- Email: [email protected]
Marker-assisted pyramiding of soybean resistance genes RSC4, RSC8, and RSC14Q to soybean mosaic virus
Journal of Integrative Agriculture 2017, 16(11): 2413–2420 Available online at www.sciencedirect.com
ScienceDirect
RESEARCH ARTICLE
Marker-assisted pyramiding of soybean resistance genes RSC4, RSC8, and RSC14Q to soybean mosaic virus WANG Da-gang1, 2, ZHAO Lin1, LI Kai1, MA Ying1, WANG Li-qun1, YANG Yong-qing1, YANG Yun-hua1, ZHI Hai-jian1 1
College of Agriculture, Nanjing Agricultural University/National Center for Soybean Improvement/National Key Laboratory for Crop Genetics and Germplasm Enhancement, Nanjing 210095, P.R.China 2 Crop Institute, Anhui Academy of Agricultural Sciences/Anhui Key Laboratory of Crops Quality Improving, Hefei 230031, P.R.China
Abstract Soybean mosaic virus (SMV) is one of the major viral pathogens affecting soybean crops worldwide. Three SMV resistance genes, RSC4, RSC8, and RSC14Q, have been identified and mapped on soybean chromosomes 14, 2, and 13 from Dabaima, Kefeng 1, and Qihuang 1 cultivars, respectively. Soybean cultivar Nannong 1138-2 is widely grown in the Yangtze River Valley of China. In this study, crosses were made between Qihuang 1×Kefeng 1 and Dabaima×Nannong 1138-2. Ten simple sequence repeat (SSR) markers linked to three resistance loci (RSC4, RSC8, and RSC14Q) were used to assist pyramided breeding. Pyramided families containing three resistance loci (RSC4, RSC8, and RSC14Q) were evaluated by inoculating them with 21 SMV strains from China. Results indicated that the 10 markers can be used effectively to assist the selection of resistant individuals containing RSC4, RSC8, and RSC14Q. A total of 53 F6 plants were confirmed to contain three homozygous alleles conferring resistance to SMV. Five F7 homozygous pyramided families exhibited resistance to 21 strains of SMV and showed desirable agronomic traits using dual selection. The strategy of pyramiding resistance gene derived from different varieties has practical breeding value in providing broad-spectrum resistance against the existing strains of SMV in China. Keywords: soybean, soybean mosaic virus, resistance genes, pyramiding, marker-assisted breeding
and deficiencies in seed quality. The most effective way to
1. Introduction Soybean mosaic virus (SMV) is one of the most important and destructive viral diseases affecting soybean production worldwide, which can cause significant yield reductions
control the disease is to breed resistant varieties, which is a more economical and environmental friendly approach than chemical control strategies. Therefore, the development of resistant varieties against disease is a priority area in soybean breeding programs. Some single dominant resistance genes have been deployed in soybean cultivars by managing the incidence of SMV (Smith 1968; Buss et al. 1988). The breakdown of
Received 28 November, 2016 Accepted 11 May, 2017 WANG Da-gang, E-mail: [email protected]; Correspondence ZHI Hai-jian, Tel: +86-25-84396463, E-mail: [email protected] © 2017, CAAS. Publishing services by Elsevier B.V. All rights reserved. doi: 10.1016/S2095-3119(17)61682-4
resistance in soybean varieties has been reported, which is a consequence of evolutionary (i.e., genetic) changes associated with viral genomes in response to the deployment of resistant varieties with a single resistance gene (Choi et al. 2005; Koo et al. 2005; Gagarinova et al. 2008; Yang et al.
2414
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
2014). However, this can be delayed by pyramiding multiple resistance genes into soybean varieties. The pyramiding of resistance genes that originate from different parental lines can lead to a broader resistance spectrum, and thus the potential risk of a resistance breakdown would be reduced. Frequently, the pyramiding strategy, combining several resistance genes into one cultivar, has been proposed to enhance the durability of resistance (Pedersen and Leath 1988). However, gene pyramiding is highly timeconsuming and difficult using conventional breeding methods, as a result of genes that produce similar functional proteins in two or more strains being difficult to identify. However, the presence of molecular markers that are closely linked with each resistance gene makes the identification of plants with two and more resistance genes possible. The molecular marker-assisted pyramiding of multiple resistance genes into an elite variety, leading to the simultaneous expression of more than one gene, is a strategy that can prevent or delay the breakdown of resistance. The dominant expression of molecular markers that are linked to resistance genes can be used to track all possible resistance genes in any breeding program. SMV resistance genes Rsv1, Rsv3, and Rsv4 have been reported and fine-mapped to three different chromosomes (chr. 13, 14, and 2) (Yu et al. 1994; Hayes et al. 2000; Jeong et al. 2002; Shi et al. 2008; Saghai Maroof et al. 2010; Suh et al. 2011; Ilut et al. 2016). The pyramiding of Rsv1, Rsv3, and Rsv4 through marker-assisted selection (MAS) is an ideal method for creating durable and wide-spectrum resistance to all strains of SMV in the USA (Saghai Maroof et al. 2008). By doing so, Saghai Maroof et al. (2008) confirmed that soybean lines that contained two or three resistance genes displayed high levels of resistance to SMV. Shi et al. (2009) screened five soybean lines and found, by gene pyramiding, that they carried all three SMV homozygous resistance genes (Rsv1, Rsv3, and Rsv4) to create potentially durable resistance to SMV. To date, several monogenically controlled SMV resistance genes, including RSC3Q, RSC4, RSC7, RSC8, RSC14Q, RSC15, and RSC18, have been fine-mapped and assigned to at least four soybean chromosomes (Fu et al. 2006; Li et al. 2006; Wang et al. 2010, 2011; Ma et al. 2011; Yang and Gai 2011; Zheng et al. 2014; Li et al. 2015; Yan et al. 2015). To our knowledge, no report has been published regarding the use of this combination of SMV resistance genes in China. RSC4 was mapped onto soybean chromosome 14, and two genomic simple sequence repeat (SSR) markers, BARCSOYSSR_14_1413 and BARCSOYSSR_14_1417, were found to be tightly linked to RSC4 with distances of 0.18 and 0.58 cM, respectively (Wang et al. 2011). RSC8 is situated between BARCSOYSSR_02_0610 and BARCSOYSSR_02_0616 with a distance of 0.1 and 0.3 cM,
respectively (Wang et al. 2010). Another dominant SMV resistance gene, RSC14Q, was mapped onto soybean chromosome 13 with an approximate 4.2 cM interval between the markers Satt334 and Sct_033 (Li et al. 2006). Ma et al. (2011) further restricted RSC14Q to the interval of genetic distances of 0.6 and 0.5 cM flanked by the Satt334 and MY750 markers, using the screening of residual heterozygous lines. In this study, SSR markers were used to pyramid the SMV resistance genes RSC4, RSC8, and RSC14Q through MAS in available strains in China to confirm disease resistance. This study aimed to evaluate the effects of the MAS and eventually to create multi-resistance varieties for breeding program to counteract SMV in soybean.
2. Materials and methods 2.1. Plant materials Three SMV resistant soybean cultivars and one founder parent were used for pyramiding the three resistance genes, including Dabaima (RSC4), Kefeng 1 (RSC8), Qihuang 1 (RSC14Q), and Nannong 1138-2, which is widely grown in the Yangtze River Valley, China. The pyramiding scheme for the three SMV resistance genes is shown in Fig. 1. The four soybean parents were grown at the Jiangpu Experimental Station of Nanjing Agricultural University in 2006. Two crosses were made, between Qihuang 1×Kefeng 1 and Dabaima×Nannong 1138-2. Then, F1 plants of Qihuang 1×Kefeng 1 were crossed with F1 plants of Dabaima×Nannong 1138-2. The multi-cross F1 plants were grown in the field and harvested individually to produce F2 seeds. The F2 populations were grown in the field for DNA isolation and to produce F2:3 families. Qihuang 1×Kefeng 1 RSC14Q RSC8 F1
Dabaima× Nannong 1138-2 RSC4 ×
F1
F1 ⊗ F2 MAS selection from F2 to F6
⊗ F3 ⊗
Phenotypic selection at F3:4, F4:5, and F5:6
F6 Evaluation of resistance of the pyramided families to 21 SMV strains and agronomic traits at F6:7 and F7:8
Fig. 1 Scheme for the development of RSC4, RSC8, and RSC14Q gene-pyramided breeding families using marker-assisted selection (MAS). SMV, soybean mosaic virus.
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
Each F2:3 family were divided into four equal groups with 10–20 seeds. One group was grown in the field for DNA isolation and to produce F3:4 families. The remaining three groups were grown in an aphid-free greenhouse and inoculated with SMV strains, SC4, SC8, and SC14. A similar strategy was used to produce F4 to F7 populations. Genotyping analysis for pyramided genes was performed amongst each population from the F2 to F6 generation using MAS. The selection of relevant traits for yield and quality was also carried out and recorded for parents and F7 pyramided families. Five random plants from each family were sampled for phenotypic data acquisition, including cotyledon color, days to first flowering, flowering color, days of mature period (recorded after 95% pods matured), plant height, branching number, number of seeds per pod, seed shape, seed coat color, protein content, oil content, and 100-grain weight.
