Mapping of the human cone transducin α-subunit (GNAT2) gene to 1p13 and negative mutation analysis in patients with Stargardt disease

SHORT COMMUNICATION Mapping of the Human Cone Transducin a-Subunit (GNAT2) Gene to lp13 and Negative Mutation Analysis in Patients with Stargardt Disease IVANA MAGOVCEVIC,* STANISLAWA WEREMOWICZ,t'=I: CYNTHIA C. MORTON,-I-'=I: SHAO-LING FONG,§ ELIOT L. BERSON,¶ AND THADDEUS P. DRYJAII'1 Departments of *Genetics and t Pathology, Harvard Medical School, ~Department of Pathology, Brigham and Women's Hospital, and the IIHowe Laboratory and the ¶Berman-Gund Laboratory, Harvard Medical School and Massachusetts Eye and Ear Infirmary, Boston, Massachusetts, and §Department of Ophthalmology, Indiana University School of Medicine, Indianapolis, Indiana Received June 2, 1994; revised September 26, 1994

We report l o c a l i z a t i o n of the h u m a n c o n e t r a n s d u c i n (GNAT2) g e n e u s i n g f l u o r e s c e n c e in situ h y b r i d i z a t i o n on c h r o m o s o m e 1 in b a n d p13. The r e c e n t a s s i g n m e n t o f a g e n e for S t a r g a r d t d i s e a s e to t h e s a m e c h r o m o s o m a l r e g i o n by l i n k a g e a n a l y s i s p r o m p t e d us to investigate t h e p o s s i b l e role o f GNAT2 in t h e p a t h o g e n e s i s o f this d i s e a s e . We i n v e s t i g a t e d 66 u n r e l a t e d p a t i e n t s for m u t a t i o n s in t h e c o d i n g r e g i o n o f t h e GNAT2 g e n e u s i n g p o l y m e r a s e c h a i n r e a c t i o n - s i n g l e s t r a n d conform a t i o n p o l y m o r p h i s m a n a l y s i s (SSCP) a n d direct sequencing. No disease-specific mutations were found, i n d i c a t i n g t h a t GNAT2 is p r o b a b l y n o t i n v o l v e d in t h e p a t h o g e n e s i s o f m o s t c a s e s o f S t a r g a r d t d i s e a s e . © 1995 Academic Press, Inc.

Transducin a-subunits are members of a large family of G proteins and play an important role in phototransduction in rod and cone photoreceptors. When the visual pigment of photoreceptors is light activated, it interacts with transducin and stimulates the exchange of bound GDP for GTP. The activated transducin a-subunit, bound to GTP, is released from the ~/-subunits and activates cGMP-phosphodiesterase (cGMP-PDE) by removing inhibitory T-subunits from cGMP-PDE, cGMP-PDE in turn lowers the concentration of cGMP, causing the closure of cGMP-dependent cation channels and hyperpolarization of the photoreceptor (18). Members of the phototransduction cascade have been implicated in the pathogenesis of hereditary photoreceptor degeneration in mammals and insects. For example, mutations of rod opsin (rhodopsin) (2, 4) or the ~-subunit of rod cGMP-PDE (7) cause forms of retinitis pigmentosa in humans and related photoreceptor degeneration in mice (10, 12). It is conceivable that defects in other members of 1 To whom correspondence a n d r e p r i n t requests should be addressed at the D e p a r t m e n t of Ophthalmology, M a s s a c h u s e t t s Eye a n d E a r Infirmary, 243 C h a r l e s Street, Boston, MA 02114. Telephone: (617) 573-3319. Fax: (617) 573-3168. GENOMICS 25, 288--290 (1995) 0888-7543/95 $6.00 Copyright © 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.

