Marked effect of RhoA-specific shRNA-producing plasmids on neurite growth in PC12 cells

Neuroscience Letters 440 (2008) 170–175

Contents lists available at ScienceDirect

Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet

Marked effect of RhoA-specific shRNA-producing plasmids on neurite growth in PC12 cells You-Ming Fan a,b,1 , Chi-Pui Pang a,c , Alan R. Harvey d , Qi Cui a,c,∗ a

Joint Shantou International Eye Center of Shantou University and The Chinese University of Hong Kong, Shantou University Medical College, Shantou, PR China Department of Pathophysiology and High Altitude Physiology, Third Military Medical University, ChongQing, PR China c Department of Ophthalmology and Visual Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Hong Kong, PR China d School of Anatomy and Human Biology, The University of Western Australia, Crawley 6009, Australia b

a r t i c l e

i n f o

Article history: Received 18 January 2008 Received in revised form 29 April 2008 Accepted 5 May 2008 Keywords: Neurite outgrowth RhoA Small hairpin RNA RNA interference PC12 cells

a b s t r a c t In order to promote neurite outgrowth, we constructed a plasmid producing RhoA-specific small hairpin RNA (shRNA) to block RhoA expression and tested its actions in PC12 cells. Our results show that the shRNA-mediated RNA interference (RNAi) successfully suppressed RhoA expression. As a consequence of RhoA knockdown, F-actin levels were significantly reduced and processes were markedly induced. These processes express two neurite markers, neurofilament and ␤III tubulin. This study demonstrates that plasmid-producing shRNA specific for RhoA can act as an effective tool to induce neurite outgrowth and further confirms the neurite growth-inhibitory role of RhoA. This shRNA may thus be a useful tool in promoting neurite outgrowth and could be applicable in neural repair after CNS injury. © 2008 Elsevier Ireland Ltd. All rights reserved.

Mammalian CNS neurons do not regenerate spontaneously after injury partly due to inhibitory molecules in the CNS. Some molecules inhibit axon regeneration through activation of RhoA [17,26]. Thus, blockade of RhoA signal transduction may result in axon regeneration. The most commonly used tools to block RhoA functions are dominant negative N19RhoA and C3 toxin. Previous studies showed that inactivation of RhoA using C3 transferase enhanced axonal outgrowth in vitro [4,8,17], but the effectiveness of C3 was not always seen in in vivo studies [8]. On the other hand, N19RhoA was shown not to be effective in promoting neurite outgrowth of dorsal root ganglia [8]. In aim to develop a tool for long-term in vivo suppression of RhoA actions, in this preliminary study we investigated whether plasmid expressing RhoA-specific small hairpin RNA (shRNA) was capable of inducing neurite outgrowth in PC12 cells, a commonly used in vitro system for studying neurite growth [10,33]. The sequences (5 -GATCCGGATCTTCGGAATGATGAGTTCAAGAGACTCATCATTCCGAAGATCCTTTTTTGGAAA-3 ; 5 -AGCTTTTCCAAAA-

∗ Corresponding author at: Department of Ophthalmology and Visual Sciences, The Chinese University of Hong Kong, Hong Kong, PR China. Tel.: +852 2762 3180; fax: +852 2715 9490. E-mail addresses: [email protected] (Q. Cui), [email protected] (Y.-M. Fan). 1 Tel.: +86 23 68752340x8203. 0304-3940/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2008.05.045