2.2. Virus preparation and inoculation SMV strains SC4, SC8, and SC14 were preserved on the SMV susceptible parent Nannong 1138-2 in an aphid-free greenhouse. The inoculum was prepared by grinding infected young leaves using a mortar and pestle in 0.01 mol L–1 sodium phosphate buffer (approx. 3–5 mL g–1 leaf tissue) at pH 7.2 with 600-mesh carborundum powder. At the unifoliate leaf stage, plants were inoculated with SMV strains SC4, SC8, and SC14 using the mechanical leaf inoculation method (Li et al. 2006). The symptoms were recorded 7 d after inoculation at 1-wk intervals for 2 mon. The main purpose of the inoculation test was to verify the results of molecular MAS.
at 72°C was allowed for the completion of primer extension. The amplified products were visualized after electrophoresis on an 8% polyacrylamide gel followed by silver staining, or on a 1% agarose gel followed by ethidium bromide staining (Wang et al. 2010). Ten SSR markers closely linked to SMV resistance genes were used to select the three resistance genes in the SMV resistance families; this was consecutively implemented from F3 to F6 generations. Three SSR markers were linked with RSC4 by 1 cM or less on chromosome 14 (Wang et al. 2011), and four SSR markers were adjacent to RSC8 on chromosome 2 (Wang et al. 2010). Two SSR markers on chromosome 13, Satt334 and Sct_033, were used to check the presence of RSC14Q (Li et al. 2006). According to fine mapping in the RSC14Q region from the Qihuang 1×Nannong 1138-2 residual heterozygous lines, another Indel marker MY750, closely linked to RSC14Q at a distance of approximately 0.5 cM (Ma et al. 2011), was also selected. All primer sequences are publicly available in previous papers (Song et al. 2004, 2010; Ma et al. 2011) or SoyBase (http://soybase.org/sbt/) (Table 1).
2.5. Evaluation of multi-strains to pyramided families Furthermore, to examine the resistance spectrum of the soybean families with the three pyramided resistance genes from F6 and F7 generations, F6:7 and F7:8 families were produced after selfing and then inoculated with 21 strains of SMV (SC1–SC21) in China using the method mentioned above. One of these strains, SC15 is the most virulent strain as it infects all 10 differentials (Li et al. 2010).
2.3. DNA extraction
3. Results
Genomic DNA was extracted from fresh leaves using the cetyltrimethyl ammonium bromide (CTAB) method (Saghai Maroof et al. 1984) with minor modifications (Wang et al. 2010). DNA was diluted to a concentration of 50 ng μL–1 prior to use in polymerase chain reaction (PCR).
3.1. MAS efficiency for the resistance genes
2.4. PCR analysis for MAS PCR was conducted in a total reaction mixture of 10 μL including approximately 50 ng of genomic DNA, 1×PCR buffer (50 mmol L–1 KCl, 10 mmol L–1 Tris-HCl, pH 8.0, 0.01% gelatin), 0.25 μmol L–1 of each primer, 0.2 mmol L–1 deoxy-ribonucleoside triphosphates (dNTPs), and 1 U Taq polymerase in distilled deionized water. Template DNA was initially denatured at 94°C for 5 min followed by 30 cycles of PCR amplification with the following parameters: 30 s of denaturation at 94°C, 50 s of primer annealing at 55°C, and 50 s of primer extension at 72°C. A final 10 min incubation
2415
Genotypes of F2 progenies obtained from multi-cross F1 plants were analyzed by 10 SSR markers closely linked with three resistance genes, RSC4, RSC8 or RSC14Q. The MAS efficiency of F2 was not evaluated by phenotype data after inoculating with SMV, as there were insufficient numbers of F2:3 families to inoculate three SMV strains. In the F3 population, the 143 resistant genotypes and 150 that showed susceptible genotypes were tested by markers BARCSOYSSR_14_1413, BARCSOYSSR_14_1417, and BARCSOYSSR_14_1418. Validation of the detected markers was performed in F3:4 families compared with the phenotype data collected by the inoculation of individuals with the SC4 SMV strain. Overall, 136 plants showed a resistant phenotype in a total of 143 resistance genotypic plants and 140 were susceptible in a total of 150 susceptible genotypic plants in the F3 population. The coincidental
2416
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
rates were 95.10 and 93.33%, respectively (Table 2). Based on the genotype and phenotype data, MAS efficiency for the resistant or susceptible plants to SC8 and SC14 were higher than 94% using BARCSOYSSR_02_0606, BARCSOYSSR_02_0610, BARCSOYSSR_02_0616, BARCSOYSSR_02_0618, and Satt334, Sct_033, MY750 (Table 2). In the 127 plants in the F4 population, a resistant genotype was exhibited by 123 F4 plants tested by three markers closely linked with resistance gene RSC4, and the phenotype of 121 resistant plants were identified by inoculation with SC4. The results indicated that the coincidental rate was 96.75% (Table 3). Simultaneously, for RSC8 and RSC14Q, the coincidental rates were 97.60 and 96.72%, respectively. Using markers closely linked with resistance genes RSC4, RSC8, or RSC14Q, the MAS efficiency for the resistant plants in the F5 population were all up to 100% based on the genotype and phenotype data (Table 3).
These results indicated that the resistance of the plants tested by the SSR markers closely linked with three resistance genes RSC4, RSC8, and RSC14Q showed high levels of consistency to the one by conventional inoculation (Li et al. 2010). Therefore, the 10 SSR markers can be used effectively in selecting resistance genes RSC4, RSC8, and RSC14Q instead of identification by inoculation.
3.2. Pyramiding SMV resistance genes through MAS The marker-assisted breeding approach was performed on F2 to select the plants with resistance alleles of the three target genes; only progenies with the resistance alleles were advanced for the next generation (Table 3). Phenotype analysis was performed in families of the next generation to verify the MAS. From the F2 generation, 97 plants were selected as having an allele of three resistance genes on the basis
Table 1 List of simple sequence repeat (SSR) markers used for gene-pyramiding analysis Gene Chr. RSC4
RSC8
RSC14Q
Marker
Forward primer (5´→3´)
Genetic distance (cM) CAGTTTCAATGCTGTGCATTTT 0.18 Reveres primer (5´→3´)
References
14 BARCSOYSSR_14_1413
CCTCGCGGTTCGTTTATTAT
14 BARCSOYSSR_14_1417
CATTCGAGAGTTGGAGGAGC
TTTTCCCAAGCAAGAAGGTG
0.68
14 BARCSOYSSR_14_1418 CACACAATATTTTGGGAATTTT ATCA 2 BARCSOYSSR_02_0606 CAACATGCTGTTTGGAGCAG
TGTTTTGGTTCTTAACACTTT CACA CGTTGCCAATCCTTTGATTT
1.07 0.40
2
BARCSOYSSR_02_0610
GATGGGGGAGTGGTCATTTA
AATACCCGTGGGTCCTTACC
0.10
2
BARCSOYSSR_02_0616
ACGTGTTTGATACAGGCTGC
CCAAGGCTCCATAACTGCAT
0.30
2
BARCSOYSSR_02_0618
TGCGCATTACGATGAATGTT
AGCAGGGTATGTGATCCAGC
0.50
13
Satt334 Sct_033
2.80
Li et al. (2006)
13
MY750
GCGAGTTTTTGGTTGGATTG AGTTG TGCTAATTTAGATTACGTT ATGT CAAGGGAAACTGAAGAT
1.40
13
GCGTTAAGAATGCATTTATGTT TAGTC CTTTTAAATTATAATAGCATG ATCT AAAAGCGAAGGGAAATA
Wang et al. (2011) Wang et al. (2011) Wang et al. (2011) Wang et al. (2010) Wang et al. (2010) Wang et al. (2010) Wang et al. (2010) Li et al. (2006)
0.50
Ma et al. (2011)
Table 2 Coincidental rate between markers flanking RSC4, RSC8, or RSC14Q and inoculation in F3 population Markers BARCSOYSSR_14_1413+ BARCSOYSSR_14_1417+ BARCSOYSSR_14_1418 BARCSOYSSR_02_0606+ BARCSOYSSR_02_0610+ BARCSOYSSR_02_0616+ BARCSOYSSR_02_0618 Satt334+Sct_033+MY750 1)
2)
Total (no.) 293
Genotype tested by SSR1) (no.) RR+Rr rr 143 150
Phenotype of inoculation plants (no.) R S 136 140
MAS efficiency (%)2) R S 95.10 93.33
293
152
141
148
136
97.37
96.45
293
115
178
109
169
94.78
94.94
SSR, sequence repeat markers; RR, homozygous dominant genotype for resistance genes; Rr, heterozygous genotype for resistance genes; rr, homozygous recessive genotype for resistance genes. MAS, marker-assisted selection; R, resistant; S, susceptible.
2417
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
of molecular marker analysis. In total, 293 F3 plants from these 97 F2:3 families were genotyped using the 10 selected molecular markers specific for RSC4, RSC8, or RSC14Q, and were also confirmed for resistance to SMV strains SC4, SC8, or SC14. Results indicated that 143, 152, and 115 plants, respectively, consistently showed alleles for the selected corresponding markers, indicating the presence of all three SMV resistance genes, RSC4, RSC8, or RSC14Q, in these plants (Table 2). In the F4 generation, there were 29 plants that were homozygous and 94 that were heterozygous for resistance gene RSC4 were identified, compared to 33 and 25 homozygous plants and 92 and 97 heterozygous plants for resistance genes RSC8 and RSC14Q, respectively (Table 3). All 119 F5 plants were identified using linked molecular markers and screening for SMV resistance. Of these, 59, 62, and 57 plants homozygous for resistance genes RSC4, RSC8, and RSC14Q, respectively, were confirmed (Table 3). In F5:6 families, 53 F6 plants were confirmed to have homozygous alleles for the SMV resistance genes and desirable agronomic traits after dual selection.
3.3. Evaluation of resistance of the derived families to 21 SMV strains To further evaluate the resistance spectrum of the 53 pyramided families, 21 SMV strains of China were inoculated into the F6:7 and F7:8 families. These results showed that five pyramided families (from Nannong GPR501 to Nannong GPR505) were resistant to all 21 SMV strains (Table 4). Additionally, the five pyramided families had good quality traits and branching numbers, in addition to other favorable agronomic traits such as days to first flowering and seed shape (Table 5).