the phototransduction pathway are responsible for other forms of photoreceptor degeneration in humans. In this paper we report an investigation of the gene encoding the a-subunit of cone transducin (GNAT2). GNAT2 has been previously localized to chromosome 1 using somatic cell hybrids (1, 16). We confirmed this chromosomal assignment and sublocalized the GNAT2 locus using fluorescence in situ hybridization (FISH) (9). A 16-kb GNAT2 genomic probe (0.5 #g) in the vector EMBL3 (8) was labeled with digoxigenin-11-dUTP (Boehringer Mannheim, Indianapolis, IN) using dNTPs obtained from Boehringer Mannheim and DNase I/DNA polymerase I mix from the BioNick labeling system (GIBCO-BRL, Bethesda, MD). DNA was coprecipitated with 2.5 #g Cot-1 DNA (GIBCOBRL) and resuspended in TE at a probe concentration of 50 #g/ml. Hybridization of the labeled GNAT2 probe (7.5 #g/ml) to metaphase chromosomes prepared from human peripheral blood lymphocytes was performed in Hybrisol VI according to the protocol supplied with the chromosome in situ hybridization kit (Oncor, Gaithersburg, MD) with omission of the RNase treatment. Posthybridization washes included one wash in 2x SSC in 50% formamide at 42°C for 15 min, two washes in 2x SSC at 42°C for 5 min each, and one wash in l x PBD (Oncor) for 5 min at room temperature. The digoxigenin-labeled probe was detected with fluorescein-labeled antidigoxigenin antibody according to the manufacturer's recommendations. Metaphase chromosomes were counterstained with propidium iodide (PI) and 4,6 - diamidino - 2 - phenylindole - dihydrochloride (DAPI) (Oncor). The probe hybridized to lp13 (Fig. 1). This map position was determined by visual inspection of the fluorescent hybridization signal on PI-stained metaphase chromosomes coupled with chromosome identification by DAPI staining. The chromosomal assignment for GNAT2

288

SHORT COMMUNICATION

B A

~]--GNAT2 C

FIG. 1. (A) Idiogram of human chromosome 1 showing the map location of the human GNAT2 gene at lp13. (B) Photograph of human metaphase chromosomes counterstained with DAPI. The two chromosomes 1 are indicated by numbers. (C) Photograph of the same human metaphase chromosomes counterstained with propidium iodide. Arrows point to the sites of hybridization on both sister chromatids in band p13 of both chromosome 1 homologues. Hybridization was observed using a Zeiss Axiophot microscope, and photographs were taken with Kodak Technical Pan film at ASA 200. was s u p p o r t e d by F L p t e r v a l u e s (6) o b t a i n e d from m e a s u r e m e n t s of 10 m e t a p h a s e chr om os omes. K a p l a n et al. (5) r e c e n t l y r e p o r t e d ei ght families w i t h a u t o s o m a l r eces s i ve S t a r g a r d t disease in which t h e disease locus was l i n k e d to m icrosat el lite m a r k e r s in t he i n t e r v a l l p 1 3 - p 2 1 . S t a r g a r d t disease is c h a r a c t e r i z e d by d e g e n e r a t i o n in late childhood or e a r l y a d u l t h o o d of t h e m a c u l a of t h e r e t i n a , a r egi on rich in cones (13, 17). It is one of t h e mo s t f r e q u e n t c a us es of m a c u l a r d e g e n e r a t i o n in children. Th e full-field e l e c t r o r e t i n o g r a m (ERG) shows e i t h e r a n o r m a l r e s p o n s e or a selective a l t e r a t i o n of photopic (cone) r e s pons e s . In all cases t h e r e is an a b n o r m a l foveal cone E R G (14, 15). T he families e x h i b i t i n g l i nkage to l p h a d a b n o r m a l photopic ER Gs (5), s u g g e s t i n g an a b n o r m a l i t y of cones throughout the retina. B e c a u s e GNAT2 plays an i m p o r t a n t role in cone p h o t o t r a n s d u c t i o n and b e c a u s e it m a p s to t h e re-

