ suppression hybridization using recombinant DNA libraries. Hum. Genet. 80: 224-234.
10.
11.
NELSON, D. L., LEDBETTER, S. A., Co-o, L., VICTORIA, M. F., RAMIREZ-SOLIS, R., WEBSTER, T. D., LEDBETTER, D. H., AND CASKEY, C. T. (1989). Alu polymerase chain reaction: A method for rapid isolation of human specific sequences from complex DNA sources. Proc. Natl. Acad. Sci. USA 86: 6686-6690. ROMANI, M., DEAMEIROSIS, A., ALHADEFF, B., PURRELLO, M., GLUZMAN, Y., AND SINISCALCO, M. (1990). Preferential viral integration at the highly recombinogenic chromosomal site lp 36 in human cells transformed with adeno 5-SV40. Gene 95: 231-241.
12.
SANGER, F., NICKLEN, S., AND COULSEN, A. R. (1977). sequencing with chain-terminating inhibitors. Proc. Acad, Sci. USA 74: 5463-5467.
13.
WAHLS, W. P., WALLACE, L. J., AND MOORE, P. D. (1990). Hypervariable minisatellite DNA is a hot spot for homologous recombination in human cells. Cell 60: 95-103.
DNA Natl.