4. Discussion In this study, we confirmed that the markers used in MAS
showed high levels of efficiency, and the efficiency of the selection of resistant plants was more than 93%. The pyramided families obtained using MAS contained three SMV resistance genes, RSC4, RSC8, and RSC14Q, which conferred resistance to SMV strains SC4, SC8, and SC14, respectively. This resistance appears to be more durable and broad-spectrum if different resistance genes are combined (Saghai Maroof et al. 2008; Shi et al. 2009), implying that there is an additive effect on the overall level of resistance as a result of the presence of multiple resistance genes (Suh et al. 2013). Comparing the mapping region in our present study with the gene locations reported by Saghai Maroof et al. (2008) and Shi et al. (2009), some similarities exist. In our pyramided families, R genes (RSC4, RSC8, and RSC14Q) were combined using MAS from the donors in suppressing the SMV, while three R genes (Rsv1, Rsv3, and Rsv4) were transferred from other varieties in their study. According to the latest report and soybean reference genome GlymaWm82.a2.v1 (accessible at https://soybase.org/, verified 8th May, 2017), resistance genes RSC4 (the flanking markers genomic region 46 944 260–47 007 675 bp), and Rsv3 (the flanking markers genomic region 46 852 283–47 059 763 bp), RSC14Q (the flanking markers genomic region 29 609 521– 30 795 224 bp) and Rsv1 (the flanking markers genomic region 28 506 083–31 802 676 bp) might be the same or tightly linked resistance loci as they were located in the partly overlapped mapping regions in the different experiments (Gore et al. 2002; Shi et al. 2008; Ma et al. 2011; Suh et al. 2011; Wang et al. 2011; Li et al. 2016; Redekar et al. 2016); however, resistance genes RSC8 (the flanking markers genomic region 12 060 349–12 091 258 bp) and Rsv4 (the flanking markers genomic region 12 036 536–12 044 484 bp) might be two different resistance loci (Wang et al. 2011; Ilut et al. 2016; Zhao et al. 2016). The Rsv1 gene provides resistance to less virulent strains (G1–G4), the Rsv3 locus confers resistance against more aggressive stains (G5–G7), and genotypes carrying the
Table 3 Marker-assisted selection (MAS) efficiency when markers flanking RSC4, RSC8, or RSC14Q were co-used in F4 and F5 populations Markers BARCSOYSSR_14_1413+ BARCSOYSSR_14_1417+ BARCSOYSSR_14_1418 BARCSOYSSR_02_0610+ BARCSOYSSR_02_0610+ BARCSOYSSR_02_0616+ BARCSOYSSR_02_0610 Satt334+Sct_033+MY750 1)
2)
Population Total (no.)
Genotype tested by SSR1) (no.) RR Rr 29 94 59 60
Inoculation2) Phenotype No. of plants R 119 R 119
MAS efficiency (%)
F4 F5
127 119
96.75 100.00
F4 F5
127 119
33 62
92 57
R R
122 119
97.60 100.00
F4 F5
127 119
25 57
97 62
R R
118 119
96.72 100.00
SSR, sequence repeat markers; RR, homozygous dominant genotype for resistance genes; Rr, heterozygous genotype for resistance genes. R, resistant.
2418
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
Table 4 Responses of five pyramided families carrying three soybean mosaic virus (SMV) resistance genes and their parents against each of 21 SMV strains in China1) Strain SC1 SC2 SC3 SC4 SC5 SC6 SC7 SC8 SC9 SC10 SC11 SC12 SC13 SC14 SC15 SC16 SC17 SC18 SC19 SC20 SC21 1)
Nannong 1138-2 –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M
Qihuang 1
Kefeng 1
Dabaima
–/– –/– –/– –/– –/– –/– –/– –/– –/M –/M –/– –/– –/– –/– –/M –/– –/– –/– –/M –/– –/–
–/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/M –/M –/– –/M –/– –/– –/– –/–
–/– –/– –/– –/– –/– –/– –/– –/– –/MN –/– –/– –/– –/– –/M –/– –/– –/– –/– –/– –/– –/–
Nannong GPR501 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR502 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR503 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR504 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR505 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Data are from previous studies (Guo et al. 2005; Li et al. 2010). Reactions on inoculated primary leaves/reactions on non-inoculated upper leaves; –, symptomless; M, mosaic; N, necrosis.
Table 5 Performance of principal agronomic and grain quality traits of three pyramided families, which were selected as the most promising lines1) Variety or family2) Nannong 1138-2 Qihuang 1 Kefeng 1 Dabaima Nannong GPR501 Nannong GPR502 Nannong GPR503 Nannong GPR504 Nannong GPR505
CC
DFF (d)
FC
Yellow Yellow Yellow Yellow Yellow Yellow Yellow Yellow Yellow
49 33 35 33 48 48 48 48 46
Purple White White White Purple Purple Purple Purple White
DMP (d) 114 97 98 96 110 109 110 109 107
PH (cm) 55.30 53.60 49.50 79.90 83.40 54.60 85.20 55.30 76.70
NB
NSPP
SS
SCC
5.00 3.00 6.00 6.00 5.00 5.00 4.00 4.00 6.00
2.53 2.44 2.12 2.32 2.47 2.39 2.40 2.43 2.46
Oval Long oval Crescent Oval Long oval Oval Oval Oval Oval
Yellow Yellow Black Yellow Brown Yellow Yellow Yellow Yellow
PC (%) 44.10 46.90 43.90 44.80 46.30 46.80 46.70 46.80 43.40
OC (%) 20.40 19.30 19.60 20.80 21.00 18.90 18.85 18.95 20.50
100-GW (g) 19.43 11.12 7.33 14.93 11.00 10.95 13.36 12.26 14.52
1)
CC, cotyledon color; DFF, days to first flowering; FC, flowing color; DMP, days of mature period; PH, plant height; NB, number of branching; NSPP, number of seeds per pod; SS, seed shape; SCC, seed coat color; PC, protein content; OC, oil content; 100-GW, 100-grain weight. 2) Families Nannong GPR501 to Nannong GPR505 are pyramided families containing the three homozygous resistance genes RSC4, RSC8 and RSC14Q.
Rsv4 locus display effectiveness to most or all strains (G1– G7) identified in the previous assays (Klepadlo et al. 2017). The elite cultivars (Dabaima, Kefeng 1, and Qihuang 1), carrying RSC4, RSC8, and RSC14Q, respectively, were resistant to most SMV strains identified by Chinese differential hosts (Table 4) and also confer resistance to some or all the strains classified by other differentials in USA (G1–G7) (Cai et al. 2014). However, whether these resistance genes (Rsv1, Rsv3 and Rsv4) would function in Chinese SMV strains remains unclear. In addition, five F7 homozygous pyramided families pro-
vided resistance to all 21 strains of SMV in China (Table 4). On one hand, American researchers found that resistance to different SMV strains in soybean was conditioned by a single dominant gene (Yu et al. 1994; Hayes et al. 2000; Jeong et al. 2002). Hayes et al. (2000) found that the gene Rsv4 conferred resistance to SMV strains G1–G7. In China, Yang et al. (2013) reported that the resistance genes to SMV strains SC3, SC6, and SC17 in the soybean accession PI96983 all localized to a 345-kb region designated Rsc-pm on chromosome 13. In other words, the gene RSC4 may confer resistance to more SMV strains than SC4, in a
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
similar manner to RSC8 and RSC14Q. On the other hand, Li et al. (2010) reported that Qihuang 1 and Kefeng 1 were resistant to most SMV strains of China. Therefore, we inferred that Qihuang 1, Kefeng 1 or Dabaima, which contained resistance genes to different SMV strains, may be tightly linked. Using Kefeng 1 as resistant parent, Wang et al. (2011) mapped the resistance gene RSC8 to the region between BARCSOYSSR_02_0610 and BARCSOYSSR_02_0616 on chromosome 2; RSC10 was located on chromosome 2 with a distance of 0.9 cM from Satt634 and 0.8 cM from Gm020580 on the other side (Li et al. 2012). Yan et al. (2015) reported that the resistance gene for SC7 on chromosome 2 is flanked by the genomic-SSR markers BARCSOYSSR_02_0621 and BARCSOYSSR_02_0632. Li et al. (2015) found that the SC18 resistance gene in Kefeng 1 was delimited within the interval between the two markers, BARCSOYSSR_02_0667 and BARCSOYSSR_02_0670. Taken together, these results indicated that RSC7, RSC8, RSC10, and RSC18 were mapped on chromosome 2 and are tightly linked with each other, which was similar to the results identified by Yang et al. (2013). Nannong 1138-2 is widely grown and is the founder parent in the Yangtze River valley displaying susceptibility to all SMV strains. Here, we have pyramided three SMV resistance genes (RSC4+RSC8+RSC14Q) onto Nannong 1138-2 through MAS. In addition, we also obtained five homozygous pyramided families at the three resistance target loci (F6 and F7 progenies). The agronomic traits and quality performances of five pyramided families in the field and laboratory showed that most morphological traits were similar to those of the founder parent, Nannong 1138-2 (Table 5). Therefore, these pyramided families with improved disease resistance may be used as genetic stocks in a soybean breeding program that focuses on improving SMV resistance, which may in turn help to control the spread of SMV disease caused by different isolates of this pathogen.
Acknowledgements This work was supported by the National Natural Science Foundation of China (31571687, 31571690, and 31371646), the Natural Science Foundation of Anhui Province, China (1708085MC69), the Jiangsu Collaborative Innovation Center for Modern Crop Production, China (JCIC-MCP), and the Fund of Transgenic Breeding for Soybean Resistance to Soybean Mosaic Virus, China (2016ZX08004-004).