AAGGATCTTCGGAATGATGAGTCTCTTGAACTCATCATTCCGAAGATCCG-3 ) were annealed and inserted into pSilencer 2.1-U6 neo (Ambion, Austin, TX, USA) to obtain G418 resistant pSilencerRhoA RNA interference (RNAi) plasmid (pSil-RhoA RNAi). Manufacturer-supplied pSilencer 2.1-U6 neo negative control (pSil-Neg), which expresses a shRNA with limited homology to any known sequences in rat genome, served as the negative control. RhoA coding sequence (CDS) (178–759 of rat RhoA mRNA, Accession: NM 057132) was cloned by RT-PCR, inserted into pcDNA3.1/CT-GFP-TOPO vector (Invitrogen, Frederick, MD, USA) and named as pcDNA3.1/RhoA-CDS-GFP (pRhoA-CDS-GFP). 293 cells (Stratagene, La Jolla, CA, USA) and PC12 cells (American Type Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS) and 5% FBS+10% horse serum, respectively. Transient transfection was carried out with Lipofectamine 2000 (Invitrogen). 293 cells were cotransfected with pRhoA-CDS-GFP and pSil-RhoA RNAi or pSilNeg for 72 h to confirm the efficacy of the silencing action of shRNA-expressing plasmids. PC12 cells were plated on poly-l-lysine coated 6-well plates. At the indicated time points after transfection, the PC12 cells were fixed with 4% paraformaldehyde and stained with anti-RhoA (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA), anti-panneurofilament (NF) (Upstate Biotechnology, Waltham, MA, USA) or anti-␤III tubulin (TUJ1, Zymed, South San Francisco, CA, USA) primary antibody, then cyanine 3-conjugated second antibody

Y.-M. Fan et al. / Neuroscience Letters 440 (2008) 170–175

171

Fig. 1. Confirmation of the biological effect of RhoA RNAi in 293 cells and PC12 cells. (A) The coding sequence of RhoA (RhoA-CDS, at 582 bp) was cloned by RT-PCR. (B) Western blot analysis of RhoA (overexpressed RhoA-GFP) after 293 cells were transfected with pRhoA-CDS-GFP alone, pRhoA-CDS-GFP plus pSil-Neg (pSil-Neg), and pRhoA-CDS-GFP plus pSil-RhoA RNAi (pSil-RhoA RNAi) for 72 h. (C) Blockade of endogenous RhoA expression after pSil-RhoA RNAi treatment in PC12 cells. PC12 cells were transfected with peGFP plus pSil-Neg, or peGFP plus pSil-RhoA RNAi for 4 days and stained with anti-RhoA antibody. Almost no RhoA staining in pSil-RhoA RNAi transfected cells was seen (arrows on the right), whereas nearby untransfected or pSil-Neg transfected cells remained unaffected. Scale bar, 50 ␮m. (D) Western blot showing the significant reduction of endogenous RhoA protein by pSil-RhoA RNAi treatment for 4 days, whereas Rac1 and ␤-actin were not affected by pSil-RhoA RNAi treatment in PC12 cells. These experiments were performed three times with similar results.

(Jackson ImmunoResearch Laboratories, West Grove, PA, USA). For staining with F-actin, PC12 cells were incubated with 200 ng/ml of TRICT-phalloidin. A process longer than the cell body diameter was scored as a neurite. 293 cells were cotransfected with pRhoA-CDS-GFP plus pSilRhoA RNAi or pSil-Neg for 72 h, whereas PC12 cells were transfected with pSil-RhoA RNAi or pSil-Neg for 24 h and incubated with 600 ␮g/ml G418 for additional 72 h to kill the non-transfected cells. Then the proteins were extracted and separated by 10% SDS-PAGE and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedford, MA, USA). The membrane was incubated

with anti-RhoA or anti-rac1, and then with horseradish peroxidase (HRP)-conjugated secondary antibody (Santa Cruz Biotechnology Inc.). The signals were detected by ECL detection kit (Pierce, Rockford, IL, USA). The membranes were stripped, then reprobed with anti-␤-actin antibody (Sigma), which served as loading control. For rapid screening of RNAi for better target site of RhoA mRNA, we amplified PC12 cell RhoA CDS (Fig. 1A) by RT-PCR, then fused it with GFP. Of four possible target sites, we found, through the brightness of GFP, that the sequence (534–552) is the most effective target for RNAi, consistent with a previous report [1]. The brightness of GFP after pRhoA-CDS-GFP plus pSil-RhoA RNAi transfection

Fig. 2. Comparison of morphology of PC12 cells treatment with NGF and pSil-RhoA RNAi for 36 h. (A) In the absence of nerve growth factor (NGF), (B) in the presence of NGF, (C) transfection with peGFP plus pSil-RhoA RNAi under fluorescent microscopy, and (D) in the same field of C under light microscopy. Scale bar, 50 ␮m.