289

gion i m p l i c a t e d in S t a r g a r d t disease, we decided to s c r e e n p a t i e n t s w i t h S t a r g a r d t disease, w i t h or w i t h o u t p e r i p h e r a l cone i n v o l v e m e n t as m o n i t o r e d by t he full-field ERG, for m u t a t i o n s in this gene. O ur screen i n c l u d e d 66 u n r e l a t e d cases, i n c l u d i n g 22 w i t h p e r i p h e r a l cone involvem e n t . Oligonucleotide p r i m e r pai rs (Table 1) w e re deri ved from i n t r o n DNA s e q u e n c e s flanking exons 1 - 8 ; t h e s e ei ght exons c o n t a i n t he e n t i r e coding region of GNAT2. DNA s e q u e n c e c o n t a i n e d b e t w e e n each set of oligomers i n c l u d e d splice acceptor a n d donor sites. For each exon, 0.1 #g of leukocyte DNA was PCR-amplified in 20 #l to ta l volu m e u n d e r t h e conditions o u t l i n e d in T a b le 1. F o r exons 1, 4, and 7, 10% DMSO was u s e d in th e amplification reaction. F r a g m e n t s l a r g e r t h a n 220 bp were di gest ed w i t h an a p p r o p r i a t e r e s t r i c t i o n endon u c l e a s e (Table 1) a f t e r amplification. Amplified DNA was h e a t - d e n a t u r e d and s i n g l e - s t r a n d e d fragm e n t s were s e p a r a t e d by e l e c t r o p h o r e s i s at room t e m p e r a t u r e t h r o u g h each of two n o n d e n a t u r i n g 6% a c r y l a m i d e gels, one c o n t a i n i n g 10% glycerol (11). S a m p l e s w i t h a b n o r m a l l y m i g r a t i n g f r a g m e n t s were e v a l u a t e d f u r t h e r by di rect l y s e q u e n c i n g th e r e l e v a n t exon usi ng p r e v i o u s l y describ e d techni ques (19). One silent change and one r a r e s e q u e n c e v a ria tion were found. One p a t i e n t (034-16) was heterozygous for a silent change in exon VI, Asp238Asp (GAT to GAC). Two p a t i e n t s , one (071-001) w i t h o u t p e r i p h e r a l cone i n v o l v e m e n t a n d one (035-005) w i t h p e r i p h e r a l cone i n v o l v e m e n t , w e re h e t e r o z y g o u s for t he m i s s e n s e c h a n g e V a l 1 2 4 M e t (GTG to ATG) in exon IV. A s u b s e q u e n t sc re e n of 96 u n r e l a t e d , u n a f f e c t e d controls r e v e a l e d one i n d i v i d u a l (N10) who was h e t e r o z y g o u s for th is s a m e a l t e r a t i o n . We concluded t h a t t he V a l 1 2 4 M e t s u b s t i t u t i o n is a r a r e v a r i a n t not c a u s i n g S t a r g a r d t disease. B a s e d on t h e s e r e s u l t s , it is u n l i k e l y t h a t m u t a t i o n s in GNAT2 are a com m on cause of S ta rg a r d t disease. We c a n n o t definitively ru le out a role for t he GNAT2 gene in S t a r g a r d t d ise a se b e c a u s e t he SSCP t e c h n i q u e has an e s t i m a t e d 10% n o n d e t e c t i o n r a t e (3), so t h a t our sc re e n could possibly miss some m u t a t i o n s . F u r t h e r more, a p a t h o g e n i c m u t a t i o n in this gene m i g h t lie out si de t h e regions t h a t we i n c l u d e d in our screen. Finally, S t a r g a r d t di sease is t h o u g h t to exhi bi t nonallelic h e t e r o g e n e i t y , and it m i g h t be t h a t by chance we did not include in our s c r e e n a p a t i e n t w i t h a GNAT2 m u t a t i o n . It r e m a i n s to be seen w h a t disease, if any, is c a u s e d by defects in th e GNAT2 gene.

290

SHORT COMMUNICATION

TABLE 1 O l i g o m e r s a n d C o n d i t i o n s for P C R A m p l i f i c a t i o n o f E x o n s in t h e H u m a n C o n e T r a n s d u c i n G e n e

Exon

Primer pairs (sense/antisense, 5' to 3' direction)

Ampl. frag. size (in bp)

pH

[MgC12] (mM)

Annealing temp (°C)

Restriction enzyme

DMSO (10%)

AGTTGAAGTAGGGAGTCTCA TCTCTGGCTCATCTTCCCAT

350

8.6

1.00

52

HaeIII

Yes

GTGGAAATCGAAAGCATAAG TCTTCACCCTATCTTGTCTT

120

8.6

1.50

52

No

AGCTAAAGACAGAGTGTCTG CTGCTTCCACCCTTAACCAC

210

8.4

1.00

54

No

TGTGAAGTTCTTAACCAGGT CTAGAAGATTGCTTAAGCAT

240

8.4

1.00

50

GTCTCTTAGCCTCGTCTGTG TGTATCCGAGATGCCCTAGG

220

8.6

1.50

50

No

GTATGTTGGGCATACCTATG TGTTCTACCAAAGCTGCTTG

210

8.6

1.50

50

No

ATTCTATAAGCCAAATCTGA AGTCTCTACTAAAAGGCATT

250

8.4

1.50

50

AvaII

Yes

TCAGCAACTAACAAGGGTTC ATACCTGAGGAATGGTGAGG

270

8.4

1.50

54

BsrI

No

ACKNOWLEDGMENTS This research was supported by NIH Grants EY08683 (to T.P.D.), EY00169 (to E.L.B.), DC00871 (to C.C.M.), and EY08562 (to S.-L.F.), and by the RP Foundation Fighting Blindness, Baltimore, MD (to T.P.D. and E.L.B.).