References Buss G R, Camper H M J, Roane C W. 1988. Registration of ‘Hutcheson’ soybean. Crop Science, 28, 1024–1025. Cai C M, J X, Zhao C M, Ma J X. 2014. Sequence analys is
2419
of the coat protein gene of Chinese soybean mosaic virus strain SC7and comparison with those of SMV strains from the USA. Chinese Journal of Virology, 30, 489–494. (in Chinese) Choi B K, Koo J M, Ahn H J, Yum H J, Choi C W. 2005. Emergence of Rsv-resistance breaking soybean mosaic virus isolates from Korean soybean cultivars. Virus Research, 112, 42–51. Fu S X, Zhan Y, Zhi H J, Gai J Y, Yu D Y. 2006. Mapping of SMV resistance gene Rsc-7 by SSR markers in soybean. Genetica, 128, 63–69. Gagarinova A G, Babu M, Poysa V, Hill J H, Wang A M. 2008. Identification and molecular characterization of two naturally occurring soybean mosaic virus isolates that are closely related but differ in their ability to overcome Rsv4 resistance. Virus Research, 138, 50–56. Gore M A, Hayes A J, Jeong S C, Yue Y G, Buss G R, Saghai Maroof M A. 2002. Mapping tightly linked genes controlling potyvirus infection at the Rsv1 and Rpv1 region in soybean. Genome, 45, 592–599． Guo D Q, Zhi H J, Wang Y W, Gai J Y, Zhou X A, Yang C L, Li K, Li H C. 2005. Identification and distribution of soybean mosaic virus strains in Middle and Northern Huang Huai Region of China. Chinese Journal of Oil Crop Sciences, 27, 64–68. (in Chinese) Hayes A J, Ma G, Buss G R, Saghai Maroof M A. 2000. Molecular marker mapping of Rsv4, a gene conferring resistance to all known strains of soybean mosaic virus. Crop Science, 40, 1434–1437. Ilut D C, Lipka A E, Jeong N, Dong N B, Dong H K, Ji H K, Redekar N, Yang K, Park W, Kang S T, Kim N, Moon J K, Saghai Maroof M A, Gore M A, Jeong S C. 2016. Identification of haplotypes at the Rsv4 genomic region in soybean associated with durable resistance to soybean mosaic virus. Theoretical and Applied Genetics, 129, 453–468. Jeong S C, Kristipati S, Hayes A J, Maughan P J, Noffsinger S L, Gunduz I, Buss G R, Saghai Maroof M A. 2002. Genetic and sequence analysis of markers tightly linked to the soybean mosaic virus resistance gene, Rsv3. Crop Science, 42, 265–270. Klepadlo M, Chen P Y, Shi A N, Mason R E, Korth K L, Srivastava V. 2017. Single nucleotide polymorphism markers for rapid detection of the Rsv4 locus for soybean mosaic virus resistance in diverse germplasm. Molecular Breeding, 37, 1–11. Koo J M, Choi B K, Ahn H J, Yum H J, Choi C W. 2005. First report of an Rsv resistance-breaking isolate of soybean mosaic virus in Korea. Plant Pathology, 54, 573. Li C Y, Yang Y Q, Wang D G, Li H W, Zheng G J, Wang T, Zhi H J. 2012. Studies on mapping and inheritance of resistance genes to SMV strain SC10 in soybean. Scientia Agricultura Sinica, 45, 4335–4342. (in Chinese) Li H C, Zhi H J, Gai J Y, Guo D Q, Wang Y W, Li K, Bai L, Yang H. 2006. Inheritance and gene mapping of resistance to soybean mosaic virus strain SC14 in soybean. Journal of Integrative Plant Biology, 48, 1466–1472. Li K, Ren R, Adhimoolam K, Gao L, Yuan Y, Liu Z T, Zhong Y K,
2420
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
Zhi H J, Morris B. 2015. Genetic analysis and identification of two soybean mosaic virus resistance genes in soybean [Glycine max. L. Merr]. Plant Breeding, 134, 129–134. Li K, Yang Q H, Zhi H J, Gai J Y. 2010. Identification and distribution of soybean mosaic virus strains in southern China. Plant Disease, 94, 351–357. Li N, Yin J L, Li C, Wang D G, Yang Y Q, Karthikeyan A, Luan H X, Zhi H J. 2016. NB-LRR gene family required for Rsc4mediated resistance to soybean mosaic virus. Crop and Pasture Science, 67, 541–552. Ma Y, Wang D G, Li H C, Zheng G J, Yang Y Q, Li H W, Zhi H J. 2011. Fine mapping of resistance gene RSC14Q to soybean mosaic virus based on residual heterozygous lines derived from a recombinant inbred line. Euphytica, 181, 127–135. Pedersen W L, Leath S. 1988. Pyramiding major genes for resistance to maintain residual effects. Annual Review of Phytopathology, 26, 369–378. Redekar N R, Clevinger E M, Laskar M A, Biyashev R M, Ashfield T, Jensen R V, Jeong S C, Tolin S A, Saghai Maroof M A. 2016. Candidate gene sequence analyses toward identifying Rsv3-type resistance to soybean mosaic virus. Plant Genome, 9, 1–12. Saghai Maroof M A, Jeong S C, Gunduz I, Tucker D M, Buss G R, Tolin S A. 2008. Pyramiding of soybean mosaic virus resistance genes by marker-assisted selection. Crop Science, 48, 517–526. Saghai Maroof M A, Soliman K M, Jorgensen R A, Allard R W. 1984. Ribosomal DNA spacer-length polymorphisms in barley, Mendelian inheritance, chromosomal location, and population dynamics. The Proceedings of the National Academy of Sciences of the United States of America, 81, 8014–8018. Saghai Maroof M A, Tucker D M, Skoneczka J A, Bowman B C, Tripathy S, Tolin S A. 2010. Fine mapping and candidate gene discovery of the soybean mosaic virus resistance gene, Rsv4. Plant Genome, 3, 14–22. Shi A N, Chen P Y, Li D X, Zheng C M, Zhang B, Hou A F. 2009. Pyramiding multiple genes for resistance to soybean mosaic virus in soybean using molecular markers. Molecular Breeding, 23, 113–124. Shi A N, Chen P Y, Zheng C M, Hou A F, Zhang B. 2008. A PCR–based marker for the Rsv1 locus conferring resistance to soybean mosaic virus. Crop Science, 48, 262–268. Smith T J. 1968. Registration of “York” soybean crop. Crop Science, 8, 776. Song Q J, Jia G F, Zhu Y L, David G, Rext T N, Eunyoung H, David L H, Cregan P B. 2010. Abundance of SSR motifs and development of candidate polymorphic SSR markers (BARCSOYSSR_1.0) in soybean. Crop Science, 50, 1950–1960.
Song Q J, Marek L F, Shoemaker R C, Lark K G, Concibido V C, Delannay X, Specht J E, Cregan P B. 2004. A new integrated genetic linkage map of the soybean. Theoretical and Applied Genetics, 109, 122–128. Suh J P, Jeung J U, Noh T H, Cho Y C, Park S H, Park H S, Shin M S, Kim C K, Jena K K. 2013. Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice. Rice, 6, 1–11. Suh S J, Bowman B C, Jeong N, Yang K, Kastl C, Tolin S A, Saghai Maroof M A, Jeong S C. 2011. The Rsv3 locus conferring resistance to soybean mosaic virus is associated with a cluster of coiled-coil nucleotide-binding leucine-rich repeat genes. The Plant Genome, 4, 55–64. Wang D G, Ma Y, Liu N, Yang Z L, Zheng G J, Zhi H J. 2011. Fine mapping and identification of the soybean R SC4 resistance candidate gene to soybean mosaic virus. Plant Breeding, 130, 653–659. Wang D G, Ma Y, Yang Y Q, Liu N, Li C Y, Song Y P, Zhi H J. 2010. Fine mapping and analyses of RSC8 resistance candidate genes to soybean mosaic virus in soybean. Theoretical and Applied Genetics, 122, 555–565. Yan H L, Wang H, Cheng H, Hu Z B, Chu S S, Zhang G Z, Yu D Y. 2015. Detection and fine-mapping of SC7 resistance genes via linkage and association analysis in soybean. Journal of Integrative Plant Biology, 57, 722–729. Yang Q H, Gai J Y. 2011. Identification, inheritance and gene mapping of resistance to a virulent soybean mosaic virus strain SC15 in soybean. Plant Breeding, 130, 128–132. Yang Y Q, Lin J, Zheng G J, Zhang M C, Zhi H J. 2014. Recombinant soybean mosaic virus is prevalent in Chinese soybean fields. Archives of Virology, 159, 1793–1796. Yang Y Q, Zheng G J, Han L, Wang D G, Yang X F, Yuan Y, Huang S H, Zhi H J. 2013. Genetic analysis and mapping of genes for resistance to multiple strains of soybean mosaic virus in a single resistant soybean accession PI96983. Theoretical and Applied Genetics, 126, 1783–1791. Yu Y G, Sahgai M A, Saghai Maroof M A, Buss G R, Maughan P J, Tolin S A. 1994. RFLP and microsatellite mapping of a gene for soybean mosaic virus resistance. Phytopathology, 84, 60–64. Zhao L, Wang D G, Zhang H Y, Shen Y C, Yang Y Q, Li K, Wang L Q, Yang Y H, Zhi H J. 2016. Fine mapping of the RSC8 locus and expression analysis of candidate SMV resistance genes in soybean. Plant Breeding, 135, 701–706. Zheng G J, Yang Y Q, Ma Y, Yang X F, Chen S Y, Ren R, Wang D G, Yang Z L, Zhi H J. 2014. Fine mapping and candidate gene analysis of resistance gene RSC3Q to soybean mosaic virus in Qihuang 1. Journal of Integrative Agriculture, 13, 2608–2615. (Managing editor WANG Ning)
ScienceDirect
RESEARCH ARTICLE
Marker-assisted pyramiding of soybean resistance genes RSC4, RSC8, and RSC14Q to soybean mosaic virus WANG Da-gang1, 2, ZHAO Lin1, LI Kai1, MA Ying1, WANG Li-qun1, YANG Yong-qing1, YANG Yun-hua1, ZHI Hai-jian1 1
College of Agriculture, Nanjing Agricultural University/National Center for Soybean Improvement/National Key Laboratory for Crop Genetics and Germplasm Enhancement, Nanjing 210095, P.R.China 2 Crop Institute, Anhui Academy of Agricultural Sciences/Anhui Key Laboratory of Crops Quality Improving, Hefei 230031, P.R.China