172

Y.-M. Fan et al. / Neuroscience Letters 440 (2008) 170–175

Fig. 3. Induction of neurite outgrowth by RhoA RNAi in PC12 cells at different times. (A) PC12 cells were cotransfected with peGFP and pSil-Neg (control, on day 6 after transfection), or with peGFP and pSil-RhoA RNAi for 1–6 days. (B) Quantification analysis (mean ± S.D.) shows that the percentage of neurite-bearing PC12 cells increases from 2 to 5 days after pSil-RhoA transfection. Negative control did not develop any neurite at all time-points examined (data not shown).

decreased substantially compared with pRhoA-CDS-GFP alone or cotransfection with pSil-Neg in 293 cells. Expression of RhoA-CDSGFP fusion protein was almost completely eliminated by pSil-RhoA RNAi whereas change was not obvious after pSil-Neg transfection (Fig. 1B). PC12 cells express a high level of RhoA. To further confirm whether the plasmid also worked in PC12 cells, we transfected PC12 cells with pSil-RhoA RNAi or the negative control pSil-Neg. eGFP expressing vector peGFP-N1 was cotransfected to label the transfected cells and to visualize the cellular morphology. Four days after transfection, the intensity of RhoA staining in pSil-RhoA RNAi transfected cells was significantly reduced compared with that of the untransfected, peGFP transfected or pSil-Neg transfected (Fig. 1C) cells. The effectiveness of pSil-RhoA RNAi in suppressing RhoA expression in PC12 cells was also validated using Western blotting (Fig. 1D). RhoA expression was clearly decreased on day 4 after pSil-RhoA RNAi transfection, whereas no change was seen after peGFP or pSil-Neg transfection. Note that rac1 protein, a close relative of RhoA [5,20,27,30], and the house keeping gene ␤-actin remained unchanged after pSil-RhoA RNAi transfection. The lack of influence on rac1 suggests specificity of this RNAi on RhoA. These experiments thus, convincingly demonstrate that the pSil-RhoA RNAi plasmid eliminates both exogenously and endogenously RhoA protein with high efficiency in 293 cells and PC12 cells, respectively. In the normal condition, PC12 cells were round-to-oval in shape, with few neurites, and tended to grow in small clumps (Fig. 2A). Consistent with previous studies [10,33], neurite outgrowth was induced in PC12 cells 36 h after NGF stimulation (Fig. 2B). In the absence of NGF pSil-RhoA RNAi transfected PC12 cells also

developed neurites 36 h after transfection (Fig. 2C). It should be mentioned that, although both NGF-stimulated and pSil-RhoA RNAi transfected PC12 cells developed long, thin neurites, the bodies of NGF stimulated PC12 cells appeared to be fuller or more protruding in three-dimensional aspect than that of pSil-RhoA RNAi transfected PC12 cells (Fig. 2B and D). To further clarify the effects of RhoA RNAi on PC12 cells, we observed morphological changes. The shape of PC12 cells changed gradually after RhoA RNAi transfection, and began to possess various morphologies with the elongated form sometimes being seen on day 1 (Fig. 3A). After 2–3 days, a small proportion of the cells developed one or more short neurites, a few of which extended more than one cell body length. After 4–6 days, neurites were longer and a greater proportion of cells expressed neurites (Fig. 3A and B). Quantitative analysis confirmed that the percentage of neuritebearing cells increased as the length of pSil-RhoA RNAi transfection time grew (Fig. 3B). It reached a peak (20%) on day 5 (Fig. 3B). In contrast, the morphology of pSil-Neg transfected PC12 cells did not have obvious change (data not shown). These results suggest that knockdown of RhoA by shRNA is sufficient to induce neurite growth in PC12 cells. Beside reorganization of actin cytoskeleton, neurite formation requires assembly of microtubulin cytoskeleton and intermediate filaments. To characterize RhoA RNAi-induced neurite growth, we examined the expression of microtubulin cytoskeletal protein ␤III tubulin and the neuron-specific intermediate NF. NGF is known to increase the level of NF proteins in PC12 cells [18]. In this study neurites were clearly stained in PC12 cells after NGF stimulation or pSil-RhoA RNAi transfection (Fig. 4A). Immunohistochemical