REFERENCES 1. Blatt, C., Eversole-Cire, P., and Cohn, V. H. (1988). Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human. Proc. Natl. Acad. Sci. USA 85: 7642-7646. 2. Berson, E. L. (1993). Retinitis pigmentosa. Invest. Ophthalmol. Vis. Sci. 34(5): 1659-1676. 3. Condie, A., Eeles, R., Borresen, A. L., Coles, C., Cooper, C., and Presser, J. (1993). Detection of point mutations in the p53 gene: Comparison of single-strand conformation polymorphism, constant denaturing gel electrophoresis, and hydroxylamine and osmium tetroxide techniques. Hum. Mutat. 2: 58-66. 4. Dryja, T. P. (1992). Rhodopsin and autosomal dominant retinitis pigmentosa. Eye 6: 1-10. 5. Kaplan, J., Gerber, S., Larget-Piet, D., Rozet, J.-M., Dollfus, H., Duffer, J.-L., Odent, S., Postel-Vinay, A., Janin, N., Briard, M.-L., Frezal, J., and Munnich, A. (1993). A gene for Stargardt's disease (fundus flavimaculatus) maps to the short arm of chromosome 1. Nature Genet. 5: 308-311. 6. Lichter, P., Tang, C. C., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990). High-resolution banding of human chromosome 11 by in situ hybridization with cosmid clones. Science 247: 64-69. 7. McLaughlin, M. E., Sandberg, M. A., Berson, E. L., and Dryja, T. P. (1993). Recessive mutations in the gene encoding the/~subunit of rod phosphodiesterase in patients with retinitis pigmentosa. Nature Genet. 4: 130-134. 8. Morris, T. A., and Fong, S.-L. (1993). Characterization of the gene encoding human cone transducin a-subunit (GNAT2). Genomics 17: 442-448. 9. Ney, P. A., Andrews, N. C., Jane, S. M., Safer, B., Puruckner, M. E., Weremowicz, S., Morton, C. C., Goff, S. C., Orkin, S. H.,

10.

11.

12.

13.

14.

15.

16.

17.

18. 19.

TaqI

Yes

and Nienhuis, A. W. (1993). Purification of the human NF-E2 complex: cDNA cloning of the hematopoietic-specific subunit and evidence for an associated partner. Mol. Cell. Biol. 13: 5604-5612. Olsson, J. E., Gordon, J. W., Pawlyk, B. S., Roof, D. J., Hayes, A., Molday, R. S., Mukai, S , Cowley, G. S., Berson, E. L., and Dryja, T. P. (1992). Transgenic mice with rhodopsin mutation (Pro23His): A mouse model of autosomal dominant retinitis pigmentosa. Neuron 9: 815-830. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, I~ (1989). Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874-879. Pittler, S. J., and Baehr, W. (1991). Identification of a nonsense mutation in the rod photoreceptor cGMP phosphodiesterase beta-subunit gene of the rd mouse. Proc. Natl. Acad. Sci. USA 88: 8322-8326. Reichel, E., and Sandberg, M. A. (1993). Hereditary macular degenerations. In "Principles and Practice of Ophthalmology: Clinical Practice" (D. M. Albert and F. A. Jakobiec, Eds.), pp. 1249-1262, W. B. Saunders, Philadelphia. Sandberg, M. A., Hanson, A. H., and Berson, E. L. (1983). Foveal and parafoveal cone electroretinograms in juvenile macular degeneration. Ophthal. Paediatr. Genet. 3(2): 83-87. Sandberg, M. A., Jacobson, S. G., and Berson, E. L. (1979). Foveal cone electroretinograms in retinitis pigmentosa and juvenile macular degeneration. Am. J. Ophthalmol. 88: 702-707. Sparkes, R. S., Cohn, V. H., Mohandas, T., Zollman, S., CireEversole, P., Amatruda, T. T., Reed, R. R., Lochrie, M. A , and Simon, M. I. (1987). Mapping of genes encoding the subunits of guanine nucleotide binding proteins (G-proteins) in humans. Cytogenet. Cell Genet. 46: 696. Stargardt, K. (1909). Uber familiare, progressive Degeneration in der Makulagegend des Auges. Albrecht yon Graefes Arch. Ophthalmol. 71: 534-550. Stryer, L. (1991). Visual excitation and recovery. J. Biol. Chem. 266: 10711-10714. Yandell, D. W., and Dryja, T. P. (1989). Direct genomic sequence of alleles at the human retinoblastoma locus: Application to cancer and genetic counseling. In "Cold Spring Harbor Symposium Series: Cancer Cell 7: Molecular Diagnostics of Human Cancer" (M. Furth and M. Greaves, Eds.), pp. 223-227, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.