Abstract Soybean mosaic virus (SMV) is one of the major viral pathogens affecting soybean crops worldwide. Three SMV resistance genes, RSC4, RSC8, and RSC14Q, have been identified and mapped on soybean chromosomes 14, 2, and 13 from Dabaima, Kefeng 1, and Qihuang 1 cultivars, respectively. Soybean cultivar Nannong 1138-2 is widely grown in the Yangtze River Valley of China. In this study, crosses were made between Qihuang 1×Kefeng 1 and Dabaima×Nannong 1138-2. Ten simple sequence repeat (SSR) markers linked to three resistance loci (RSC4, RSC8, and RSC14Q) were used to assist pyramided breeding. Pyramided families containing three resistance loci (RSC4, RSC8, and RSC14Q) were evaluated by inoculating them with 21 SMV strains from China. Results indicated that the 10 markers can be used effectively to assist the selection of resistant individuals containing RSC4, RSC8, and RSC14Q. A total of 53 F6 plants were confirmed to contain three homozygous alleles conferring resistance to SMV. Five F7 homozygous pyramided families exhibited resistance to 21 strains of SMV and showed desirable agronomic traits using dual selection. The strategy of pyramiding resistance gene derived from different varieties has practical breeding value in providing broad-spectrum resistance against the existing strains of SMV in China. Keywords: soybean, soybean mosaic virus, resistance genes, pyramiding, marker-assisted breeding
and deficiencies in seed quality. The most effective way to
1. Introduction Soybean mosaic virus (SMV) is one of the most important and destructive viral diseases affecting soybean production worldwide, which can cause significant yield reductions
control the disease is to breed resistant varieties, which is a more economical and environmental friendly approach than chemical control strategies. Therefore, the development of resistant varieties against disease is a priority area in soybean breeding programs. Some single dominant resistance genes have been deployed in soybean cultivars by managing the incidence of SMV (Smith 1968; Buss et al. 1988). The breakdown of
Received 28 November, 2016 Accepted 11 May, 2017 WANG Da-gang, E-mail: [email protected]; Correspondence ZHI Hai-jian, Tel: +86-25-84396463, E-mail: [email protected] © 2017, CAAS. Publishing services by Elsevier B.V. All rights reserved. doi: 10.1016/S2095-3119(17)61682-4
resistance in soybean varieties has been reported, which is a consequence of evolutionary (i.e., genetic) changes associated with viral genomes in response to the deployment of resistant varieties with a single resistance gene (Choi et al. 2005; Koo et al. 2005; Gagarinova et al. 2008; Yang et al.
2414
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
2014). However, this can be delayed by pyramiding multiple resistance genes into soybean varieties. The pyramiding of resistance genes that originate from different parental lines can lead to a broader resistance spectrum, and thus the potential risk of a resistance breakdown would be reduced. Frequently, the pyramiding strategy, combining several resistance genes into one cultivar, has been proposed to enhance the durability of resistance (Pedersen and Leath 1988). However, gene pyramiding is highly timeconsuming and difficult using conventional breeding methods, as a result of genes that produce similar functional proteins in two or more strains being difficult to identify. However, the presence of molecular markers that are closely linked with each resistance gene makes the identification of plants with two and more resistance genes possible. The molecular marker-assisted pyramiding of multiple resistance genes into an elite variety, leading to the simultaneous expression of more than one gene, is a strategy that can prevent or delay the breakdown of resistance. The dominant expression of molecular markers that are linked to resistance genes can be used to track all possible resistance genes in any breeding program. SMV resistance genes Rsv1, Rsv3, and Rsv4 have been reported and fine-mapped to three different chromosomes (chr. 13, 14, and 2) (Yu et al. 1994; Hayes et al. 2000; Jeong et al. 2002; Shi et al. 2008; Saghai Maroof et al. 2010; Suh et al. 2011; Ilut et al. 2016). The pyramiding of Rsv1, Rsv3, and Rsv4 through marker-assisted selection (MAS) is an ideal method for creating durable and wide-spectrum resistance to all strains of SMV in the USA (Saghai Maroof et al. 2008). By doing so, Saghai Maroof et al. (2008) confirmed that soybean lines that contained two or three resistance genes displayed high levels of resistance to SMV. Shi et al. (2009) screened five soybean lines and found, by gene pyramiding, that they carried all three SMV homozygous resistance genes (Rsv1, Rsv3, and Rsv4) to create potentially durable resistance to SMV. To date, several monogenically controlled SMV resistance genes, including RSC3Q, RSC4, RSC7, RSC8, RSC14Q, RSC15, and RSC18, have been fine-mapped and assigned to at least four soybean chromosomes (Fu et al. 2006; Li et al. 2006; Wang et al. 2010, 2011; Ma et al. 2011; Yang and Gai 2011; Zheng et al. 2014; Li et al. 2015; Yan et al. 2015). To our knowledge, no report has been published regarding the use of this combination of SMV resistance genes in China. RSC4 was mapped onto soybean chromosome 14, and two genomic simple sequence repeat (SSR) markers, BARCSOYSSR_14_1413 and BARCSOYSSR_14_1417, were found to be tightly linked to RSC4 with distances of 0.18 and 0.58 cM, respectively (Wang et al. 2011). RSC8 is situated between BARCSOYSSR_02_0610 and BARCSOYSSR_02_0616 with a distance of 0.1 and 0.3 cM,
respectively (Wang et al. 2010). Another dominant SMV resistance gene, RSC14Q, was mapped onto soybean chromosome 13 with an approximate 4.2 cM interval between the markers Satt334 and Sct_033 (Li et al. 2006). Ma et al. (2011) further restricted RSC14Q to the interval of genetic distances of 0.6 and 0.5 cM flanked by the Satt334 and MY750 markers, using the screening of residual heterozygous lines. In this study, SSR markers were used to pyramid the SMV resistance genes RSC4, RSC8, and RSC14Q through MAS in available strains in China to confirm disease resistance. This study aimed to evaluate the effects of the MAS and eventually to create multi-resistance varieties for breeding program to counteract SMV in soybean.
2. Materials and methods 2.1. Plant materials Three SMV resistant soybean cultivars and one founder parent were used for pyramiding the three resistance genes, including Dabaima (RSC4), Kefeng 1 (RSC8), Qihuang 1 (RSC14Q), and Nannong 1138-2, which is widely grown in the Yangtze River Valley, China. The pyramiding scheme for the three SMV resistance genes is shown in Fig. 1. The four soybean parents were grown at the Jiangpu Experimental Station of Nanjing Agricultural University in 2006. Two crosses were made, between Qihuang 1×Kefeng 1 and Dabaima×Nannong 1138-2. Then, F1 plants of Qihuang 1×Kefeng 1 were crossed with F1 plants of Dabaima×Nannong 1138-2. The multi-cross F1 plants were grown in the field and harvested individually to produce F2 seeds. The F2 populations were grown in the field for DNA isolation and to produce F2:3 families. Qihuang 1×Kefeng 1 RSC14Q RSC8 F1
Dabaima× Nannong 1138-2 RSC4 ×
F1
F1 ⊗ F2 MAS selection from F2 to F6
⊗ F3 ⊗
Phenotypic selection at F3:4, F4:5, and F5:6
F6 Evaluation of resistance of the pyramided families to 21 SMV strains and agronomic traits at F6:7 and F7:8
Fig. 1 Scheme for the development of RSC4, RSC8, and RSC14Q gene-pyramided breeding families using marker-assisted selection (MAS). SMV, soybean mosaic virus.
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
Each F2:3 family were divided into four equal groups with 10–20 seeds. One group was grown in the field for DNA isolation and to produce F3:4 families. The remaining three groups were grown in an aphid-free greenhouse and inoculated with SMV strains, SC4, SC8, and SC14. A similar strategy was used to produce F4 to F7 populations. Genotyping analysis for pyramided genes was performed amongst each population from the F2 to F6 generation using MAS. The selection of relevant traits for yield and quality was also carried out and recorded for parents and F7 pyramided families. Five random plants from each family were sampled for phenotypic data acquisition, including cotyledon color, days to first flowering, flowering color, days of mature period (recorded after 95% pods matured), plant height, branching number, number of seeds per pod, seed shape, seed coat color, protein content, oil content, and 100-grain weight.