Y.-M. Fan et al. / Neuroscience Letters 440 (2008) 170–175

173

Fig. 4. pSil-RhoA RNAi-induced processes express neurofilament (NF; A) and ␤III tubulin (TUJ1; B). Scale bar, 50 ␮m.

results showed that ␤III tubulin was also expressed in PC12 cells after NGF stimulation or pSil-RhoA RNAi transfection (Fig. 4B). These results thus, demonstrate that RhoA RNAi-induced processes have neuritic characteristics. Serum contains lysophosphatidic acid (LPA), which activates Rho and elicits actomysin contraction through a G-protein coupled receptor Ga12/13 [15]. Actomysin contraction leads to formation of F-actin that maintains cellular shape. If neurite induction observed here was due to reduction of RhoA activity a change in F-actin network may occur. In this study F-actin was clearly seen on normal cell bodies except nuclei in peGFP alone transfected and peGFP plus pSil-Neg transfected (Fig. 5 first and second rows, arrows) as well as nearby non-transfected cells. Four days after pSil-RhoA RNAi transfection, a time-point at which RhoA protein was known to have been depleted by RhoA RNAi (Fig. 1C and D), the level of Factin decreased substantially (Fig. 5 third row, arrows), concomitant with the decreased intensity of RhoA staining in these transfected cells (Fig. 1C and D). In contrast, the intensity of F-actin staining in non-transfected cells nearby remained unaffected (Fig. 5 third row, arrowheads). Note that when the intensity of F-actin was reduced, neurite outgrowth was induced in the transfected cells (Fig. 5 third row, arrows), whereas morphology of untransfected cells remained round without neurites (Fig. 5 third row, arrowheads). Our results are obviously different from a previous study whereby dominant negative form of RhoA N19RhoA was used as an inactivation tool for RhoA. Stable N19RhoA clones of PC12 cell in

their naive state showed no difference from wild type and mocktransfected controls [31]. These data indicate that N19RhoA may not be an efficient tool in inducing neurite outgrowth of PC12 cells. It could be explained by the following reasons. N19RhoA exists as the constitutively GDP-bounding form which binds to a guanine nucleotide exchange factor (GEF) but is unable to exchange the GDP for GTP. Similar to dominant inhibitory ras, which inhibits the catalytic domain of rasGEFs, N19RhoA inhibits directly the catalytic domain of rhoGEFs rather than RhoA itself [7]. Recently, it is reported that N19RhoA prevents activation of not only RhoA but also Rac [7,21], the latter is well known to play an important role in enhancing neurite outgrowth [3,12,14,16] including in PC12 cells [13]. The simultaneous suppression of RhoA and Rac activities by N19RhoA may thus compromise its efficiency in promoting neurite outgrowth. In contrast, our shRNA-mediated RNAi directly blocks expression of RhoA (Fig. 1) but not rac1 (Fig. 1D). Compared with the N19RhoA results, we obtained better neurite outgrowth in the presence of serum even without of NGF. Thus, RhoA RNAi is a more powerful tool for inducing neurite outgrowth than the dominant negative form of RhoA N19RhoA in PC12 cells. Our results are also markedly different from a previous study whereby chemically synthesized short interfering RNA (siRNA) specific for RhoA mRNA was used to block RhoA expression but failed to induce neurite outgrowth in PC12 cells [13]. The differences may result from different type of RhoA RNAi used. Synthesized siRNA was used in their study whereas plasmid-expressing shRNA was

174

Y.-M. Fan et al. / Neuroscience Letters 440 (2008) 170–175

Fig. 5. RhoA RNAi disrupt F-actin in PC12 cells. F-actin is normally distributed in the cytoplasm of the transfected cells (arrows in rows 1 and 2) and nearby untransfected. Clear reduction in the level of F-actin (arrows in rows 3) was seen after pSil-RhoAi transfection compared with nearby untransfected (arrowheads in row 3) and pSil-Neg transfected cells (arrows in row 2). Scale bar, 50 ␮m.

used in this study. RNAi effect of plasmid-expressing shRNA can be more pronounced and prolonged [22] compared with transient suppression of RhoA by synthesized siRNA. Once the plasmid is delivered into the cell, it can produce a large amount of shRNAs and subsequent siRNA molecules, whereas synthesized siRNAs cannot be amplified in mammalian cells [28]. It is thus, not surprising that the plasmid-mediated RhoA RNAi action is more powerful than that of synthesized one. It is well known that there are various types of axon growthinhibitory molecules in mature CNS, such as myelin-associated glycoprotein [19,23,25], oligodendrocyte myelin glycoprotein [34] and Nogo [2,9]. After binding with NgR/LINGO/p75 or NgR/LINGO/TROY receptor complex, these inhibitors activate RhoA to inhibit axonal regeneration [24,29,32]. Inactivation of RhoA by C3 have been proved to promote neurite outgrowth [4,8,17]. In contrast to what was seen in PC12 cells [31], synthesized RhoA siRNA also promoted neurite outgrowth [1] and blocked Sema 3A-mediated growth cone collapse in dorsal root ganglia culture [11]. RhoA is known to be activated for at least 7 days after spinal cord injury [6]. Thus, prolonged blockade of RhoA activity is important in promoting axon regeneration after spinal cord injury. In this regard, the shRNAmediated RhoA RNAi could be more effective in promoting axonal regeneration via prolonged suppression of RhoA function in vivo. In summary, in the present study we have successfully constructed a pSil-RhoA RNAi plasmid which suppresses RhoA activity. The RhoA RNAi markedly induces neurite outgrowth of PC12 cells. This study thus, confirms the neurite growth-inhibitory role of RhoA and provides a useful alternative for studies of RhoA functions. In combination with gene therapy approach, such as utilizing viral vector to express this type of RhoA siRNA in vivo, enhanced axonal regeneration and functional recovery might be achievable after CNS injury. Acknowledgements This project supported by Natural Science Foundation of China (No. 30672038), China Postdoctoral Science Foundation (No. 2005037624), and Joint Shantou International Eye Center of Shantou University and The Chinese University of Hong Kong (JSIEC).