2.2. Virus preparation and inoculation SMV strains SC4, SC8, and SC14 were preserved on the SMV susceptible parent Nannong 1138-2 in an aphid-free greenhouse. The inoculum was prepared by grinding infected young leaves using a mortar and pestle in 0.01 mol L–1 sodium phosphate buffer (approx. 3–5 mL g–1 leaf tissue) at pH 7.2 with 600-mesh carborundum powder. At the unifoliate leaf stage, plants were inoculated with SMV strains SC4, SC8, and SC14 using the mechanical leaf inoculation method (Li et al. 2006). The symptoms were recorded 7 d after inoculation at 1-wk intervals for 2 mon. The main purpose of the inoculation test was to verify the results of molecular MAS.
at 72°C was allowed for the completion of primer extension. The amplified products were visualized after electrophoresis on an 8% polyacrylamide gel followed by silver staining, or on a 1% agarose gel followed by ethidium bromide staining (Wang et al. 2010). Ten SSR markers closely linked to SMV resistance genes were used to select the three resistance genes in the SMV resistance families; this was consecutively implemented from F3 to F6 generations. Three SSR markers were linked with RSC4 by 1 cM or less on chromosome 14 (Wang et al. 2011), and four SSR markers were adjacent to RSC8 on chromosome 2 (Wang et al. 2010). Two SSR markers on chromosome 13, Satt334 and Sct_033, were used to check the presence of RSC14Q (Li et al. 2006). According to fine mapping in the RSC14Q region from the Qihuang 1×Nannong 1138-2 residual heterozygous lines, another Indel marker MY750, closely linked to RSC14Q at a distance of approximately 0.5 cM (Ma et al. 2011), was also selected. All primer sequences are publicly available in previous papers (Song et al. 2004, 2010; Ma et al. 2011) or SoyBase (http://soybase.org/sbt/) (Table 1).
2.5. Evaluation of multi-strains to pyramided families Furthermore, to examine the resistance spectrum of the soybean families with the three pyramided resistance genes from F6 and F7 generations, F6:7 and F7:8 families were produced after selfing and then inoculated with 21 strains of SMV (SC1–SC21) in China using the method mentioned above. One of these strains, SC15 is the most virulent strain as it infects all 10 differentials (Li et al. 2010).
2.3. DNA extraction
3. Results
Genomic DNA was extracted from fresh leaves using the cetyltrimethyl ammonium bromide (CTAB) method (Saghai Maroof et al. 1984) with minor modifications (Wang et al. 2010). DNA was diluted to a concentration of 50 ng μL–1 prior to use in polymerase chain reaction (PCR).
3.1. MAS efficiency for the resistance genes
2.4. PCR analysis for MAS PCR was conducted in a total reaction mixture of 10 μL including approximately 50 ng of genomic DNA, 1×PCR buffer (50 mmol L–1 KCl, 10 mmol L–1 Tris-HCl, pH 8.0, 0.01% gelatin), 0.25 μmol L–1 of each primer, 0.2 mmol L–1 deoxy-ribonucleoside triphosphates (dNTPs), and 1 U Taq polymerase in distilled deionized water. Template DNA was initially denatured at 94°C for 5 min followed by 30 cycles of PCR amplification with the following parameters: 30 s of denaturation at 94°C, 50 s of primer annealing at 55°C, and 50 s of primer extension at 72°C. A final 10 min incubation
2415
Genotypes of F2 progenies obtained from multi-cross F1 plants were analyzed by 10 SSR markers closely linked with three resistance genes, RSC4, RSC8 or RSC14Q. The MAS efficiency of F2 was not evaluated by phenotype data after inoculating with SMV, as there were insufficient numbers of F2:3 families to inoculate three SMV strains. In the F3 population, the 143 resistant genotypes and 150 that showed susceptible genotypes were tested by markers BARCSOYSSR_14_1413, BARCSOYSSR_14_1417, and BARCSOYSSR_14_1418. Validation of the detected markers was performed in F3:4 families compared with the phenotype data collected by the inoculation of individuals with the SC4 SMV strain. Overall, 136 plants showed a resistant phenotype in a total of 143 resistance genotypic plants and 140 were susceptible in a total of 150 susceptible genotypic plants in the F3 population. The coincidental
2416
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
rates were 95.10 and 93.33%, respectively (Table 2). Based on the genotype and phenotype data, MAS efficiency for the resistant or susceptible plants to SC8 and SC14 were higher than 94% using BARCSOYSSR_02_0606, BARCSOYSSR_02_0610, BARCSOYSSR_02_0616, BARCSOYSSR_02_0618, and Satt334, Sct_033, MY750 (Table 2). In the 127 plants in the F4 population, a resistant genotype was exhibited by 123 F4 plants tested by three markers closely linked with resistance gene RSC4, and the phenotype of 121 resistant plants were identified by inoculation with SC4. The results indicated that the coincidental rate was 96.75% (Table 3). Simultaneously, for RSC8 and RSC14Q, the coincidental rates were 97.60 and 96.72%, respectively. Using markers closely linked with resistance genes RSC4, RSC8, or RSC14Q, the MAS efficiency for the resistant plants in the F5 population were all up to 100% based on the genotype and phenotype data (Table 3).
These results indicated that the resistance of the plants tested by the SSR markers closely linked with three resistance genes RSC4, RSC8, and RSC14Q showed high levels of consistency to the one by conventional inoculation (Li et al. 2010). Therefore, the 10 SSR markers can be used effectively in selecting resistance genes RSC4, RSC8, and RSC14Q instead of identification by inoculation.
3.2. Pyramiding SMV resistance genes through MAS The marker-assisted breeding approach was performed on F2 to select the plants with resistance alleles of the three target genes; only progenies with the resistance alleles were advanced for the next generation (Table 3). Phenotype analysis was performed in families of the next generation to verify the MAS. From the F2 generation, 97 plants were selected as having an allele of three resistance genes on the basis
Table 1 List of simple sequence repeat (SSR) markers used for gene-pyramiding analysis Gene Chr. RSC4
RSC8
RSC14Q
Marker
Forward primer (5´→3´)
Genetic distance (cM) CAGTTTCAATGCTGTGCATTTT 0.18 Reveres primer (5´→3´)
References
14 BARCSOYSSR_14_1413
CCTCGCGGTTCGTTTATTAT
14 BARCSOYSSR_14_1417
CATTCGAGAGTTGGAGGAGC
TTTTCCCAAGCAAGAAGGTG
0.68
14 BARCSOYSSR_14_1418 CACACAATATTTTGGGAATTTT ATCA 2 BARCSOYSSR_02_0606 CAACATGCTGTTTGGAGCAG
TGTTTTGGTTCTTAACACTTT CACA CGTTGCCAATCCTTTGATTT
1.07 0.40
2
BARCSOYSSR_02_0610
GATGGGGGAGTGGTCATTTA
AATACCCGTGGGTCCTTACC
0.10
2
BARCSOYSSR_02_0616
ACGTGTTTGATACAGGCTGC
CCAAGGCTCCATAACTGCAT
0.30
2
BARCSOYSSR_02_0618
TGCGCATTACGATGAATGTT
AGCAGGGTATGTGATCCAGC
0.50
13
Satt334 Sct_033
2.80
Li et al. (2006)
13
MY750
GCGAGTTTTTGGTTGGATTG AGTTG TGCTAATTTAGATTACGTT ATGT CAAGGGAAACTGAAGAT
1.40
13
GCGTTAAGAATGCATTTATGTT TAGTC CTTTTAAATTATAATAGCATG ATCT AAAAGCGAAGGGAAATA
Wang et al. (2011) Wang et al. (2011) Wang et al. (2011) Wang et al. (2010) Wang et al. (2010) Wang et al. (2010) Wang et al. (2010) Li et al. (2006)
0.50
Ma et al. (2011)
Table 2 Coincidental rate between markers flanking RSC4, RSC8, or RSC14Q and inoculation in F3 population Markers BARCSOYSSR_14_1413+ BARCSOYSSR_14_1417+ BARCSOYSSR_14_1418 BARCSOYSSR_02_0606+ BARCSOYSSR_02_0610+ BARCSOYSSR_02_0616+ BARCSOYSSR_02_0618 Satt334+Sct_033+MY750 1)
2)
Total (no.) 293
Genotype tested by SSR1) (no.) RR+Rr rr 143 150
Phenotype of inoculation plants (no.) R S 136 140
MAS efficiency (%)2) R S 95.10 93.33
293
152
141
148
136
97.37
96.45
293
115
178
109
169
94.78
94.94
SSR, sequence repeat markers; RR, homozygous dominant genotype for resistance genes; Rr, heterozygous genotype for resistance genes; rr, homozygous recessive genotype for resistance genes. MAS, marker-assisted selection; R, resistant; S, susceptible.
2417
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
of molecular marker analysis. In total, 293 F3 plants from these 97 F2:3 families were genotyped using the 10 selected molecular markers specific for RSC4, RSC8, or RSC14Q, and were also confirmed for resistance to SMV strains SC4, SC8, or SC14. Results indicated that 143, 152, and 115 plants, respectively, consistently showed alleles for the selected corresponding markers, indicating the presence of all three SMV resistance genes, RSC4, RSC8, or RSC14Q, in these plants (Table 2). In the F4 generation, there were 29 plants that were homozygous and 94 that were heterozygous for resistance gene RSC4 were identified, compared to 33 and 25 homozygous plants and 92 and 97 heterozygous plants for resistance genes RSC8 and RSC14Q, respectively (Table 3). All 119 F5 plants were identified using linked molecular markers and screening for SMV resistance. Of these, 59, 62, and 57 plants homozygous for resistance genes RSC4, RSC8, and RSC14Q, respectively, were confirmed (Table 3). In F5:6 families, 53 F6 plants were confirmed to have homozygous alleles for the SMV resistance genes and desirable agronomic traits after dual selection.
3.3. Evaluation of resistance of the derived families to 21 SMV strains To further evaluate the resistance spectrum of the 53 pyramided families, 21 SMV strains of China were inoculated into the F6:7 and F7:8 families. These results showed that five pyramided families (from Nannong GPR501 to Nannong GPR505) were resistant to all 21 SMV strains (Table 4). Additionally, the five pyramided families had good quality traits and branching numbers, in addition to other favorable agronomic traits such as days to first flowering and seed shape (Table 5).