References [1] Z. Ahmed, R.G. Dent, E.L. Suggate, L.B. Barrett, R.J. Seabright, M. Berry, A. Logan, Disinhibition of neurotrophin-induced dorsal root ganglion cell neurite outgrowth on CNS myelin by siRNA-mediated knockdown of NgR, p75NTR and Rho-A, Mol. Cell Neurosci. 28 (2005) 509–523. [2] M.S. Chen, A.B. Huber, M.E. van der Haar, M. Frank, L. Schnell, A.A. Spillmann, F. Christ, M.E. Schwab, Nogo-A is a myelin-associated neurite outgrowth inhibitor and an antigen for monoclonal antibody IN-1, Nature 403 (2000) 434–439. [3] R.H. Daniels, P.S. Hall, G.M. Bokoch, Membrane targeting of p21-activated kinase 1 (PAK1) induces neurite outgrowth from PC12 cells, EMBO J. 17 (1998) 754–764. [4] P. Dergham, B. Ellezam, C. Essagian, H. Avedissian, W.D. Lubell, L. McKerracher, Rho signaling pathway targeted to promote spinal cord repair, J. Neurosci. 22 (2002) 6570–6577. [5] J. Didsbury, R.F. Weber, G.M. Bokoch, T. Evans, R. Snyderman, rac, a novel rasrelated family of proteins that are botulinum toxin substrates, J. Biol. Chem. 264 (1989) 16378–16382. [6] C.I. Dubreuil, M.J. Winton, L. McKerracher, Rho activation patterns after spinal cord injury and the role of activated Rho in apoptosis in the central nervous system, J. Cell Biol. 162 (2003) 233–243. [7] L.A. Feig, Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases, Nat. Cell Biol. 1 (1999) E25–E27. [8] A.E. Fournier, B.T. Takizawa, S.M. Strittmatter, Rho kinase inhibition enhances axonal regeneration in the injured CNS, J. Neurosci. 23 (2003) 1416–1423. [9] T. GrandPre, F. Nakamura, T. Vartanian, S.M. Strittmatter, Identification of the Nogo inhibitor of axon regeneration as a reticulon protein, Nature 403 (2000) 439–444. [10] L.A. Greene, A.S. Tischler, Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor, Proc. Natl. Acad. Sci. U.S.A. 73 (1976) 2424–2428. [11] U. Hengst, L.J. Cox, E.Z. Macosko, S.R. Jaffrey, Functional and selective RNA interference in developing axons and growth cones, J. Neurosci. 26 (2006) 5727–5732. [12] M. Hirose, T. Ishizaki, N. Watanabe, M. Uehata, O. Kranenburg, W.H. Moolenaar, F. Matsumura, M. Maekawa, H. Bito, S. Narumiya, Molecular dissection of the Rho-associated protein kinase (p160ROCK)-regulated neurite remodeling in neuroblastoma N1E-115 cells, J. Cell Biol. 141 (1998) 1625–1636. [13] M. Hoshino, S. Nakamura, Small GTPase Rin induces neurite outgrowth through Rac/Cdc42 and calmodulin in PC12 cells, J. Cell Biol. 163 (2003) 1067–1076. [14] R. Kozma, S. Sarner, S. Ahmed, L. Lim, Rho family GTPases and neuronal growth cone remodelling: relationship between increased complexity induced by Cdc42Hs, Rac1, and acetylcholine and collapse induced by RhoA and lysophosphatidic acid, Mol. Cell Biol. 17 (1997) 1201–1211. [15] O. Kranenburg, M. Poland, F.P. van Horck, D. Drechsel, A. Hall, W.H. Moolenaar, Activation of RhoA by lysophosphatidic acid and Galpha12/13 subunits in neuronal cells: induction of neurite retraction, Mol. Biol. Cell 10 (1999) 1851–1857. [16] J. Leemhuis, S. Boutillier, H. Barth, T.J. Feuerstein, C. Brock, B. Nurnberg, K. Aktories, D.K. Meyer, Rho GTPases and phosphoinositide 3-kinase organize formation of branched dendrites, J. Biol. Chem. 279 (2004) 585–596.