4. Discussion In this study, we confirmed that the markers used in MAS
showed high levels of efficiency, and the efficiency of the selection of resistant plants was more than 93%. The pyramided families obtained using MAS contained three SMV resistance genes, RSC4, RSC8, and RSC14Q, which conferred resistance to SMV strains SC4, SC8, and SC14, respectively. This resistance appears to be more durable and broad-spectrum if different resistance genes are combined (Saghai Maroof et al. 2008; Shi et al. 2009), implying that there is an additive effect on the overall level of resistance as a result of the presence of multiple resistance genes (Suh et al. 2013). Comparing the mapping region in our present study with the gene locations reported by Saghai Maroof et al. (2008) and Shi et al. (2009), some similarities exist. In our pyramided families, R genes (RSC4, RSC8, and RSC14Q) were combined using MAS from the donors in suppressing the SMV, while three R genes (Rsv1, Rsv3, and Rsv4) were transferred from other varieties in their study. According to the latest report and soybean reference genome GlymaWm82.a2.v1 (accessible at https://soybase.org/, verified 8th May, 2017), resistance genes RSC4 (the flanking markers genomic region 46 944 260–47 007 675 bp), and Rsv3 (the flanking markers genomic region 46 852 283–47 059 763 bp), RSC14Q (the flanking markers genomic region 29 609 521– 30 795 224 bp) and Rsv1 (the flanking markers genomic region 28 506 083–31 802 676 bp) might be the same or tightly linked resistance loci as they were located in the partly overlapped mapping regions in the different experiments (Gore et al. 2002; Shi et al. 2008; Ma et al. 2011; Suh et al. 2011; Wang et al. 2011; Li et al. 2016; Redekar et al. 2016); however, resistance genes RSC8 (the flanking markers genomic region 12 060 349–12 091 258 bp) and Rsv4 (the flanking markers genomic region 12 036 536–12 044 484 bp) might be two different resistance loci (Wang et al. 2011; Ilut et al. 2016; Zhao et al. 2016). The Rsv1 gene provides resistance to less virulent strains (G1–G4), the Rsv3 locus confers resistance against more aggressive stains (G5–G7), and genotypes carrying the
Table 3 Marker-assisted selection (MAS) efficiency when markers flanking RSC4, RSC8, or RSC14Q were co-used in F4 and F5 populations Markers BARCSOYSSR_14_1413+ BARCSOYSSR_14_1417+ BARCSOYSSR_14_1418 BARCSOYSSR_02_0610+ BARCSOYSSR_02_0610+ BARCSOYSSR_02_0616+ BARCSOYSSR_02_0610 Satt334+Sct_033+MY750 1)
2)
Population Total (no.)
Genotype tested by SSR1) (no.) RR Rr 29 94 59 60
Inoculation2) Phenotype No. of plants R 119 R 119
MAS efficiency (%)
F4 F5
127 119
96.75 100.00
F4 F5
127 119
33 62
92 57
R R
122 119
97.60 100.00
F4 F5
127 119
25 57
97 62
R R
118 119
96.72 100.00
SSR, sequence repeat markers; RR, homozygous dominant genotype for resistance genes; Rr, heterozygous genotype for resistance genes. R, resistant.
2418
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
Table 4 Responses of five pyramided families carrying three soybean mosaic virus (SMV) resistance genes and their parents against each of 21 SMV strains in China1) Strain SC1 SC2 SC3 SC4 SC5 SC6 SC7 SC8 SC9 SC10 SC11 SC12 SC13 SC14 SC15 SC16 SC17 SC18 SC19 SC20 SC21 1)
Nannong 1138-2 –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M –/M
Qihuang 1
Kefeng 1
Dabaima
–/– –/– –/– –/– –/– –/– –/– –/– –/M –/M –/– –/– –/– –/– –/M –/– –/– –/– –/M –/– –/–
–/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/M –/M –/– –/M –/– –/– –/– –/–
–/– –/– –/– –/– –/– –/– –/– –/– –/MN –/– –/– –/– –/– –/M –/– –/– –/– –/– –/– –/– –/–
Nannong GPR501 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR502 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR503 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR504 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Nannong GPR505 –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/– –/–
Data are from previous studies (Guo et al. 2005; Li et al. 2010). Reactions on inoculated primary leaves/reactions on non-inoculated upper leaves; –, symptomless; M, mosaic; N, necrosis.
Table 5 Performance of principal agronomic and grain quality traits of three pyramided families, which were selected as the most promising lines1) Variety or family2) Nannong 1138-2 Qihuang 1 Kefeng 1 Dabaima Nannong GPR501 Nannong GPR502 Nannong GPR503 Nannong GPR504 Nannong GPR505
CC
DFF (d)
FC
Yellow Yellow Yellow Yellow Yellow Yellow Yellow Yellow Yellow
49 33 35 33 48 48 48 48 46
Purple White White White Purple Purple Purple Purple White
DMP (d) 114 97 98 96 110 109 110 109 107
PH (cm) 55.30 53.60 49.50 79.90 83.40 54.60 85.20 55.30 76.70
NB
NSPP
SS
SCC
5.00 3.00 6.00 6.00 5.00 5.00 4.00 4.00 6.00
2.53 2.44 2.12 2.32 2.47 2.39 2.40 2.43 2.46
Oval Long oval Crescent Oval Long oval Oval Oval Oval Oval
Yellow Yellow Black Yellow Brown Yellow Yellow Yellow Yellow
PC (%) 44.10 46.90 43.90 44.80 46.30 46.80 46.70 46.80 43.40
OC (%) 20.40 19.30 19.60 20.80 21.00 18.90 18.85 18.95 20.50
100-GW (g) 19.43 11.12 7.33 14.93 11.00 10.95 13.36 12.26 14.52
1)
CC, cotyledon color; DFF, days to first flowering; FC, flowing color; DMP, days of mature period; PH, plant height; NB, number of branching; NSPP, number of seeds per pod; SS, seed shape; SCC, seed coat color; PC, protein content; OC, oil content; 100-GW, 100-grain weight. 2) Families Nannong GPR501 to Nannong GPR505 are pyramided families containing the three homozygous resistance genes RSC4, RSC8 and RSC14Q.
Rsv4 locus display effectiveness to most or all strains (G1– G7) identified in the previous assays (Klepadlo et al. 2017). The elite cultivars (Dabaima, Kefeng 1, and Qihuang 1), carrying RSC4, RSC8, and RSC14Q, respectively, were resistant to most SMV strains identified by Chinese differential hosts (Table 4) and also confer resistance to some or all the strains classified by other differentials in USA (G1–G7) (Cai et al. 2014). However, whether these resistance genes (Rsv1, Rsv3 and Rsv4) would function in Chinese SMV strains remains unclear. In addition, five F7 homozygous pyramided families pro-
vided resistance to all 21 strains of SMV in China (Table 4). On one hand, American researchers found that resistance to different SMV strains in soybean was conditioned by a single dominant gene (Yu et al. 1994; Hayes et al. 2000; Jeong et al. 2002). Hayes et al. (2000) found that the gene Rsv4 conferred resistance to SMV strains G1–G7. In China, Yang et al. (2013) reported that the resistance genes to SMV strains SC3, SC6, and SC17 in the soybean accession PI96983 all localized to a 345-kb region designated Rsc-pm on chromosome 13. In other words, the gene RSC4 may confer resistance to more SMV strains than SC4, in a
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
similar manner to RSC8 and RSC14Q. On the other hand, Li et al. (2010) reported that Qihuang 1 and Kefeng 1 were resistant to most SMV strains of China. Therefore, we inferred that Qihuang 1, Kefeng 1 or Dabaima, which contained resistance genes to different SMV strains, may be tightly linked. Using Kefeng 1 as resistant parent, Wang et al. (2011) mapped the resistance gene RSC8 to the region between BARCSOYSSR_02_0610 and BARCSOYSSR_02_0616 on chromosome 2; RSC10 was located on chromosome 2 with a distance of 0.9 cM from Satt634 and 0.8 cM from Gm020580 on the other side (Li et al. 2012). Yan et al. (2015) reported that the resistance gene for SC7 on chromosome 2 is flanked by the genomic-SSR markers BARCSOYSSR_02_0621 and BARCSOYSSR_02_0632. Li et al. (2015) found that the SC18 resistance gene in Kefeng 1 was delimited within the interval between the two markers, BARCSOYSSR_02_0667 and BARCSOYSSR_02_0670. Taken together, these results indicated that RSC7, RSC8, RSC10, and RSC18 were mapped on chromosome 2 and are tightly linked with each other, which was similar to the results identified by Yang et al. (2013). Nannong 1138-2 is widely grown and is the founder parent in the Yangtze River valley displaying susceptibility to all SMV strains. Here, we have pyramided three SMV resistance genes (RSC4+RSC8+RSC14Q) onto Nannong 1138-2 through MAS. In addition, we also obtained five homozygous pyramided families at the three resistance target loci (F6 and F7 progenies). The agronomic traits and quality performances of five pyramided families in the field and laboratory showed that most morphological traits were similar to those of the founder parent, Nannong 1138-2 (Table 5). Therefore, these pyramided families with improved disease resistance may be used as genetic stocks in a soybean breeding program that focuses on improving SMV resistance, which may in turn help to control the spread of SMV disease caused by different isolates of this pathogen.
Acknowledgements This work was supported by the National Natural Science Foundation of China (31571687, 31571690, and 31371646), the Natural Science Foundation of Anhui Province, China (1708085MC69), the Jiangsu Collaborative Innovation Center for Modern Crop Production, China (JCIC-MCP), and the Fund of Transgenic Breeding for Soybean Resistance to Soybean Mosaic Virus, China (2016ZX08004-004).