Y.-M. Fan et al. / Neuroscience Letters 440 (2008) 170–175 [17] M. Lehmann, A. Fournier, I. Selles-Navarro, P. Dergham, A. Sebok, N. Leclerc, G. Tigyi, L. McKerracher, Inactivation of Rho signaling pathway promotes CNS axon regeneration, J. Neurosci. 19 (1999) 7537–7547. [18] M.H. Lindenbaum, S. Carbonetto, F. Grosveld, D. Flavell, W.E. Mushynski, Transcriptional and post-transcriptional effects of nerve growth factor on expression of the three neurofilament subunits in PC-12 cells, J. Biol. Chem. 263 (1988) 5662–5667. [19] B.P. Liu, A. Fournier, T. GrandPre, S.M. Strittmatter, Myelin-associated glycoprotein as a functional ligand for the Nogo-66 receptor, Science 297 (2002) 1190–1193. [20] L.M. Machesky, A. Hall, Role of actin polymerization and adhesion to extracellular matrix in Rac- and Rho-induced cytoskeletal reorganization, J. Cell Biol. 138 (1997) 913–926. [21] K.J. Marler, R. Kozma, S. Ahmed, J.M. Dong, C. Hall, L. Lim, Outgrowth of neurites from NIE-115 neuroblastoma cells is prevented on repulsive substrates through the action of PAK, Mol. Cell Biol. 25 (2005) 5226–5241. [22] A.P. McCaffrey, L. Meuse, T.T. Pham, D.S. Conklin, G.J. Hannon, M.A. Kay, RNA interference in adult mice, Nature 418 (2002) 38–39. [23] L. McKerracher, S. David, D.L. Jackson, V. Kottis, R.J. Dunn, P.E. Braun, Identification of myelin-associated glycoprotein as a major myelin-derived inhibitor of neurite growth, Neuron 13 (1994) 805–811. [24] S. Mi, X. Lee, Z. Shao, G. Thill, B. Ji, J. Relton, M. Levesque, N. Allaire, S. Perrin, B. Sands, T. Crowell, R.L. Cate, J.M. McCoy, R.B. Pepinsky, LINGO-1 is a component of the Nogo-66 receptor/p75 signaling complex, Nat. Neurosci. 7 (2004) 221–228. [25] G. Mukhopadhyay, P. Doherty, F.S. Walsh, P.R. Crocker, M.T. Filbin, A novel role for myelin-associated glycoprotein as an inhibitor of axonal regeneration, Neuron 13 (1994) 757–767.

175

[26] B. Niederost, T. Oertle, J. Fritsche, R.A. McKinney, C.E. Bandtlow, Nogo-A and myelin-associated glycoprotein mediate neurite growth inhibition by antagonistic regulation of RhoA and Rac1, J. Neurosci. 22 (2002) 10368– 10376. [27] C.D. Nobes, A. Hall, Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia, Cell 81 (1995) 53–62. [28] C.D. Novina, P.A. Sharp, The RNAi revolution, Nature 430 (2004) 161–164. [29] J.B. Park, G. Yiu, S. Kaneko, J. Wang, J. Chang, X.L. He, K.C. Garcia, Z. He, A TNF receptor family member, TROY, is a coreceptor with Nogo receptor in mediating the inhibitory activity of myelin inhibitors, Neuron 45 (2005) 345–351. [30] A.J. Ridley, H.F. Paterson, C.L. Johnston, D. Diekmann, A. Hall, The small GTPbinding protein rac regulates growth factor-induced membrane ruffling, Cell 70 (1992) 401–410. [31] A. Sebok, N. Nusser, B. Debreceni, Z. Guo, M.F. Santos, J. Szeberenyi, G. Tigyi, Different roles for RhoA during neurite initiation, elongation, and regeneration in PC12 cells, J. Neurochem. 73 (1999) 949–960. [32] Z. Shao, J.L. Browning, X. Lee, M.L. Scott, S. Shulga-Morskaya, N. Allaire, G. Thill, M. Levesque, D. Sah, J.M. McCoy, B. Murray, V. Jung, R.B. Pepinsky, S. Mi, TAJ/TROY, an orphan TNF receptor family member, binds Nogo-66 receptor 1 and regulates axonal regeneration, Neuron 45 (2005) 353–359. [33] D. Vaudry, P.J. Stork, P. Lazarovici, L.E. Eiden, Signaling pathways for PC12 cell differentiation: making the right connections, Science 296 (2002) 1648– 1649. [34] K.C. Wang, V. Koprivica, J.A. Kim, R. Sivasankaran, Y. Guo, R.L. Neve, Z. He, Oligodendrocyte-myelin glycoprotein is a Nogo receptor ligand that inhibits neurite outgrowth, Nature 417 (2002) 941–944.