References Buss G R, Camper H M J, Roane C W. 1988. Registration of ‘Hutcheson’ soybean. Crop Science, 28, 1024–1025. Cai C M, J X, Zhao C M, Ma J X. 2014. Sequence analys is
2419
of the coat protein gene of Chinese soybean mosaic virus strain SC7and comparison with those of SMV strains from the USA. Chinese Journal of Virology, 30, 489–494. (in Chinese) Choi B K, Koo J M, Ahn H J, Yum H J, Choi C W. 2005. Emergence of Rsv-resistance breaking soybean mosaic virus isolates from Korean soybean cultivars. Virus Research, 112, 42–51. Fu S X, Zhan Y, Zhi H J, Gai J Y, Yu D Y. 2006. Mapping of SMV resistance gene Rsc-7 by SSR markers in soybean. Genetica, 128, 63–69. Gagarinova A G, Babu M, Poysa V, Hill J H, Wang A M. 2008. Identification and molecular characterization of two naturally occurring soybean mosaic virus isolates that are closely related but differ in their ability to overcome Rsv4 resistance. Virus Research, 138, 50–56. Gore M A, Hayes A J, Jeong S C, Yue Y G, Buss G R, Saghai Maroof M A. 2002. Mapping tightly linked genes controlling potyvirus infection at the Rsv1 and Rpv1 region in soybean. Genome, 45, 592–599． Guo D Q, Zhi H J, Wang Y W, Gai J Y, Zhou X A, Yang C L, Li K, Li H C. 2005. Identification and distribution of soybean mosaic virus strains in Middle and Northern Huang Huai Region of China. Chinese Journal of Oil Crop Sciences, 27, 64–68. (in Chinese) Hayes A J, Ma G, Buss G R, Saghai Maroof M A. 2000. Molecular marker mapping of Rsv4, a gene conferring resistance to all known strains of soybean mosaic virus. Crop Science, 40, 1434–1437. Ilut D C, Lipka A E, Jeong N, Dong N B, Dong H K, Ji H K, Redekar N, Yang K, Park W, Kang S T, Kim N, Moon J K, Saghai Maroof M A, Gore M A, Jeong S C. 2016. Identification of haplotypes at the Rsv4 genomic region in soybean associated with durable resistance to soybean mosaic virus. Theoretical and Applied Genetics, 129, 453–468. Jeong S C, Kristipati S, Hayes A J, Maughan P J, Noffsinger S L, Gunduz I, Buss G R, Saghai Maroof M A. 2002. Genetic and sequence analysis of markers tightly linked to the soybean mosaic virus resistance gene, Rsv3. Crop Science, 42, 265–270. Klepadlo M, Chen P Y, Shi A N, Mason R E, Korth K L, Srivastava V. 2017. Single nucleotide polymorphism markers for rapid detection of the Rsv4 locus for soybean mosaic virus resistance in diverse germplasm. Molecular Breeding, 37, 1–11. Koo J M, Choi B K, Ahn H J, Yum H J, Choi C W. 2005. First report of an Rsv resistance-breaking isolate of soybean mosaic virus in Korea. Plant Pathology, 54, 573. Li C Y, Yang Y Q, Wang D G, Li H W, Zheng G J, Wang T, Zhi H J. 2012. Studies on mapping and inheritance of resistance genes to SMV strain SC10 in soybean. Scientia Agricultura Sinica, 45, 4335–4342. (in Chinese) Li H C, Zhi H J, Gai J Y, Guo D Q, Wang Y W, Li K, Bai L, Yang H. 2006. Inheritance and gene mapping of resistance to soybean mosaic virus strain SC14 in soybean. Journal of Integrative Plant Biology, 48, 1466–1472. Li K, Ren R, Adhimoolam K, Gao L, Yuan Y, Liu Z T, Zhong Y K,
2420
WANG Da-gang et al. Journal of Integrative Agriculture 2017, 16(11): 2413–2420
Zhi H J, Morris B. 2015. Genetic analysis and identification of two soybean mosaic virus resistance genes in soybean [Glycine max. L. Merr]. Plant Breeding, 134, 129–134. Li K, Yang Q H, Zhi H J, Gai J Y. 2010. Identification and distribution of soybean mosaic virus strains in southern China. Plant Disease, 94, 351–357. Li N, Yin J L, Li C, Wang D G, Yang Y Q, Karthikeyan A, Luan H X, Zhi H J. 2016. NB-LRR gene family required for Rsc4mediated resistance to soybean mosaic virus. Crop and Pasture Science, 67, 541–552. Ma Y, Wang D G, Li H C, Zheng G J, Yang Y Q, Li H W, Zhi H J. 2011. Fine mapping of resistance gene RSC14Q to soybean mosaic virus based on residual heterozygous lines derived from a recombinant inbred line. Euphytica, 181, 127–135. Pedersen W L, Leath S. 1988. Pyramiding major genes for resistance to maintain residual effects. Annual Review of Phytopathology, 26, 369–378. Redekar N R, Clevinger E M, Laskar M A, Biyashev R M, Ashfield T, Jensen R V, Jeong S C, Tolin S A, Saghai Maroof M A. 2016. Candidate gene sequence analyses toward identifying Rsv3-type resistance to soybean mosaic virus. Plant Genome, 9, 1–12. Saghai Maroof M A, Jeong S C, Gunduz I, Tucker D M, Buss G R, Tolin S A. 2008. Pyramiding of soybean mosaic virus resistance genes by marker-assisted selection. Crop Science, 48, 517–526. Saghai Maroof M A, Soliman K M, Jorgensen R A, Allard R W. 1984. Ribosomal DNA spacer-length polymorphisms in barley, Mendelian inheritance, chromosomal location, and population dynamics. The Proceedings of the National Academy of Sciences of the United States of America, 81, 8014–8018. Saghai Maroof M A, Tucker D M, Skoneczka J A, Bowman B C, Tripathy S, Tolin S A. 2010. Fine mapping and candidate gene discovery of the soybean mosaic virus resistance gene, Rsv4. Plant Genome, 3, 14–22. Shi A N, Chen P Y, Li D X, Zheng C M, Zhang B, Hou A F. 2009. Pyramiding multiple genes for resistance to soybean mosaic virus in soybean using molecular markers. Molecular Breeding, 23, 113–124. Shi A N, Chen P Y, Zheng C M, Hou A F, Zhang B. 2008. A PCR–based marker for the Rsv1 locus conferring resistance to soybean mosaic virus. Crop Science, 48, 262–268. Smith T J. 1968. Registration of “York” soybean crop. Crop Science, 8, 776. Song Q J, Jia G F, Zhu Y L, David G, Rext T N, Eunyoung H, David L H, Cregan P B. 2010. Abundance of SSR motifs and development of candidate polymorphic SSR markers (BARCSOYSSR_1.0) in soybean. Crop Science, 50, 1950–1960.
Song Q J, Marek L F, Shoemaker R C, Lark K G, Concibido V C, Delannay X, Specht J E, Cregan P B. 2004. A new integrated genetic linkage map of the soybean. Theoretical and Applied Genetics, 109, 122–128. Suh J P, Jeung J U, Noh T H, Cho Y C, Park S H, Park H S, Shin M S, Kim C K, Jena K K. 2013. Development of breeding lines with three pyramided resistance genes that confer broad-spectrum bacterial blight resistance and their molecular analysis in rice. Rice, 6, 1–11. Suh S J, Bowman B C, Jeong N, Yang K, Kastl C, Tolin S A, Saghai Maroof M A, Jeong S C. 2011. The Rsv3 locus conferring resistance to soybean mosaic virus is associated with a cluster of coiled-coil nucleotide-binding leucine-rich repeat genes. The Plant Genome, 4, 55–64. Wang D G, Ma Y, Liu N, Yang Z L, Zheng G J, Zhi H J. 2011. Fine mapping and identification of the soybean R SC4 resistance candidate gene to soybean mosaic virus. Plant Breeding, 130, 653–659. Wang D G, Ma Y, Yang Y Q, Liu N, Li C Y, Song Y P, Zhi H J. 2010. Fine mapping and analyses of RSC8 resistance candidate genes to soybean mosaic virus in soybean. Theoretical and Applied Genetics, 122, 555–565. Yan H L, Wang H, Cheng H, Hu Z B, Chu S S, Zhang G Z, Yu D Y. 2015. Detection and fine-mapping of SC7 resistance genes via linkage and association analysis in soybean. Journal of Integrative Plant Biology, 57, 722–729. Yang Q H, Gai J Y. 2011. Identification, inheritance and gene mapping of resistance to a virulent soybean mosaic virus strain SC15 in soybean. Plant Breeding, 130, 128–132. Yang Y Q, Lin J, Zheng G J, Zhang M C, Zhi H J. 2014. Recombinant soybean mosaic virus is prevalent in Chinese soybean fields. Archives of Virology, 159, 1793–1796. Yang Y Q, Zheng G J, Han L, Wang D G, Yang X F, Yuan Y, Huang S H, Zhi H J. 2013. Genetic analysis and mapping of genes for resistance to multiple strains of soybean mosaic virus in a single resistant soybean accession PI96983. Theoretical and Applied Genetics, 126, 1783–1791. Yu Y G, Sahgai M A, Saghai Maroof M A, Buss G R, Maughan P J, Tolin S A. 1994. RFLP and microsatellite mapping of a gene for soybean mosaic virus resistance. Phytopathology, 84, 60–64. Zhao L, Wang D G, Zhang H Y, Shen Y C, Yang Y Q, Li K, Wang L Q, Yang Y H, Zhi H J. 2016. Fine mapping of the RSC8 locus and expression analysis of candidate SMV resistance genes in soybean. Plant Breeding, 135, 701–706. Zheng G J, Yang Y Q, Ma Y, Yang X F, Chen S Y, Ren R, Wang D G, Yang Z L, Zhi H J. 2014. Fine mapping and candidate gene analysis of resistance gene RSC3Q to soybean mosaic virus in Qihuang 1. Journal of Integrative Agriculture, 13, 2608–2615. (Managing editor WANG Ning)